The dimeric and tetrameric octarepeat fragments of prion protein behave differently to its monomeric unit

Potentiometric and spectroscopic data have shown that octarepeat dimer and tetramer are much more effective ligands for Cu(II) ions than simple octapeptide. Thus, the whole N-terminal segment of prion protein due to cooperative effects, could be more effective in binding of Cu(II) than simple peptides containing a His residue. The gain of the Cu(II) binding by longer octarepeat peptides derives from the involvement of up to four imidazoles in the coordination of the first Cu(II) ion. This type of binding increases the order of the peptide structure, which allows successive metal ions for easier coordination.     

Liquid—liquid extraction and determination of uranium(IV) with 2,6-diacetylpyridine bis(benzoylhydrazone)

2,6-Diacetylpyridine bis(benzoylhydrazone) (H₂DPBH) is proposed as a ligand for the extraction of uranium(VI). Complete extraction from aqueous solutions into dichloromethane is achieved with a ligand/metal mole ratio of < for 10^?5?10^?4 M uranyl ion. Potentiometric measurements indicate that the extracted species is UO₂ (DPBH). Uranium can be determined in the extract by spectrophotometric measurements at 420 nm and by differentail pulse polarography (E_p = ?0.67 V) with tetraethylammonium bromide as supporting electrolyte. For both methods, the detection limit is about 2 × 10^?6 M in the extract.     

A dysprosium single molecule magnet outperforming current pseudocontact shift agents

A common criterion for designing performant single molecule magnets and pseudocontact shift tags is a large magnetic anisotropy. In this article we present a dysprosium complex chemically designed to exhibit strong easy-axis type magnetic anisotropy that is preserved in dichloromethane solution at room temperature. Our detailed theoretical and experimental studies on the magnetic properties allowed explaining several features typical of highly performant SMMs. Moreover, the NMR characterization shows remarkably large chemical shifts, outperforming the current state-of-the art PCS tags.

A robust dysprosium(iii) single molecule magnet with large uniaxial magnetic anisotropy induces pseudocontact shifts at almost doubled distance compared to standard shift agents.     

Within the Ischemic Penumbra,Sub-Cellular Compartmentalization of Heat Shock Protein 70 Overlaps with Autophagy Proteins and Fails to Merge with Lysosomes

The brain area which surrounds the frankly ischemic region is named the area penumbra. In this area, most cells are spared although their oxidative metabolism is impaired. area penumbra is routinely detected by immunostaining of a molecule named Heat Shock Protein 70 (HSP70). Within the area penumbra, autophagy-related proteins also increase. Therefore, in the present study, the autophagy-related microtubule-associated protein I/II-Light Chain 3 (LC3) was investigated within the area penumbra along with HSP70. In C57 black mice, ischemia was induced by permanent occlusion of the distal part of the middle cerebral artery. Immunofluorescence and electron microscopy show that LC3 and HSP70 are overexpressed and co-localize within the area penumbra in the same cells and within similar subcellular compartments. In the area penumbra, marked loss of co-localization of HSP70 and LC3-positive autophagy vacuoles, with lysosomal-associated membrane protein 1 (LAMP1) or cathepsin-D-positive lysosome vacuoles occurs. This study indicates that, within the area penumbra, a failure of autophagolysosomes depends on defective compartmentalization of LC3, LAMP1 and cathepsin-D and a defect in merging between autophagosomes and lysosomes. Such a deleterious effect is likely to induce a depletion of autophagolysosomes and cell clearing systems, which needs to be rescued in the process of improving neuronal survival.     

New Chemotypes for the Inhibition of (p)ppGpp Synthesis in the Quest for New Antimicrobial Compounds

Antimicrobial resistance (AMR) poses a serious threat to our society from both the medical and economic point of view, while the antibiotic discovery pipeline has been dwindling over the last decades. Targeting non-essential bacterial pathways, such as those leading to antibiotic persistence, a bacterial bet-hedging strategy, will lead to new molecular entities displaying low selective pressure, thereby reducing the insurgence of AMR. Here, we describe a way to target (p)ppGpp (guanosine tetra- or penta-phosphate) signaling, a non-essential pathway involved in the formation of persisters, with a structure-based approach. A superfamily of enzymes called RSH (RelA/SpoT Homolog) regulates the intracellular levels of this alarmone. We virtually screened several fragment libraries against the (p)ppGpp synthetase domain of our RSH chosen model Rel_Seq, selected three main chemotypes, and measured their interaction with Rel_Seq by thermal shift assay and STD-NMR. Most of the tested fragments are selective for the synthetase domain, allowing us to select the aminobenzoic acid scaffold as a hit for lead development.     

