Electronic Excitations in G‐quadruplexes Formed by the Human Telomeric Sequence: A Time‐Resolved Fluorescence Study

The present study deals with G‐quadruplexes formed by folding of the human telomeric sequence d(GGGTTAGGGTTAGGGTTAGGG), in presence of K⁺ cations, noted Tel21/K⁺. Fluorescence decays and fluorescence anisotropy decays, obtained upon excitation at 267 nm, are probed from femtosecond to nanosecond domains using two different detection techniques, fluorescence upconversion and time‐correlated single photon counting. The results are discussed in light of recent theoretical studies. It is shown that efficient energy transfer takes place among the bases on the femtosecond time scale, possible only via exciton states. The major part of the fluorescence originates from bright excited states having weak charge transfer character and decaying between 1 and 100 ps. Charge transfer states involving guanines in different tetrads decay mainly after 100 ps and emit at the red wing of the spectrum. The persistence of electronic excitations in Tel21/K⁺ is longer and the contribution of charge transfer states is more pronounced than what is observed for G‐quadruplexes formed by association of four d(TGGGT) strands and containing the same number of tetrads. This difference is due to the increased structural rigidity of monomolecular structures which reduces nonradiative deactivation pathways and favors collective effects.     

Synthesis of modified triazole nucleosides possessing one or two base moieties via a click chemistry approach

Copper-catalyzed 1,3-dipolar cycloaddition of propargyl and azidoethyl thymine and adenine derivatives afforded triazole nucleosides bearing one or two base moieties. A catalytic role of the adenine nucleus was observed and is explained through copper-adenine coordination in the intermediate copper acetylide-azide complex. The antioxidant activity of the obtained cycloadducts was tested.     

Excited-state interactions in diastereomeric flurbiprofen-thymine dyads

Excited-state interactions between (S)- or (R)-flurbiprofen ((S)- or (R)-FBP) and thymidine (dThd) covalently linked in dyads 1 or 2 have been investigated. In both dyads, the only emitting species is (1)FBP*, but with a lower fluorescence quantum yield (?(F)) and a shorter fluorescence lifetime (τ(F)) than when free in solution. These results indicate that dynamic quenching occurs either by electron transfer or via exciplex formation, with FBP as the charge-donating species. In acetonitrile, both mechanisms are favored, while in dioxane exciplex formation is predominating. Isomer 1 displays lower values of ?(F) and τ(F) than its analogue 2, indicating that the relative spatial arrangement of the chromophores plays a significant role. The triplet quantum yields (?(T)) of 1 and 2 are significantly higher than the expectations based solely on (1)FBP*-dThd intersystem crossing quantum yields (?(ISC)), with ?(T) (1) > ?(T) (2). This can be explained in terms of intramolecular charge recombination at the radical ion pairs and/or the exciplexes, which would be again dependent on geometrical factors. The triplet lifetimes (τ(T)) of (3)FBP*-dThd and free (3)FBP* are similar, indicating the lack of excited-state interactions at this stage. The FBP-dThd dyads could, in principle, constitute appropriate model systems for the elucidation of the excited-state interactions in noncovalent DNA-ligand complexes.     

Thermotropic liquid crystal behaviour of alkaline-earth-metal dihexadecyl phosphate salts

Alkaline-earth-metal dihexadecyl phosphate salts were synthesized, and their thermal stability was evaluated by thermogravimetry. Their thermotropic liquid crystal behaviour was investigated by differential scanning calorimetry, polarizing optical microscopy, dilatometry, and X-ray diffraction. On heating, the calcium, strontium, and barium salts exhibit columnar liquid crystal phases, whereas the less ionic beryllium and magnesium salts melt directly into isotropic liquids.     

Occurrence and distribution of selected pharmaceutical compounds on sewage-impacted section of River Acheloos,Western Greece

The occurrence of eight pharmaceutical compounds (PhCs), two metabolites and caffeine was investigated in River Acheloos, located in Western Greece, during a twelve-month monitoring period (March 2007–February 2008). Solid-phase extraction (SPE) was used for the extraction and pre-concentration of the target pollutants and gas chromatography mass spectrometry (GC–MS) for the detection and quantification. Recoveries were determined between 74.0–100.4% for distilled water and 72.6–95.1% for the river water, whereas the relative standard deviation was less than 9.4% for distilled water and 8% for the river water, respectively. The limits of detection ranged between 1–40 ng L^?1. Two pharmaceuticals (paracetamol and carbamazepine), caffeine and the metabolite (salicylic acid), have been detected in all the analysed samples. Maximum concentration levels determined in river samples reached 305 ng L^?1 recorded for paracetamol. The concentrations of target compounds were significantly higher in the samples collected at the sampling station situated after the wastewater treatment plant (WWTP) of Agrinio City compared to the samples collected in upper and lower parts of the river. Seasonal variations were attributed mainly to river flow variations and removal percentages by WWTP. Risk quotient method for median environmental concentrations revealed minimal to median risk with the exception of triclosan, ibuprofen and diclofenac, which presented high risk when maximum environmental concentrations were used.     

