Identification and quantitative determination of atorvastatin calcium polymorph in tablets using FT-Raman spectroscopy

Atorvastatin calcium (ATC) is the active pharmaceutical ingredient (API) of the best selling lipid-lowering formulation Lipitor. Twelve ATC crystal forms are known and several pharmaceutical companies are developing or have developed generic drug formulations based on different ATC polymorphs. The strong overlap of the X-ray diffraction patterns (XRD) of the polymorphs with the respective patterns of the excipients, the presence of small API quantities in the tablet and the similarity of the crystal phase VIII XRD pattern used in the tablet examined in this work to that of phases IV and IX made identification difficult. Quantitative determination of ATC was attempted using Raman spectroscopy (RS), IR spectroscopy and X-ray powder diffraction. It was found that RS exhibited lower detection limit and a calibration model was constructed. Its application on commercial ATC tablets with 40mg strength yielded an error of 1.25%.     

Lecithin organogels used as bioactive compounds carriers. A microdomain properties investigation

Organogels were obtained by adding small amounts of water to a solution of lecithin in organic solvents. Either isooctane or isopropyl palmitate and isopropyl myristate were used as the continuous organic phase of the gels. EPR spectroscopy using both DSA membrane-sensitive and lipophilic spin probes was applied to define the dynamic structure of the surfactant monolayer and the continuous oil phase of lecithin organogels. It was found that by increasing the water quantity, an increase of the polar head area per lecithin molecule was induced, and as a consequence the total interface expanded. It was found that the use of esters as organic solvents induced a decrease of the size of the dispersed structures. The interconnection of the aqueous microdomains and their dynamics were monitored by both static and time-resolved fluorescence quenching spectroscopy using Ru(bipy)32+ as fluorophore and Fe(CN)63- as quencher. It was found that the rates of inter- and/or intra-micellar exchange of water molecules were very slow because they appeared quite immobilized close to the lecithin polar heads. According to the results of the dynamic studies, appropriate organogels were formulated and used to incorporate model bioactive compounds with medicinal or cosmetic interest such as caffeine and theophylline. When these systems were tested for trans-membrane diffusion, they showed a 24 h permeation of 20% and 35%, respectively.     

Ultrafast excited-state deactivation and energy transfer in guanine-cytosine DNA double helices

The DNA double helix poly(dGdC).poly(dGdC) is studied by fluorescence upconversion spectroscopy with femtosecond resolution. It is shown that the excited-state relaxation of the duplex is faster than that of the monomeric components dGMP and dCMP. This contrasts with the behavior of duplexes composed exclusively of adenine-thymine base pairs, for which an overall lengthening of the fluorescence lifetimes with respect to that of an equimolar mixture of dAMP and TMP was reported previously. Despite the difference in the excited-state deactivation rate between the two types of duplexes, the signature of ultrafast energy transfer is present in both of them. It is attested by the decrease of fluorescence anisotropy decay of the duplexes on the subpicosecond time scale, where molecular motions are inhibited, and is corroborated by the fact that their steady-state fluorescence spectra do not change with the excitation wavelength. Energy transfer involves excited states delocalized over at least two bases, whose existence is revealed by the UV absorption spectrum of the duplex, clearly different from that of an equimolar spectrum of dGMP and dCMP.     

Recent developments in headspace microextraction techniques for the analysis of environmental contaminants in different matrices

Headspace microextraction procedures such as solid-phase microextraction (SPME) and single drop microextraction (SDME) or liquid-phase microextraction (LPME) are increasingly used for the extraction of environmental organic pollutants from a variety of aqueous, viscous, semisolid and solid environmental and biological matrices. In this article, recent analytical applications of these methodologies when used as an isolation and trace enrichment step prior to the analysis of organic pollutants (pesticides, polycyclic aromatic hydrocarbons, polychlorinated compounds, organotin compounds, phenolic derivatives, aromatic amines, phthalates, etc.) by gas and liquid chromatography are reviewed. The applicability and inherent limitations of headspace microextraction are also discussed. The future direction of research in this field and general trends toward commercial applications are considered.     

Synthesis,Neuroprotection, and Antioxidant Activity of 1,1′-Biphenylnitrones as α-Phenyl-N-tert-butylnitrone Analogues in In Vitro Ischemia Models

Herein, we report the neuroprotective and antioxidant activity of 1,1′-biphenyl nitrones (BPNs) 1–5 as α-phenyl-N-tert-butylnitrone analogues prepared from commercially available [1,1′-biphenyl]-4-carbaldehyde and [1,1′-biphenyl]-4,4′-dicarbaldehyde. The neuroprotection of BPNs 1-5 has been measured against oligomycin A/rotenone and in an oxygen–glucose deprivation in vitro ischemia model in human neuroblastoma SH-SY5Y cells. Our results indicate that BPNs 1–5 have better neuroprotective and antioxidant properties than α-phenyl-N-tert-butylnitrone (PBN), and they are quite similar to N-acetyl-L-cysteine (NAC), which is a well-known antioxidant agent. Among the nitrones studied, homo-bis-nitrone BPHBN5, bearing two N-tert-Bu radicals at the nitrone motif, has the best neuroprotective capacity (EC₅₀ = 13.16 ± 1.65 and 25.5 ± 3.93 μM, against the reduction in metabolic activity induced by respiratory chain blockers and oxygen–glucose deprivation in an in vitro ischemia model, respectively) as well as anti-necrotic, anti-apoptotic, and antioxidant activities (EC₅₀ = 11.2 ± 3.94 μM), which were measured by its capacity to reduce superoxide production in human neuroblastoma SH-SY5Y cell cultures, followed by mononitrone BPMN3, with one N-Bn radical, and BPMN2, with only one N-tert-Bu substituent. The antioxidant activity of BPNs 1-5 has also been analyzed for their capacity to scavenge hydroxyl free radicals (82% at 100 μM), lipoxygenase inhibition, and the inhibition of lipid peroxidation (68% at 100 μM). Results showed that although the number of nitrone groups improves the neuroprotection profile of these BPNs, the final effect is also dependent on the substitutent that is being incorporated. Thus, BPNs bearing N-tert-Bu and N-Bn groups show better neuroprotective and antioxidant properties than those substituted with Me. All these results led us to propose homo-bis-nitrone BPHBN5 as the most balanced and interesting nitrone based on its neuroprotective capacity in different neuronal models of oxidative stress and in vitro ischemia as well as its antioxidant activity.     

