Thermal and physical properties of ZrO2–AlO(OH) nanopowders synthesised by microwave hydrothermal method

Journal of Thermal Analysis and Calorimetry - Industrially relevant nanopowder was synthesised by microwave hydrothermal synthesis to obtain well-controlled composition (ZrO2–AlO(OH) system)...     

Thermal and spectral analysis of copolymers with sulphur groups

Journal of Thermal Analysis and Calorimetry - The paper presents the synthesis, structure and polymerization of S-phenyl 2-methylprop-2-enethioate (PSM). This compound was prepared in the reaction...     

Chiral imines prepared from 1-(2-aminoalkyl)aziridines as novel chiral shifts reagents for efficient recognition of acids

Optically pure, chiral imines synthesized from the corresponding aldehydes and 1-(2-aminoalkyl)aziridines in good chemical yields, have been assessed as an NMR chiral shift reagents for effective discrimination of the signals of some acids (mandelic acid and its derivatives and N-protected amino acid). The title compounds have proven to be very useful for the determination of enantiomeric purity and absolute configuration of the aforementioned acid derivatives.     

Origin of organic gaseous products formed in the thermal decomposition of formates

The gaseous products of the thermal decomposition of formates have been investigated and compared with the products of formaldehyde and synthesis gas transformation under analogous conditions in the presence of the solids formed in the thermal decomposition of particular formates. It was found that formaldehyde transformation leads to organic compounds identical to those obtained in the thermal decomposition of the respective formates, while synthesis gas does not react under such conditions. This fact substantiates the hypothesis that formaldehyde is a precursor of the organic compounds identified in the thermal decomposition of formates. The nature of the organic componds obtained in the thermal decomposition of formates indicates that the formaldehyde formed in the initial stages is then transformed in the Cannizzaro or Tishchenko reactions.

---

Zusammenfassung Die gasförmigen Produkte der thermischen Zersetzung von Formiaten wurden untersucht und mit den Produkten verglichen, die bei der Umwandlung von Formaldehyd und Synthesegas unter analogen Bedingungen in Gegenwart von bei der thermischen Zersetzung von speziellen Formiaten gebildeten Feststoffen entstehen. Formaldehydumwandlungen führen zu organischen Verbindungen, die identisch mit denen sind, die bei der thermischen Zersetzung des betreffenden Formiats gebildet werden, während Synthesegas unter solchen Bedingungen nicht reagiert. Dies erhärtet die Hypothese, daß Formaldehyd eine Vorstufe der bei der thermischen Zersetzung von Formiaten identifizierten organischen Verbindungen ist. Die Natur der bei der thermischen Zersetzung von Formiaten auftretenden organischen Verbindungen weist darauf hin, daß das in den ersten Reaktionsschritten gebildete Formaldehyd nach der Cannizzaro-oder Tishchenko-Reaktion weiterreagiert.

---

, , . , i , . . , , . , , , .

     

Rapidly renewable silver amalgam annular band electrode for voltammetry and polarography

This work describes a novel type of working electrode for use in voltammetry and polarography — the renewable silver liquid amalgam film–modified silver solid amalgam annular band electrode (AgLAF–AgSAE). The electrode is produced by mechanically refreshing the silver liquid amalgam film (AgLAF) before each measurement. The main constituents of the electrode are: a specially constructed silver solid amalgam annular band electrode (AgSAE), two silicon O-rings, silver liquid amalgam and a polypropylene electrode body. Contaminants from the analyzed solution are removed and the AgSAE surface is covered with a thick layer of fresh amalgam while pulling the AgSAE into the sensor body. During movement in the reverse direction AgLAF is formed and homogenized. The time needed to refresh the film is less than 1 s. The electrode is characterized by excellent surface repeatability (～ 1%) and long-term stability (over ten thousand measurement cycles).     

Sensitive voltammetric determination of gallium in aluminium materials using renewable mercury film silver based electrode

Simple cyclic renewable silver amalgam film electrode (Hg(Ag)FE), applied for the determination of gallium(III) using differential pulse anodic stripping voltammetry (DP ASV), is presented. The effects of various factors such as: preconcentration potential and time, pulse height, step potential and supporting electrolyte composition are optimised. The calibration graph is linear from 5?nM (0.35?µg?L^?1) to 80?nM (5.6?µg?L^?1) for a preconcentration time of 60?s, with correlation coefficient of 0.995. For a Hg(Ag)FE with a surface area of 9.9?mm² the detection limit for a preconcentration time of 120?s is as low as 0.1?µg?L^?1. The repeatability of the method at a concentration level of the analyte as low as 3.5?µg?L^?1, expressed as RSD is 3.2% (n?=?5). The proposed method was successfully applied by studying the synthetic samples and simultaneously recovery of Ga(III) from spiked aluminium samples.     

Dispersive liquid–liquid microextraction applied to isolation and concentration of alkylphenols and their short-chained ethoxylates in water samples

Dispersive liquid–liquid microextraction (DLLME) coupled with high-performance liquid chromatography with fluorescence detector was applied for the determination of alkylphenols and their short-chained ethoxylates in water samples. Development of DLLME procedure included optimisation of some important parameters such as kind and volume of extracting and dispersing solvents. Under optimised conditions 50 μL of trichloroethylene in 1.5 mL of acetone were rapidly injected into 5 mL of a water sample. After centrifuging the organic phase containing the analytes was taken for evaporation with a gentle nitrogen purge and reconstituted to 50 μL of acetonitrile. The aliquot of this solution was analysed with the use of HPLC. For octylphenol (OP) and octylphenol ethoxylates (OPEOs) linearity was satisfactory in the range 8–1000 μg L⁻¹ and for nonylphenol (NP) and nonylphenol ethoxylates (NPEOs) linearity was in the range from 50 to about 3000 μg L⁻¹. Limit of quantitation was 0.1 μg L⁻¹ for OP and OPEOs and 0.3 μg L⁻¹ for NP and NPEOs. Satisfactory recoveries between 66 and 79% were obtained for environmental samples. The results showed that DLLME is a simple, rapid and sensitive analytical method for the preconcentration of trace amounts of alkylphenols and their ethoxylates in environmental water samples.     

Chiral polymers containing a carbohydrate moiety: synthesis

This paper reports the preparation of poly(acetal-ethers) by two alternative synthetic pathways (alkaline and acid-catalyzed conditions). Polycondensations of methyl 2,3:4,6-di-O-salicylidene-alpha-D-mannopyranoside (3) (mixtures of endo-H and exo-H dioxolan-2-yl-diastereomers) with 1,4-dibromobutane (4) (method I a and I b) were performed in solvents (DMF, butyl acetate/DMF, DMSO) and were catalyzed by K2CO3/KI or KOH. A similar polymer (6) was formed by the reaction of methyl alpha-D-mannopyranoside (1) and 1,4-bis(2-formylphenoxy)butane (7), catalyzed by p-toluenesulfonic acid (method II). Regardless of conversion or initial comonomer feed ratios, the composition of the polycondensates depended on the reaction conditions, leading to the formation of macrocyclic [1 + 1] (5) and [2 + 2] compounds, which were macromolecules with diverse molecular weights and optical properties. The regioselective polycondensation was examined by 1H NMR spectroscopy of selected polymers. In the case of 5-membered cyclic acetal units, mixtures of the endo-H and exo-H dioxolan-2-yl system, diastereomers were formed in the polymer chain. The macrocycles and linear oligomers were identified by NMR and electrospray mass spectrometry (ESI-MS). Thermodynamically controlled reactions for making macrocycles as well as oligomers in the absence of templates are also discussed.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.