Photoelectron spectroscopy of isolated multiply negatively charged oligonucleotides

Ultraviolet photoelectron spectroscopy in an ion beam was used to investigate the electronic properties of isolated DNA oligonucleotides [dA(5)-4H](4-) and [dT(5)-4H](4-), carrying four excess negative charges. We find the fourth adiabatic electron affinity to be slightly negative for [dA(5)-4H](4-), while it is positive for [dT(5)-4H](4-). This implies a significant influence of the base composition on energetics, which is in turn relevant for analytic applications and also for charge transport properties.     

Stimuli-responsive surface crystallization of phospholipids from bimodal colloidal particles

These studies focus on the effect of phospholipids in the presence of ionic surfactants on the behavior of poly(methylmethactrylate/n-butyl acrylate) (p-MMA/nBA) colloidal particles during film formation. With the presence of two surfactants, it is possible to obtain particles that exhibit two distinct particle sizes. The presence of hydrogenated soybean phosphatidylcholine (HSPC) and sodium dioctyl sulfosuccinate (SDOSS), which stabilize these bimodal colloidal dispersions, has a significant effect on the mobility of individual components during coalescence. Specifically, the presence of HSPC inhibits migration of SDOSS to the film-air (F-A) interface. Furthermore, the presence of electrolyte species such as aqueous CaCl2 has a very pronounced effect on film formation. When the Ca2+/HSPC ratio is 0.1/1.0, SDOSS is released to the F-A interface during coalescence. At 2.0/1.0 Ca2+/HSPC, HSPC diffuses to the F-A interface and crystalline domains consisting of HSPC are formed. This stimuli-responsive behavior is confirmed using IRIR imaging that ultimately exhibits different surface morphologies. These studies illustrate for the first time that it is possible to control the release of two different surface-active species during coalescence that form crystalline domains.     

3H-Indol-3-ols by a novel ring contraction

Treatment of α-hydroxy-α-phenyl-o-toluidide with phosphorus tribromide afforded a series of 4H-3,1-benzoxazines. These last, when reacted with potassium amide in liquid ammonia, ring contracted to 2,3-disubstituted 3H-indol-3-ols. The scope of this rearrangement was examined. The indolols on treatment with hot base were found to rearrange to indoxyls. Several of these as well as their N-alkylation products are described.     

New structural motifs in the aggregation of neutral gold(I) complexes: structures and luminescence from (alkyl isocyanide)AuCN

The preparation and X-ray crystal structures of (CyNC)Au(I)CN, (n-BuNC)Au(I)CN, and (i-PrNC)Au(I)CN.0.5CH(2)Cl(2) are reported and compared with those of (MeNC)Au(I)CN and (t-BuNC)Au(I)CN, which were previously described. These linear molecules are all organized through aurophilic interactions into three structural classes: simple chains ((CyNC)Au(I)CN and (t-BuNC)Au(I)CN), side-by-side chains in which two strands make Au...Au contact with each other ((n-BuNC)Au(I)CN), and nets in which multiple aurophilic interactions produce layers of gold(I) centers ((i-PrNC)Au(I)CN and (MeNC)Au(I)CN). All of these five solids dissolve to produce colorless, nonluminescent solutions with similar UV/vis spectra. However, each of the solids displays a unique luminescence with emission maxima occurring in the range 371-430 nm.     

Analysis of derivatized and underivatized theanine enantiomers by high-performance liquid chromatography/atmospheric pressure ionization-mass spectrometry

Theanine, a naturally occurring non-proteinic amino acid found in tea leaves, has demonstrated wide-ranging physiological activity, from lowering blood pressure to enhancing the anti-tumor activity of chemotherapeutic drugs. The chiral nature of theanine suggests that enantiospecificity plays a significant role in its various pharmacological functions. Using the Chirobiotic T (teicoplanin) chiral stationary phase, native and derivatized theanine enantiomers were separated and detected via high-performance liquid chromatography (HPLC) coupled to atmospheric pressure ionization mass spectrometry (API-MS). With the use of flow rates compatible with each ionization source, native theanine standards achieved excellent sensitivity and detection limits (10 ng/mL) for both atmospheric pressure chemical ionization (APCI) and electrospray ionization (ESI). Optimum sensitivity and detection limits for derivatized theanine standards were achieved using ESI-MS. The enantiomeric composition of six commercially available L-theanine samples was evaluated using the high-flow APCI-MS method and confirmed with photodiode array detection. Five of the six products contained significant amounts of D-theanine. Only one product, SunTheanine, appeared to contain only the L-theanine enantiomer.     

