Influence of rotation and isotope effects on the dynamics of the N((2)D)+H(2) reactive system and of its deuterated variants

Integral cross sections and thermal rate constants have been calculated for the N((2)D)+H(2) reaction and its isotopic variants N((2)D)+D(2) and the two-channel N((2)D)+HD by means of quasiclassical trajectory and statistical quantum-mechanical model methods on the latest ab initio potential-energy surface [T.-S. Ho et al., J. Chem. Phys. 119, 3063 (2003)]. The effect of rotational excitation of the diatom on the dynamics of these reactions has been investigated and interesting discrepancies between the classical and statistical model calculations have been found. Whereas a net effect of reagent rotation on reactivity is always observed in the classical calculations, only a very slight effect is observed in the case of the asymmetric N((2)D)+HD reaction for the statistical quantum-mechanical method. The thermal rate constants calculated on this Potential-Energy Surface using quasiclassical trajectory and statistical model methods are in good agreement with the experimental determinations, although the latter are somewhat larger. A reevaluation of the collinear barrier of the potential surface used in the present study seems timely. Further theoretical and experimental studies are needed for a full understanding of the dynamics of the title reaction.     

Accurate intermolecular ground state potential of the Ar-N2 van der Waals complex

After carrying out a systematic basis set convergence study, we evaluate several ground state potential energy surfaces of the Ar-N(2) van der Waals complex at the coupled cluster singles and doubles model including connected triples corrections. We use the aug-cc-pVXZ (X=5,Q,D) and the daug-cc-pVQZ basis sets augmented with a set of 3s3p2d1f1g (denoted 33211) and 3s3p2d2f1g (denoted 33221) midbond functions, respectively. aug-cc-pVTZ-33211 results were available in the literature. The aug-cc-pV5Z-33211 (daug-cc-pVQZ-33221) surface is characterized by a T-shaped minimum at R(e)=3.709 (3.701) A and of 99.01 (102.50) cm(-1), and a linear saddle point at 4.260 (4.257) A and D(e)=75.28 (79.73) cm(-1). These results are compared with the values provided by the semiempirical potentials available, and those of previous theoretical studies. The basis set convergence of the intermolecular potentials is also analyzed. From the potentials the rovibronic spectroscopic properties are determined. We study the basis set convergence of the rotational frequencies. The binding parameters that characterized the aug-cc-pVTZ-33211 surface are reasonable, but the surface is not good enough to evaluate the microwave spectra. The aug-cc-pVQZ-33211 basis set results considerably improve the triple zeta and are close to the aug-cc-pV5Z-33211. Considering the small differences between the quadruple and the quintuple zeta surfaces, the latter results can be expected to be close to convergence. At this level the differences with respect to the accurate experimental frequencies are in the order of 0.7%. In the case of the daug-cc-pVXZ-33211,33221 (X=5,Q,T,D) series, the convergence of the interaction energies with respect to basis set improvement is not so smooth. The errors in the frequencies obtained with the daug-cc-pVQZ-33221 basis set with respect to experiment are in the order of 0.4%.     

Eine semiempirische Gleichung zur Beschreibung des Lösungsmitteleinflusses auf Statik und Kinetik chemischer Reaktionen. Teil I

A model has been developed for calculating the enthalpy, entropy and free energy change associated with the creation of cavities in a liquid the size of which corresponds to the volume occupied by a solvent molecule. The molar enthalpy change H _cav equals the molar enthalpy of vaporization of the liquid, the free energy change G _cav is given by G _cav=–RT ln (V _m ·p _eq /RT) (V _m =molar volume,p _eq =equilibrium vapor pressure) and is related to the standard free energy of vaporization. This relationship provides an estimate of the free energy of cavity formation required to accomodate a substrate in the liquid. It has been shown, that the free energy of solvation of a substrate can be dissected into different contributions accounting for (1) the concentration dependence of partial molar free energy quantities, (2) the formation of holes in the solvent, (3) the existence of specific, short range solute-solvent interactions and (4) the dielectric polarization of the medium. Application of this concept leads to an equation of the general form G ^S –G ^R =a(DN ^S –DN ^R )+b(AN ^S –AN ^R )+c(G _vp ^oS –G _vp ^oR ), where G represents the free energy of reaction or activation,DN the donor number,AN the acceptor number and G _vp ^o the standard free energy of vaporization of a solventS and a reference solventR, resp.

