Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Influence of surface heterogeneity in electroosmotic flows—Implications in chromatography, fluid mixing, and chemical reactions in microdevices

We analyze the influence of surface heterogeneity, inducing a random ζ-potential at the walls in electroosmotic incompressible flows. Specifically, we focus on how surface heterogeneity modifies the physico-chemical processes (transport, chemical reaction, mixing) occurring in microchannel and microreactors. While the macroscopic short-time features associated with solute transport (e.g. chromatographic patterns) do not depend significantly on ζ-potential heterogeneity, spatial randomness in the surface ζ-potential modifies the spectral properties of the advection-diffusion operator, determining different long-term properties of transport/reaction phenomena compared to the homogeneous case. Examples of physical relevance (chromatography, infinitely fast reactions) are addressed.     

PLA Nanofibers for Microenvironmental-Responsive Quercetin Release in Local Periodontal Treatment

The management of periodontitis remains a vital clinical challenge due to the interplay between the microorganisms of the dental biofilm and the host inflammatory response leading to a degenerative process in the surrounding tissues. Quercetin (QUE), a natural flavonol found in many foods, including apples, onions and tea, has exhibited prolonged and strong antibiofilm and anti-inflammatory effects both in vitro and in vivo. However, its clinical application is limited by its poor stability and water solubility, as well as its low bioavailability. Thus, in the present study, electrospun polylactic acid (PLA) nanofibers loaded with different amounts (5–10% w/w) of QUE were produced to rapidly respond to the acidic microenvironment typical of periodontal pockets during periodontal disease. This strategy demonstrated that PLA-QUE membranes can act as a drug reservoir releasing high QUE concentrations in the presence of oral bacterial infection (pH < 5.5), and thus limiting Pseudomonas aeruginosa PAO1 and Streptococcus mutans biofilm maturation. In addition, released QUE exerts antioxidant and anti-inflammatory effects on P. gingivalis Lipopolysaccharide (LPS)-stimulated human gingival fibroblast (HGFs). The reported results confirmed that PLA-QUE membranes could inhibit subgingival biofilm maturation while reducing interleukin release, thereby limiting host inflammatory response. Overall, this study provided an effective pH-sensitive drug delivery system as a promising strategy for treating periodontitis.     

Effect of Tomato Peel Extract Grown under Drought Stress Condition in a Sarcopenia Model

Tomatoes and their derivates represent an important source of natural biologically active components. The present study aims to investigate the protective effect of tomato peel extracts, grown in normal (RED-Ctr) or in drought stress (RED-Ds) conditions, on an experimental model of sarcopenia. The phenolic profile and total polyphenols content (TPC) of RED-Ctr and RED-Ds were determined by Ultra High-Performance Liquid Chromatography (UHPLC) analyses coupled to electrospray ionization high-resolution mass spectrometry (ESI-HR-MS). Human skeletal muscle myoblasts (HSMM) were differentiated in myotubes, and sarcopenia was induced by dexamethasone (DEXA) treatment. Differentiation and sarcopenia were evaluated by both real-time PCR and immunofluorescent techniques. Data show that myosin heavy chain 2 (MYH2), troponin T (TNNT1), and miogenin (MYOG) were expressed in differentiated myotubes. 5 μg Gallic Acid Equivalent (GAE/mL) of TPC from RED-Ds extract significantly reduced muscle atrophy induced by DEXA. Moreover, Forkhead BoxO1 (FOXO1) expression, involved in cell atrophy, was significantly decreased by RED-Ds extract. The protective effect of tomato peel extracts depended on their qualitative polyphenolic composition, resulting effectively in the in vitro model of sarcopenia.     

Comparison of analytical methods for the quality control of a new formulation containing soy extract and melatonin

Three analytical methods have been developed and compared for the quality control of a new formulation (Soymen GN(R) capsules) containing soy extract and melatonin for the treatment of menopausal symptoms. The first method is based on MEKC with diode-array detection, using a mixture of basic carbonate buffer (95%) and methanol (5%), containing 55 mM SDS, as the BGE. The second method is an HPLC method with UV detection at 260 nm. The third method is an HPLC method coupled to amperometric detection which is carried out at an oxidation potential of +0.8 V. In both HPLC systems, the chromatographic separation is obtained on an RP C18 column using a mixture of ACN and an acidic phosphate buffer (25:75 v/v) as the mobile phase. A feasible pretreatment procedure with a methanol/water mixture has been implemented to achieve the quantitative extraction of the main soy isoflavones and of melatonin from the capsules. The results obtained with the three methods are in good agreement with each other and satisfactory in terms of linearity (r(2) >0.9996), precision (RSD <5.4%) and accuracy (recovery >97%). Thus, each of the three analytical methods seems to be suitable for the simultaneous analysis of the main soy isoflavones and melatonin in the new commercial formulation.     

Geometric Hermite interpolation by spatial Pythagorean-hodograph cubics

It is shown that, depending upon the orientation of the end tangents t₀,t₁ relative to the end point displacement vector p=p₁–p₀, the problem of G¹ Hermite interpolation by PH cubic segments may admit zero, one, or two distinct solutions. For cases where two interpolants exist, the bending energy may be used to select among them. In cases where no solution exists, we determine the minimal adjustment of one end tangent that permits a spatial PH cubic Hermite interpolant. The problem of assigning tangents to a sequence of points p₀,...,p_n in R³, compatible with a G¹ piecewise-PH-cubic spline interpolating those points, is also briefly addressed. The performance of these methods, in terms of overall smoothness and shape-preservation properties of the resulting curves, is illustrated by a selection of computed examples.     

Acoustic waveguide filters made up of rigid stacked materials with elastic joints

Meccanica - The acoustic dispersion properties of monodimensional waveguide filters can be assessed by means of the simple prototypical mechanical system made of an infinite stack of periodic...