Low n-6/n-3 Gestation and Lactation Diets Influence Early Performance,Muscle and Adipose Polyunsaturated Fatty Acid Content and Deposition,and Relative Abundance of Proteins in Suckling Piglets

Elevated omega-6 (n-6) and omega-3 (n-3) polyunsaturated fatty acids (PUFAs) ratios in swine diets can potentially impose a higher risk of inflammatory and metabolic diseases in swine. A low ratio between the two omega PUFAs has beneficial effects on sows’ and piglets’ production performance and immunity status. At present, there are few studies on how sow nutrition directly affects the protein and fat deposition in suckling piglets. Two groups of sows were fed diets with high or low n-6/n-3 polyunsaturated ratios of 13:1 (SOY) and 4:1 (LIN), respectively, during gestation and lactation. Longissimus dorsi muscle and adipose tissue from newborn piglets, nourished only with sow’s milk, were subjected to fatty acid profiling by gas chromatography–mass spectrometry (GC-MS) and to proteomics assays based on nano-liquid chromatography coupled to high-resolution tandem mass spectrometry (nLC-HRMS). Fatty acid profiles on both muscle and adipose tissues resembled the magnitude of the differences between fatty acid across diets. Proteomic analysis revealed overabundance of 4 muscle and 11 adipose tissue proteins in SOY compared to LIN in both piglet tissues. The detected overabundance of haptoglobin, an acute-phase protein, and the stimulation of protein-coding genes and proteins related to the innate immune response and acute inflammatory response could be associated with the pro-inflammatory role of n-6 PUFAs.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Synergic approach to XAFS analysis for the identification of most probable binding motifs for mononuclear zinc sites in metalloproteins

In the present work a data analysis approach, based on XAFS data, is proposed for the identification of most probable binding motifs of unknown mononuclear zinc sites in metalloproteins. This approach combines multiple‐scattering EXAFS analysis performed within the rigid‐body refinement scheme, non‐muffin‐tin ab initio XANES simulations, average structural information on amino acids and metal binding clusters provided by the Protein Data Bank, and Debye–Waller factor calculations based on density functional theory. The efficiency of the method is tested by using three reference zinc proteins for which the local structure around the metal is already known from protein crystallography. To show the applicability of the present analysis to structures not deposited in the Protein Data Bank, the XAFS spectra of six mononuclear zinc binding sites present in diverse membrane proteins, for which we have previously proposed the coordinating amino acids by applying a similar approach, is also reported. By comparing the Zn K‐edge XAFS features exhibited by these proteins with those pertaining to the reference structures, key spectral characteristics, related to specific binding motifs, are observed. These case studies exemplify the combined data analysis proposed and further support its validity.     

The assay of pterostilbene in spiked matrices by liquid chromatography tandem mass spectrometry and isotope dilution method

Pterostilbene (trans‐3,5‐dimethoxy‐4‐hydroxystilbene) is an active component found in several plant species, exhibiting important pharmacological properties. A new and reliable method of assaying this phyto compound in various matrices is presented; the assay is based on (1) the selectivity of liquid chromatography (LC) hyphenated with electrospray ionisation (ESI), (2) the specificity of a two‐step mass spectrometric analysis (MS/MS) and (3) the accuracy of the isotope dilution method. The labelled analogue may be conveniently synthesised in a few steps. The sensitivity of the method is confirmed by the very low limit of detection (LOD) and limit of quantitation (LOQ) values achieved in the assay of pterostilbene in two distinct fortified matrices, and is further supported by the observed accuracy values. Copyright © 2010 John Wiley & Sons, Ltd.     

CHIRAL VARIANTS OF ARYLALKYL SULFUR REAGENTS. (R)-CAMPHOR KETIMINES OF OGIOVANNA AMINOTHIOETHERS AND OXIDES

Abstract

Ketimines la-d derived from ortho-aminosubstituted phenylthioethers were prepared in order to determine the degree of chirality transfer from the chiral auxiliary to the sulfur atom in the formation of the sulfoxide or to the α-carbon atom in the reaction of the anion with alkyl halides or benzaldehyde. Oxidation to the sulfoxide occurred with little or no asymmetric induction. The crystalline benzyl sulfone 4c was deprotonated by alkyllithium or Grignard reagents and reacted with alkyl halides and benzaldehyde, in all cases with little to fair transfer of chirality. The major diastereoisomer from methylation of the anion of 4c with methyl iodide, was isolated, and afforded the enantiomerically pure amine 5 after removal of the chiral auxiliary. An X-ray structure determination of 4d allowed the assignment of the absolute configuration of the asymmetric carbon and revealed that the conformation of the ketimine in the crystal state is not homogeneous.     