The Potential of Lamiaceae Herbs for Mitigation of Overweight,Obesity, and Fatty Liver: Studies and Perspectives

Numerous plants, plant extracts, and plant-derived compounds are being explored for their beneficial effects against overweight and liver diseases. Obesity is associated with the increased prevalence of non-alcoholic fatty liver disease (NAFLD), becoming the most common liver disease in Western countries. Obesity and NAFLD are closely associated with many other metabolic alternations such as insulin resistance, diabetes mellitus, and cardiovascular diseases. Many herbs of the Lamiaceae family are widely employed as food and spices in the Mediterranean area, but also in folk medicine, and their use for the management of metabolic disorders is well documented. Hereby, we summarized the scientific results of the medicinal and nutraceutical potential of plants from the Lamiaceae family for prevention and mitigation of overweight and fatty liver. The evidence indicates that Lamiaceae plants may be a cost-effective source of nutraceuticals and/or phytochemicals to be used in the management of metabolic-related conditions such as obesity and NAFLD. PubMed, Google Scholar, Scopus, and SciFinder were accessed to collect data on traditional medicinal plants, compounds derived from plants, their reported anti-obesity mechanisms, and therapeutic targets.     

Ultrastructural Damages to H1N1 Influenza Virus Caused by Vapor Essential Oils

Influenza viruses are transmitted from human to human via airborne droplets and can be transferred through contaminated environmental surfaces. Some works have demonstrated the efficacy of essential oils (EOs) as antimicrobial and antiviral agents, but most of them examined the liquid phases, which are generally toxic for oral applications. In our study, we describe the antiviral activity of Citrus bergamia, Melaleuca alternifolia, Illicium verum and Eucalyptus globulus vapor EOs against influenza virus type A. In the vapor phase, C. bergamia and M. alternifolia strongly reduced viral cytopathic effect without exerting any cytotoxicity. The E. globulus vapor EO reduced viral infection by 78% with no cytotoxicity, while I. verum was not effective. Furthermore, we characterized the EOs and their vapor phase by the head-space gas chromatography–mass spectrometry technique, observing that the major component found in each liquid EO is the same one of the corresponding vapor phases, with the exception of M. alternifolia. To deepen the mechanism of action, the morphological integrity of virus particles was checked by negative staining transmission electron microscopy, showing that they interfere with the lipid bilayer of the viral envelope, leading to the decomposition of membranes. We speculated that the most abundant components of the vapor EOs might directly interfere with influenza virus envelope structures or mask viral structures important for early steps of viral infection.     

A longitudinal study of MR diffusion changes in normal appearing white matter of patients with early multiple sclerosis

BACKGROUND AND PURPOSE: The stage at which normal appearing white matter (NAWM) abnormalities first appear in multiple sclerosis (MS) is not clear. The aim of our study was to monitor water diffusion changes over time in NAWM of patients with early MS.METHODS: Out of a consecutive series of patients enrolled in a MR study on clinically isolated syndrome (CIS), we selected 19 subjects who had completed a one year follow-up. The MR scans obtained at baseline and at 12 months were reviewed according to the new criteria on the diagnosis of MS. Lesion load on T2 and T1 weighted images and the trace of the apparent diffusion coefficient in NAWM were measured both at baseline and at 12 months in patients and in 12 healthy controls.RESULTS: In three patients the diagnosis of MS was done at baseline based on MR. Thirteen patients developed MS during the study and in three patients the diagnosis remained "possible MS." TADC in NAWM in patients was significantly higher than in controls at the 12 months' follow-up but not at baseline (controls mean tADC +/- sd = 0.745 +/- 0.02 mm(2)/sec x 10(-3); patients mean tADC(12) +/- sd = 0.767 +/- 0.02 mm(2)/sec x 10(-3); p < 0.02). TADC and T2 lesion load at 12 months were significantly correlated (p < 0.01). Patients exhibiting tADC(12) above a confidence interval had a significantly greater EDSS score at the same time period (EDSS(12) +/- sd = 1.9 +/- 0.5 and = 1.1 +/- 0.4 respectively; p < 0.01).CONCLUSIONS: This study suggests that diffusion MR cannot detect alterations in NAWM of patients with a CIS suggestive of MS. After one year, when most patients develop MS, diffusion MR abnormalities in NAWM become apparent. These abnormalities are correlated with T2 lesion load and may contribute to neurological impairment.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.