Invariant regions for the Nernst-Planck equations

We consider a coupling between the Nernst-Planck equations and the Navier-Stokes system; we study the stationary and the evolution problems. The crucial property turns out to be the existence of an invariant region. An asymptotic result in the case of Neumann boundary conditions is also given.     

Novel application of liquid chromatography/mass spectrometry for the characterization of drying oils in art: Elucidation on the composition of original paint materials used by Edvard Munch (1863–1944)

Modern oil paints, introduced at the beginning of the 20th century, differ from those classically used in antiquity in their chemical and compositional features. The main ingredients were still traditional drying oils, often used in mixtures with less expensive oils and added with several classes of additives. Consequently, detailed lipid profiling, together with the study of lipid degradation processes, is essential for the knowledge and the conservation of paint materials used in modern and contemporary art.     

A Sharp Upper Bound for the¶Torsional Rigidity of Rods¶by Means of Web Functions

Using web functions, we approximate the Dirichlet integral which represents the torsional rigidity of a cylindrical rod with planar convex cross-section Ω. To this end, we use a suitably defined piercing function, which enables us to obtain bounds for both the approximate and the exact value of the torsional rigidity. When Ω varies, we show that the ratio between these two values is always larger than ¾; we prove that this is a sharp lower bound and that it is not attained. Several extremal cases are also analyzed and studied by numerical methods.     

Acetylacetone, an interesting anchoring group for ZnO-based organic-inorganic hybrid materials: a combined experimental and theoretical study

Acetylacetone (acacH) adsorption on ZnO (10-10) surface has been studied by a theoretical periodic approach using density functional theory. Two dissociative adsorption modes were investigated and compared to the most stable adsorption mode of formic acid. Acetylacetone appears as a suitable anchoring group for hybrid materials, with adsorption energies of the same order of magnitude as formic acid. IR spectra of the acac/ZnO systems were computed in order to determine the spectral signature of adsorption and, possibly, of each adsorption mode to follow the coordination of acac on ZnO at the experimental level. The results have been compared to Fourier transform infrared (attenuated total reflection-IR) experimental spectra. The present investigation points out the interest of acetylacetone as an anchoring group for the development of new ZnO-based functionalized hybrid layers for corrosion protection, light emitting diodes, photocatalytic systems, and dye-sensitized solar cells.     

Total synthesis of the proposed structures of the DNA methyl transferase inhibitors peyssonenynes, and structural revision of peyssonenyne B

The purported structures of the peyssonenynes A and B isolated from Peyssonnelia caulifera, and considered to be geometric isomers at the acetoxyenediyne moiety, have been synthesized. The E and Z geometries of the synthetic compounds were secured by the magnitude of the (3)J(H9-C7) values measured using the EXSIDE band-variant of the gradient HSQC pulse sequence and by the chemical shifts of C(6). Comparison of the NMR data of the synthetic and natural products revealed that only those of the Z isomers matched, which correspond to peyssonenyne A. Using HPLC analysis it was found that peyssonenyne B must correspond to the sn-2 positional isomer of the Z sn-1/3 counterpart. The four synthetic sn-1/3 diastereomers are roughly equipotent as DNMT1 inhibitors when evaluated on a radioactive methyl transfer enzymatic assay after immunoprecipitation from K562 human leukemia cells with anti-DNMT1 antibody.     

Efficient organic monoliths prepared by γ-radiation induced polymerization in the evaluation of histone deacetylase inhibitors by capillary(nano)-high performance liquid chromatography and ion trap mass spectrometry

New monolithic HPLC columns were prepared by γ-radiation-triggered polymerization of hexyl methacrylate and ethylene glycol dimethacrylate monomers in the presence of porogenic solvents. Polymerization was carried out directly within capillary (250-200 μm I.D.) and nano (100-75 μm I.D.) fused-silica tubes yielding highly efficient columns for cap(nano)-LC applications. The columns were applied in the complete separation of core (H2A, H2B, H3, and H4) and linker (H1) histones under gradient elution with UV and/or electrospray ionization (ESI) ion trap mass spectrometry (MS) detections. Large selectivity towards H1, H2A-1, H2A-2, H2B, H3-1, H3-2 and H4 histones and complete separation were obtained within 8 min time windows, using fast gradients and very high linear flow velocities, up to 11 mm/s for high throughput applications. The method developed was the basis of a simple and efficient protocol for the evaluation of post-translational modifications (PTMs) of histones from NCI-H460 human non-small-cell lung cancer (NSCLC) and HCT-116 human colorectal carcinoma cells. The study was extended to monitoring the level of histone acetylation after inhibition of Histone DeACetylase (HDAC) enzymes with suberoylanilide hydroxamic acid (SAHA), the first HDAC inhibitor approved by the FDA for cancer therapy. Attractive features of our cap(nano)-LC/MS approach are the short analysis time, the minute amount of sample required to complete the whole procedure and the stability of the polymethacrylate-based columns. A lab-made software package ClustMass was ad hoc developed and used to elaborate deconvoluted mass spectral data (aligning, averaging, clustering) and calculate the potency of HDAC inhibitors, expressed through a Relative half maximal Inhibitory Concentration parameter, namely R_IC(50) and an averaged acetylation degree.     

Bergamot (<Emphasis Type="Italic">Citrus bergamia</Emphasis> Risso) fruit extracts and identified components alter expression of interleukin 8 gene in cystic fibrosis bronchial epithelial cell lines

Background  

Cystic fibrosis (CF) airway pathology is a fatal, autosomal, recessive genetic disease characterized by extensive lung inflammation. After induction by TNF-α, elevated concentrations of several pro-inflammatory cytokines (i.e. IL-6, IL-1β) and chemokines (i.e. IL-8) are released from airway epithelial cells. In order to reduce the excessive inflammatory response in the airways of CF patients, new therapies have been developed and in this respect, medicinal plant extracts have been studied. In this article we have investigated the possible use of bergamot extracts (Citrus bergamia Risso) and their identified components to alter the expression of IL-8 associated with the cystic fibrosis airway pathology.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.