Origin of high second- and third-order nonlinear optical response in ammonio/borato diphenylpolyene zwitterions: the remarkable role of polarized aromatic groups

We present a quantum-chemical analysis of the molecular structure and second- and third-order polarizabilities in a series of promising nonlinear optical (NLO) chromophores, the zwitterionic ammonio/borato diphenylpolyenes, R3N+Ph(C=C)nPhB-R3, whose synthesis has been reported recently. The molecular geometries are obtained via MP2/6-31G optimization, while the NLO properties are calculated with the INDO Hamiltonian using the sum-over-states and finite-field real-space methods. The real-space approach allows the direct evaluation of the NLO-active segments of the molecules, while the sum-over-states results illustrate the virtual excitations and charge-transfer pathways that are essential in the NLO response. Both methods highlight the remarkable and unexpected result that it is the strongly polarized phenylene groups that play the key role in generating a high NLO response.     

Microbial synthesis and characterization of physiochemical properties of polyhydroxyalkanoates (PHAs) produced by bacteria isolated from activated sludge obtained from the municipal wastewater works in Hong Kong

The first objective of this study was the measurement of physical properties of P(3HB-co-3HV) copolymers with different (hydroxybutyrate) HB to (hydroxyvalerate) HV ratios produced by Bacillus cereus (TRY2) isolated from activated sludge. The 3HV PHBV copolymers were 0.05, 22.6, 39.2, 54.1, and 69.1 mol%, respectively. The second objective was to study possible wastewater treatment and production of PHAs at the same time by B. cereus (TRY2) and Pseudomonas spp. (TOB17) (both were isolated from activated sludge), recombinant Bacillus DH5α, and a combination of the above three bacteria. The results were satisfactory; the maximum COD and TOC of the sewage sludge reduced were 53.5% and 67.5%, respectively.     

Synthesis and anion binding properties of 2,5-diamidothiophene polypyrrole Schiff base macrocycles

[reaction: see text] Two easy-to-synthesize polypyrrolic 2,5-diamidothiophene Schiff base macrocycles are reported, along with their anion binding properties as determined via UV-vis spectroscopic titrations carried out in dichloroethane. There is a striking difference between the interactions with anions of the two macrocycles, a finding ascribed to differences in their rigidity. For example, the more flexible dipyrromethane-derived macrocycle displays a 1.2:1 hydrogen sulfate versus nitrate selectivity, while its more rigid bipyrrole-derived congener shows a 7.4:1 selectivity in favor to hydrogen sulfate.     

Oriented immobilization of Desulfovibrio gigas hydrogenase onto carbon electrodes by covalent bonds for nonmediated oxidation of H2

The orientation of hydrogenase bound covalently to a pyrolytic graphite edge electrode modified with a 4-aminophenyl monolayer can be modulated via electrostatic interactions during the immobilization step. At low ionic strength and when the amino groups of the electrode surface are mostly protonated, the hydrogenase is immobilized with the negatively charged region that surrounds its 4Fe4S cluster nearer to the protein surface facing the electrode. This allows direct electron transfer between the immobilized hydrogenase and the electrode, which is observed by the strong catalytic currents measured in the presence of the H2 substrate. Therefore, a very stable enzymatic electrode is produced that catalyzes nonmediated H2 oxidation.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Half-sandwich titanium(IV) complexes with Kläui's tripod ligand

Treatment of [Ti(O-i-Pr)(2)Cl(2)] with NaL(OEt) (L(OEt)(-) = [CpCo[P(O)(OEt)(2)](3)](-), Cp = eta(5)-C(5)H(5)) afforded [L(OEt)Ti(O-i-Pr)(2)Cl] that reacted with HCl in ether to give [L(OEt)TiCl(3)] (1). The average Ti-O and Ti-Cl distances in 1 are 1.975 and 2.293 A, respectively. Reaction of titanyl sulfate with NaL(OEt) in water followed by addition of HBF(4) afforded [L(OEt)TiF(3)] (2), the Ti-O and Ti-F distances of which are 2.020(2) and 1.792(2) A, respectively. The Zr(IV) analogue [L(OEt)ZrF(3)] (3) was prepared similarly from zirconyl nitrate, NaL(Oet), and HBF(4) in water. The Zr-O and average Zr-F distances in 3 are 2.139(2) and 1.938(2) A, respectively. Treatment of 1 with tetrachlorocatechol (H(2)Cl(4)cat) afforded [L(OEt)Ti(Cl(4)cat)Cl] (4). The average Ti-O(P), Ti-O(C), and Ti-Cl distances in 4 are 1.972, 1.926, and 2.334 A, respectively. Hydrolysis of 4 in the presence of Et(3)N yielded the mu-oxo dimer [(L(OEt))(2)Ti(2)(Cl(4)cat)(2)(mu-O)] (5). The average Ti-O(P), Ti-O(C), and Ti-O(Ti) distances in 5 are 2.027, 1.926, and 1.7977(9) A. Treatment of 1 with 1,1'-binaphthol (BINOLH(2)) in the presence of Et(3)N afforded [(L(OEt))(2)Ti(2)(mu-O)(2)(mu-BINOL)] x 2BINOLH(2) (6.2BINOLH(2)). Complex 1 is capable of catalyzing ring opening of epoxides with Me(3)SiN(3) under solvent-free conditions presumably via a Ti-azide intermediate.