Convenient method for the synthesis of 5-(4-methoxyphenyl)-3H-1,2-dithiole-3-thione (ADT-OMe) and 5-(4-hydroxyphenyl)-3H-1,2-dithiol-3-thione (ADT-OH) using microwave irradiation

A convenient method is described for the rapid synthesis of 5-(4-methoxyphenyl)-3H-1,2-dithiole-3-thione (ADT-OMe) from anethole and elemental sulfur using microwave irradiation. Various reaction conditions were applied to reduce the reaction time from several hours to 10 min, resulting in an improvement in yield and overcoming the undesired by-product formation associated with conventional methods. 5-(4-Hydroxyphenyl)-3H-1,2-dithiol-3-thione (ADT-OH) was obtained by the deprotection of ADT-OMe using pyridine hydrochloride under microwave irradiation.     

Methods of sample preparation for determination of pesticide residues in food matrices by chromatography–mass spectrometry-based techniques: a review

Much progress has been made in pesticide analysis over the past decade, during which time hyphenated techniques involving highly efficient separation and sensitive detection have become the techniques of choice. Among these, methods based on chromatographic separation with mass spectrometric detection have resulted in greater likelihood of identification and are acknowledged to be extremely useful and authoritative methods for determination of pesticide residues. Even with such powerful instrumental techniques, however, the risk of interference increases with the complexity of the matrix studied, so sample preparation before instrumental analysis is still mandatory in many applications, for example food analysis. This article summarizes the analytical characteristics of the different methods of sample-preparation for determination of pesticide residues in a variety of food matrices, and surveys their recent applications in combination with chromatographic mass spectrometric analysis. We discuss the advantages and the disadvantages of the different methods, address instrumental aspects, and summarize conclusions and perspectives for the future.     

Electronic Excitations in G‐quadruplexes Formed by the Human Telomeric Sequence: A Time‐Resolved Fluorescence Study

The present study deals with G‐quadruplexes formed by folding of the human telomeric sequence d(GGGTTAGGGTTAGGGTTAGGG), in presence of K⁺ cations, noted Tel21/K⁺. Fluorescence decays and fluorescence anisotropy decays, obtained upon excitation at 267 nm, are probed from femtosecond to nanosecond domains using two different detection techniques, fluorescence upconversion and time‐correlated single photon counting. The results are discussed in light of recent theoretical studies. It is shown that efficient energy transfer takes place among the bases on the femtosecond time scale, possible only via exciton states. The major part of the fluorescence originates from bright excited states having weak charge transfer character and decaying between 1 and 100 ps. Charge transfer states involving guanines in different tetrads decay mainly after 100 ps and emit at the red wing of the spectrum. The persistence of electronic excitations in Tel21/K⁺ is longer and the contribution of charge transfer states is more pronounced than what is observed for G‐quadruplexes formed by association of four d(TGGGT) strands and containing the same number of tetrads. This difference is due to the increased structural rigidity of monomolecular structures which reduces nonradiative deactivation pathways and favors collective effects.     

A General Synthetic Approach for Designing Epitope Targeted Macrocyclic Peptide Ligands

We describe a general synthetic strategy for developing high‐affinity peptide binders against specific epitopes of challenging protein biomarkers. The epitope of interest is synthesized as a polypeptide, with a detection biotin tag and a strategically placed azide (or alkyne) presenting amino acid. This synthetic epitope (SynEp) is incubated with a library of complementary alkyne or azide presenting peptides. Library elements that bind the SynEp in the correct orientation undergo the Huisgen cycloaddition, and are covalently linked to the SynEp. Hit peptides are tested against the full‐length protein to identify the best binder. We describe development of epitope‐targeted linear or macrocycle peptide ligands against 12 different diagnostic or therapeutic analytes. The general epitope targeting capability for these low molecular weight synthetic ligands enables a range of therapeutic and diagnostic applications, similar to those of monoclonal antibodies.     

Synthesis of modified triazole nucleosides possessing one or two base moieties via a click chemistry approach

Copper-catalyzed 1,3-dipolar cycloaddition of propargyl and azidoethyl thymine and adenine derivatives afforded triazole nucleosides bearing one or two base moieties. A catalytic role of the adenine nucleus was observed and is explained through copper-adenine coordination in the intermediate copper acetylide-azide complex. The antioxidant activity of the obtained cycloadducts was tested.