Evaluation of methoxy polyethylene glycol‐polylactide diblock copolymers as additive in hypromellose film coating

This paper deals with a new application of diblock methoxy polyethylene glycol‐polylactide block copolymers, a class of synthetic biomaterials largely studied in the pharmaceutical and biomedical fields owing to their favorable properties such as biocompatibility, biodegradability, low immunogenicity, and good mechanical properties. In this work, these materials were evaluated as additives for gastro‐soluble pharmaceutical coating aimed to reduce film stiffness and water permeability. Two copolymers with different polylactide chain lengths were synthesized and characterized in term of molecular weight and solid‐state properties. A series of free films with different hypromellose/copolymers ratio were prepared and characterized in terms of appearance, components miscibility, plasticity, and water vapor permeability. The obtained results demonstrate that copolymers effectively influence hypromellose film properties according to their concentration and molecular weight. Specifically, the addition of the copolymer with a molecular weight of 6.5 kDa in a ratio hypromellose:polymer 5:1, allowed to obtain films with good appearance, improved plasticization, and water permeability properties. For higher molecular weight, copolymer or different ratios was not possible to observe the improvement of all the properties at the same time. The results also make possible to define the critical features to improve in order to use block copolymers as additive in hypromellose film coating. The availability of new water‐soluble additives able to work as plasticizer and moisture sealer in polymeric films represents an important progress not only in the field of pharmaceutical coating but also in that of food coatings, as for example in the formulation of edible films. Copyright © 2013 John Wiley & Sons, Ltd.     

Synthesis,binding and fluorescence studies of a new neutral H-bonding receptor for anions based on 3,5-bis(trifluoromethyl)phenylurea

The synthesis and anion binding studies of the new neutral receptor 1,1′-(2,2′-(4,10-dimethyl-1,4,7,10-tetraazacyclododecane-1,7-diyl)bis(2-oxoethane-2,1-diyl))bis(3-(3,5-bis(trifluoromethyl)phenyl)urea) (L1) are reported. L1 is a macrocyclic ligand containing the 3,5-trifluoromethylphenylureido-binding fragment attached as a side arm on the tetraazacyclododecane. L1 is soluble in numerous organic solvents; the binding properties of L1 towards several simple anions (G) were investigated by NMR, UV–vis and fluorescence techniques in DMSO and CH₃CN solutions. L1 is able to bind F^? , Cl^?  and AcO^?  in both solvents; in addition, it binds Br^?  in CH₃CN. Fluoride shows the highest constant values in the halide series (F^?  > Cl^?  > Br^? ) and AcO^?  is the most strongly bound among all the anions investigated. L1 is able to signal the presence of the anions in solution by fluorescence change; in the case of acetate, this occurs in the visible range.     

Laser-Induced Azomethine Ylide Formation and Its Covalent Entrapment by Fulleropyrrolidine Derivatives During MALDI Analysis

Two novel monofunctionalized fulleropyrrolidine derivatives (Prato adducts) were prepared and characterized by matrix-assisted laser desorption/ionization (MALDI) and electrospray ionization (ESI). MALDI experiments conducted in the positive-ion mode on pure and mixed samples of both monofunctionalized fullerene derivatives revealed the efficient formation of bisadducts (in the case of the pure samples) and mixed bisadducts (in the case of a mixed sample). Bisadducts were not observed in the ESI experiments and thus not present in the sample. A mechanism for the MALDI formation of these bisadduct ions is proposed in which an azomethine ylide fragment is formed in situ from the monofunctionalized fulleropyrrolidine species upon laser irradiation. This fragment, which can survive as an intact moiety in the gas phase in the special environment provided by the MALDI experiment, is then able to attach to a fulleropyrrolidine monoadduct which acts as a dipolarophile, thus leading to the formation of a bisadduct fullerene derivative. The unprecedented re-attachment of the azomethine ylide implies that the establishment of the ligand attainment of Prato adducts based on MALDI analysis alone can lead to wrong assignments.