---

---

Mit 3 Abbildungen     

Excitation functions of proton induced nuclear reactions on natural tellurium up to 18 MeV for validation of isotopic cross sections

Summary Excitation functions of proton induced nuclear reactions on natural Te were investigated up to 18 MeV. Cross sections for production of ^{121,123,124,126,128,130g}I and ^121gTe were measured. The new experimental data were compared with the results of ALICE-IPPE model calculations and with data found in the literature and measured on natural or enriched Te targets. The new data can be effectively used for validation of recommended cross sections of medically relevant ¹²³I and ¹²⁴I.     

Concise Synthesis and Antimicrobial Activities of New Substituted 5‐Isoxazolpenicillins

The synthesis of a series of new 5‐isoxazolpenicillins is described, which were obtained by coupling substituted isoxazoles with 6‐APA. Concise large‐scale synthesis of 3,5‐disubstituted isoxazoles by 1,3‐dipolar cycloaddition using copper(I) as catalyst was also investigated. Representative compounds were assayed for antimicrobial activities, showing satisfactory antimicrobial activities against Gram‐negative bacteria.     

K2[(UO2)As2O7] – the First Uranium Polyarsenate

Yellowish crystals of K₂[(UO₂)As₂O₇] ( 1 ) have been synthesized by solid‐state reactions method. The structure of 1 [orthorhombic, Pmmn, a = 12.601(2), b = 13.242(2), c = 5.621(1) Å, V = 937.9(3) ų, Z = 4] has been solved by direct methods and refined to R₁ = 0.049, wR₂ = 0.1060 for 1059 observed reflections. The structure of 1 is based upon [(UO₂)As₂O₇]^2? sheets formed by corner sharing between [UO₆]^6? distorted octahedra and [As₂O₇]^4? polyarsenate groups. The K⁺ cations are either in eightfold or tenfold coordination and are located between the sheets. The topology of the uranyl arsenate sheet is related to silicate minerals of the melilite group and related synthetic silicate, aluminate and germanate compounds.     

Development of a capillary electrophoretic method for the separation of diastereoisomers of a new human immunodeficiency virus protease inhibitor

A capillary electrophoretic (CE) method was developed for the separation of diastereoisomers of a new human immunodeficiency virus (HIV) protease inhibitor TMC114. In total 16 isomers of this drug have been synthesized (eight pairs of enantiomers). We succeeded in the separation of the eight diastereoisomers, but no enantiomers could be separated. Because of the high similarity and water-insolubility of these isomers, the separation is a real challenge. Different CE modes were tried out: capillary zone electrophoresis (CZE), nonaqueous capillary electrophoresis (NACE), micellar electrokinetic capillary chromatography (MEKC), and microemulsion electrokinetic capillary chromatography (MEEKC). Only MEEKC offered resolution of these compounds.     

Highly efficient redox isomerization of allylic alcohols at ambient temperature catalyzed by novel ruthenium-cyclopentadienyl complexes--new insight into the mechanism

A range of ruthenium cyclopentadienyl (Cp) complexes have been prepared and used for isomerization of allylic alcohols to the corresponding saturated carbonyl compounds. Complexes bearing CO ligands show higher activity than those with PPh3 ligands. The isomerization rate is highly affected by the substituents on the Cp ring. Tetra(phenyl)methyl-substituted catalysts rapidly isomerize allylic alcohols under very mild reaction conditions (ambient temperature) with short reaction times. Substituted allylic alcohols have been isomerized by employing Ru-Cp complexes. A study of the isomerization catalyzed by [Ru(Ph5Cp)(CO)2H] (14) indicates that the isomerization catalyzed by ruthenium hydrides partly follows a different mechanism than that of ruthenium halides activated by KOtBu. Furthermore, the lack of ketone exchange when the isomerization was performed in the presence of an unsaturated ketone (1 equiv), different from that obtained by dehydrogenation of the starting allylic alcohol, supports a mechanism in which the isomerization takes place within the coordination sphere of the ruthenium catalyst.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Reaction of allylsilanes and allylstannanes with alkynes catalyzed by electrophilic late transition metal chlorides

The intramolecular reaction of allylsilanes and allylstannanes with alkynes proceeds catalytically in the presence of Pt(II), Pd(II), Ru(II), and Au(III) chlorides. Although more limited, AgOTf also catalyzes the cyclization. Usually, PtCl2 as the catalyst in methanol or acetone gives the best results. The reaction proceeds by exo attack of the allyl nucleophile on the alkyne to form five- or six-membered ring carbocycles. The reaction generally proceeds with anti stereoselectivity. However, a terminally substituted trimethylsilyl derivative reacts by a syn-type addition. The intermediate alkenylpalladium complex has been trapped with allyl chloride to form an allylated derivative with an additional carbon-carbon bond.