Organotin flufenamates: Synthesis, characterization and antiproliferative activity of organotin flufenamates

The organotin flufenamates [Me₂(flu)SnOSn(flu)Me₂]₂ (1), [Bu₂(flu)SnOSn(flu)Bu₂]₂ (2) and [Bu₂Sn(flu)₂] (3) have been prepared and structurally characterized by means of vibrational and NMR (¹H, ¹³C and ¹¹⁹Sn) spectroscopy. The crystal structure of [Me₂(flu)SnOSn(flu)Me₂]₂ (1) has been determined by X-ray crystallography. Three distannoxane rings are present to the dimeric tetraorganodistannoxane of planar ladder arrangement. The structure is centro-symmetric and features a central rhombus Sn₂O₂ unit with two additional tin atoms linked at the O atoms. Six-coordinated tin centers are present in the dimer distannoxane. This structure is self-assembled via π → π and C-H → π stacking interactions. Flufenamic acid and flufenamates were evaluated for antiproliferative activity in vitro. Among the compounds tested [Bu₂(flu)SnOSn(flu)Bu₂]₂ (2) and [Bu₂Sn(flu)₂] (3) exhibited high cytotoxic activity against the cancer cell line A549 (non-small cell lung carcinoma).     

Exciton states of dynamic DNA double helices: alternating dCdG sequences

The present communication deals with the excited states of the alternating DNA oligomer (dCdG)5.(dCdG)5 which correspond to the UV absorption band around 260 nm. Their properties are studied in the frame of the exciton theory, combining molecular dynamics simulations and quantum chemistry data. It is shown that the dipolar coupling undergoes important variations with the site and the helix geometry. In contrast, the energy of the monomer transitions within the double helix is not sensitive to the local environment. It is thus considered to be distributed over Gaussian curves whose maximum and width are derived from the experimental absorption spectra of nucleosides in aqueous solution. The influence of the spectral width on the excited state delocalization and the absorption spectra is much stronger than that of the oligomer plasticity. About half of the excited states are delocalized over at least two bases. Many of them result from the mixing of different monomer states and extend on both strands. The trends found in the simulated spectra, when going from non-interacting monomers to the duplex, are in agreement with experimental observations. Conformational changes enhance the diversity of the states which can be populated upon excitation at a given energy. The states with larger spatial extent are located close to the maximum of the absorption spectrum.     

Intensified biochip system using chemiluminescence for the detection of Bacillus globigii spores

This paper reports the first intensified biochip system for chemiluminescence detection and the feasibility of using this system for the analysis of biological warfare agents is demonstrated. An enzyme-linked immunosorbent assay targeting Bacillus globigii spores, a surrogate species for Bacillus anthracis, using a chemiluminescent alkaline phosphatase substrate is combined with a compact intensified biochip detection system. The enzymatic amplification was found to be an attractive method for detection of low spore concentrations when combined with the intensified biochip device. This system was capable of detecting approximately 1 × 10⁵ Bacillus globigii spores. Moreover, the chemiluminescence method, combined with the self-contained biochip design, allows for a simple, compact system that does not require laser excitation and is readily adaptable to field use. Figure Schematic diagram of the miniature biochip detection system     

Photocatalytic degradation of organophosphate flame retardant TBEP: kinetics and identification of transformation products by orbitrap mass spectrometry

The photocatalytic degradation of tris (2–butoxyethyl) phosphate (TBEP) flame retardant using visible light response catalysts TiO₂/V₂O₅, (N,F-doped)-TiO₂/V₂O₅, and N-doped-SrTiO₃ has been studied by high-resolution orbitrap mass spectrometry. TBEP degradation followed first-order kinetics with half-life values ranging between 9.8 and 83.5 min. N-doped-SrTiO₃ was the catalyst with better photocatalytic performance while activity for TiO₂/V₂O₅ composites followed the trend: N, F- TiO₂/V₂O₅ > N-TiO₂/V₂O₅> TiO₂/V₂O₅. The identified degradation products (DPs) revealed hydroxylation, further oxidation and dealkylation as major degradation pathways. Based on the identified DPs and scavenging experiments, ^?OH radical-mediated reactions can be considered for the degradation of TBEP using TiO₂ and SrTiO₃-based photocatalytic materials.     

Time-resolved study of thymine dimer formation

The formation of thymine dimers in the single-stranded oligonucleotide, (dT)20, is studied at room temperature by laser flash photolysis using 266 nm excitation. It is shown that the (6-4) adduct is formed within 4 ms via a reactive intermediate. The formation of cyclobutane dimers is faster than 200 ns. The overall quantum yield for the (6-4) formation is (3.7 +/- 0.3) x 10-3, and that of the cyclobutane dimers is (2.8 +/- 0.2) x 10-2. No triplet absorption is detected, showing that either the intersystem crossing yield decreases by 1 order of magnitude upon oligomerization (<1.4 x 10-3) or the triplet state reacts with unit efficiency in less than 200 ns to yield cyclobutane dimers.