Bergamot (<Emphasis Type="Italic">Citrus bergamia</Emphasis> Risso) fruit extracts and identified components alter expression of interleukin 8 gene in cystic fibrosis bronchial epithelial cell lines

Background  

Cystic fibrosis (CF) airway pathology is a fatal, autosomal, recessive genetic disease characterized by extensive lung inflammation. After induction by TNF-α, elevated concentrations of several pro-inflammatory cytokines (i.e. IL-6, IL-1β) and chemokines (i.e. IL-8) are released from airway epithelial cells. In order to reduce the excessive inflammatory response in the airways of CF patients, new therapies have been developed and in this respect, medicinal plant extracts have been studied. In this article we have investigated the possible use of bergamot extracts (Citrus bergamia Risso) and their identified components to alter the expression of IL-8 associated with the cystic fibrosis airway pathology.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Overdetermined problems with possibly degenerate ellipticity, a geometric approach

Given an open bounded connected subset Ω of ℝⁿ, we consider the overdetermined boundary value problem obtained by adding both zero Dirichlet and constant Neumann boundary data to the elliptic equation −div(A(|∇u|)∇u)=1 in Ω. We prove that, if this problem admits a solution in a suitable weak sense, then Ω is a ball. This is obtained under fairly general assumptions on Ω and A. In particular, A may be degenerate and no growth condition is required. Our method of proof is quite simple. It relies on a maximum principle for a suitable P-function, combined with some geometric arguments involving the mean curvature of ∂Ω.     

Filtering properties of defect-bearing periodic and triadic cantor multilayers

Defect-bearing periodic as well as pre-fractal dielectric multilayers can be designed to operate as narrow-band filters. For the same dielectric constituents and the same (or closest to same) number of layers, pre-fractal structures are remarkably better than the periodic ones, both in terms of filter bandwidth and transmittance peak, and are less sensitive to variations in the defect thickness. For structures having about 30 layers, optical losses do not significantly affect the filtering features of both morphologies if the loss tangent of the constituent materials is less than 10⁻⁵.     

Interior penalty method for the indefinite time-harmonic Maxwell equations

Summary In this paper, we introduce and analyze the interior penalty discontinuous Galerkin method for the numerical discretization of the indefinite time-harmonic Maxwell equations in the high-frequency regime. Based on suitable duality arguments, we derive a-priori error bounds in the energy norm and the L²-norm. In particular, the error in the energy norm is shown to converge with the optimal order (h^min{s,}) with respect to the mesh size h, the polynomial degree , and the regularity exponent s of the analytical solution. Under additional regularity assumptions, the L²-error is shown to converge with the optimal order (h⁺¹). The theoretical results are confirmed in a series of numerical experiments.Supported by the EPSRC (Grant GR/R76615).Supported by the Swiss National Science Foundation under project 21-068126.02.Supported in part by the Natural Sciences and Engineering Council of Canada.     

Solution phase synthesis of a library of tetrasubstituted pyrrole amides

An efficient strategy for the solution-phase parallel synthesis of a library of pyrrole-amides is described. Key reactions include functional homologation of beta-ketoesters with a set of aldehydes followed by oxidation to produce a series of differently substituted 1,4-dicarbonyl compounds. Rapid cyclization using a microwave-assisted Paal-Knorr reaction provided a set of 24 pyrrole esters that were further functionalized through a trimethylaluminum-mediated aminolysis to obtain a larger library of 288 diverse pyrrole-3-amides. The tetrasubstitution allows a good exploration of the chemical space around the central pyrrole core. The last step was entirely automated with a Bohdan Myriad personal synthesizer.     

A general procedure for the synthesis of stereochemically pure conduritol derivatives practical also for solid-phase chemistry

A straightforward synthetic protocol apt to synthesize a library constituted by all conduritol stereoisomers in solution phase is described and successfully applied to some polymer-supported substrates. During the solid-phase sequence, an unprecedented rearrangement of a resin-bound sulfone performed under the Ramberg-B?cklund conditions appears of particular interest. Upon treatment with Me(3)Si-I, thiepanes supported on resin are found to undergo regio- and stereospecific ring contraction to a six-membered ring system with traceless cleavage from the solid support.     

Experimental evidence of guided-resonances in photonic crystals with aperiodically ordered supercells

We report on the first experimental evidence of guided resonances (GRs) in photonic crystal slabs based on aperiodically ordered supercells. Using Ammann-Beenker (quasiperiodic, eightfold symmetric) tiling geometry, we present our study on the fabrication, experimental characterization, and full-wave numerical simulation of two representative structures (with different filling parameters) operating at near-IR wavelengths (1300-1600 nm). Our results show a fairly good agreement between measurements and numerical predictions and pave the way for the development of new strategies (based on, e.g., the lattice symmetry breaking) for GR engineering.