Synthesis of 4,12-dihydro-4-oxoquino-[1,8a,8-a,b]quinoxaline-5-carboxylic acid derivatives

The synthesis and antibacterial activity of 1-substituted amino-2-fluoro-4,12-dihydro-4-oxoquino[1,8a,8-a,b]quinoxaline-5-carboxylic acid derivatives are described. The synthetic route includes a carbon homologation and two intramolecular nucleophilic displacement cyclization reactions leading to the novel 4,12-dihydro-4-oxoquino[1,8a,8-a,b]quinoxaline-5-carboxylic acid heterocycle.     

Mild cleavage of methoxymethyl (MOM) ethers with trimethylsilyl bromide

Trimethylsilyl bromide is an effective reagent for the deprotection of methoxymethyl ethers under mild conditions.     

On-line strong cation exchange micro-HPLC-ESI-MS/MS for protein identification and process optimization

We have developed an on-line strong cation exchange (SCX)-ESI-MS/MS platform for the rapid identification of proteins contained in mixtures. This platform consists of a SCX precolumn followed by a nanoflow SCX column on-line with an electrospray ion trap mass spectrometer. We also used this platform to study the dynamics of peptide separation/extraction by SCX, in particular to understand the parameters affecting the performance of SCX in multidimensional chromatography. For example, we have demonstrated that the buffer typically used for tryptic digestion of protein mixtures can have a detrimental effect on the chromatographic behaviour of peptides during SCX separations, thereby affecting certain peptide quantitation approaches that rely on reproducible peptide fractionation. We have also demonstrated that band broadening results when a step (discontinuous) gradient approach is used to displace peptides from the SCX precolumn, reducing the separation power of SCX in multidimensional chromatography. In contrast, excellent chromatographic peak shapes are observed when a defined (continuous) gradient is used. Finally, using a tryptic digest of a protein extract derived from human K562 cells, we observed that larger molecular weight peptides are identified using this on-line SCX approach compared to the more conventional reverse phase (RP) LC/MS approach. Both methods used in tandem complement each other and can lead to a greater number of peptide identifications from a given sample.     

Mass spectral study of ring E of taraxasterol and compounds with similar ring substitution

The origin of the [M–69]⁺ and [M–111]⁺ signals in the mass spectrum of taraxasterol was studied through the use of C(18), (19), (21), (22) and/or (30) deuteriated derivatives. The generality of these signals for ring systems with an exocyclic methylene group and a methyl moiety on an adjacent carbon was verified with 2-methylmethylenecyclohexane, 1-methyl-2-methylene-trans-decalin, 1,10-dimethyl-2-methylene-trans-decalin and some of their deuteriated derivatives. The most plausible mechanism for the formation of the [M–69]⁺ ion appears to involve cleavage of both bonds allylic to the exocyclic methylene group with a 1,3-hydrogen transfer from the adjacent ring. Genesis of the [M–111]⁺ ion is more complicated but a five-membered allylic ion generated from ring D is proposed.     

Probing hydrogen bonding in a DNA triple helix using protium-deuterium fractionation factors

In this communication we report protium-deuterium fractionation factors for the intramolecular triple helix formed by the DNA oligonucleotide 5'-d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT)-3'. The fractionation factors of individual Watson-Crick and Hoogsteen hydrogen bonds in the structure are measured by NMR spectroscopy. The results show that, in contrast to proteins, the fractionation factors are all equal or lower than unity. On the average, the values of the fractionation factors are centered between 0.6 and 0.8, and no significant differences are observed between Hoogsteen and Watson-Crick hydrogen bonds. Deviations from the average are observed for the 5'-end region of the molecule where a base triad is absent and the structure is strained by the intramolecular folding of the DNA strand.