Transport and sedimentation of solid particles in Bénard hexagonal cells

The motion of particles moving under gravity in the velocity field of a liquid in a Bénard hexagonal cell is studied experimentally and numerically for Stokes flow conditions. We then explain the settlement of particles in the centers of cells to form a regular quincunx. It is found that sedimentation also occurs preferentially along the lines connecting the centers of adjacent cells to form a triangle deposition tessellation. Finally, it is explained why particles occupy the central part of each convective cell while the peripheral part of the cell quickly becomes limpid. Numerical results are in agreement with the experimental observations of Bénard and those of the present study.     

Coherent combining in an Yb-doped double-core fiber laser

Coherent combining is demonstrated in a clad-pumped Yb-doped double-core fiber laser. A slope efficiency of more than 70% is achieved with 96% of the total output power in the fundamental mode of one of the two cores. This high combining efficiency is obtained when both cores are coupled via a biconical fused taper in a Michelson interferometer configuration.     

Origin of the asymmetric magnetization reversal behavior in exchange-biased systems: competing anisotropies

The magnetization reversal in exchange-biased ferromagnetic-antiferromagnetic (FM-AFM) bilayers is investigated. Different reversal pathways on each branch of the hysteresis loop, i.e., asymmetry, are obtained both experimentally and theoretically when the magnetic field is applied at certain angles from the anisotropy direction. The range of angles and the magnitude of this asymmetry are determined by the ratio between the FM anisotropy and the interfacial FM-AFM exchange anisotropy. The occurrence of asymmetry is linked with the appearance of irreversibility, i.e., finite coercivity, as well as with the maximum of exchange bias, increasing for larger anisotropy ratios. Our results indicate that asymmetric hysteresis loops are intrinsic to exchange-biased systems and the competition between anisotropies determines the asymmetric behavior of the magnetization reversal.     

Inverse turbulent cascades and conformally invariant curves

We offer a new example of conformal invariance (local scale invariance) far from equilibrium-the inverse cascade of surface quasigeostrophic (SQG) turbulence. We show that temperature isolines are statistically equivalent to curves that can be mapped into a one-dimensional Brownian walk (called Schramm-Loewner evolution or SLEkappa). The diffusivity is close to kappa=4, that is, isotemperature curves belong to the same universality class as domain walls in the O(2) spin model. Several statistics of temperature clusters and isolines are shown to agree with the theoretical expectations for such a spin system at criticality. We also show that the direct cascade in two-dimensional Navier-Stokes turbulence is not conformal invariant. The emerging picture is that conformal invariance may be expected for inverse turbulent cascades of strongly interacting systems.     

Laryngostroboscopic Evaluation After Supracricoid Partial Laryngectomy

BACKGROUND: Supracricoid partial laryngectomy (SCPL) results in laryngeal preservation in more than 95% of patients with T2 glottic carcinoma. Postsurgical glottic function is characterized by an absence of vocal cords, and phonation quality is a key post-SCPL quality-of-life factor. OBJECTIVE: This investigation was designed to enhance post-SCPL vocal function, study anatomic function of the post-SCPL larynx, and correlate anatomic findings with perceptual and instrumented measurements of voice. METHOD: Twenty-five patients were included. All had undergone SCPL with cricoepiglottopexy for T2 glottic carcinoma. All patients were evaluated by laryngostroboscopic examination, voice sample recording, and instrumented voice analysis with the aim of gaining further insight into postoperative larynx function. Laryngostroboscopic parameters such as laryngeal occlusion, epiglottic length, arytenoid movement, and vibratory area were assessed. The perceptual evaluation was based on the GRBAS scale. Acoustic and aerodynamic parameters were recorded, including fundamental frequency (F0), intensity, jitter, shimmer, signal-to-noise ratio (SNR), oral airflow (OAF), maximum phonation time (MPT), and estimated subglottic pressure (ESGP). Nonparametric tests were used to compare laryngostroboscopic parameters with instrumented measurements and perceptual evaluations of voice quality. RESULTS: Correlations were established among occlusion, epiglottic length, and general grade of dysphonia. Oral air flow (P = 0.006) was found to be correlated with occlusion. Voice roughness was correlated with the presence of a clearly identifiable vibratory area (P = 0.003), whereas these vibratory areas were correlated with shimmer (P = 0.041), OAF (P = 0.001), and SNR (P = 0.001). The number of preserved arytenoids was not identified as a voice quality factor (P = 0.423). CONCLUSION: This study highlighted correlations between the laryngostroboscopic examination results and the perceptive and instrumented measurements of voice. Glottis occlusion and epiglottis length were found to be key factors for postoperative voice quality. These results should help to advance technical development on surgical techniques to enhance voice results.     

The Two-Body Interaction with a Circle in Time

We complete our previous^{(1, 2)} demonstration that there is a family of new solutions to the photon and Dirac equations using spatial and temporal circles and four-vector behaviour of the Dirac bispinor. We analyse one solution for a bound state, which is equivalent to the attractive two-body interaction between a charged point particle and a second, which remains at rest. We show this yields energy and angular momentum eigenvalues that are identical to those found by the usual method of solving of the Dirac equation,⁽⁴⁾ including fine structure. We complete our previous derivation⁽²⁾ of QED from a set of rules for the two-body interaction and generalise these. We show that QED may be decomposed into a two-body interaction at every point in spacetime.     

Master Equation and Fokker–Planck Equation: Comparison of Entropy and of Rate Constants

A usual approximation of the master equation is provided by the Fokker–Planck equation. For chemical systems with one species, we prove generally that the prediction of the rate constant of the metastable state given by the Master equation and the Fokker–Planck approximation differ exponentially with respect to the size of the system. We show that this is related to the fact that the entropy of the metastable state is not described correctly by the Fokker–Planck equation. We prove that the rate given by the Fokker–Planck equation overestimates that rate given by the Master equation.     

Low frequency in situ metrology of absorption and dispersion of sound absorbing porous materials based on high power ultrasonic non-linearly demodulated waves

The present work is related to acoustic in situ free-field measurements of sound absorption in porous materials, such as cellular plastic foams, glass-wool or recycled felt materials. The emphasis is given towards fine metrology of absorption in view of potential industrial applications. A powerful ultrasonic array working at 40 kHz is used. It enables to measure absorption acoustical data down to 100 Hz due to the exploitation of the non-linear ultrasonic demodulation phenomenon in air. Fine measurements of acoustic absorption are compared to numerical predictions based on the “equivalent-fluid” model (when the squeleton frame is motionless), and to some measurements performed on a Brüel and Kjaer impedance tube. Dispersion curves are also measured and compared to the numerical predictions for some automotive felt materials which are compressed at various ratios. Data obtained with a dedicated portable instrument are also discussed for the same type of materials and configurations.     

The Fluorescence Properties and Lifetime Study of G-quadruplexes Single- and Double-labeled with Pyrene

We report steady state fluorescence and lifetime emission studies of d(GGTTGGTGTGGTTGG) (TBA) and d(GGGTTAGGGTTAGGGTTAGGG) (Htelom) oligonucleotides labeled with pyrene through a 3-aminopropyl linker. Such G-rich sequences are able to self-assemble into G-quadruplexes, especially in the presence of specific cations like potassium. A comparative studies with single- and double-labeled G-quadruplexes were carried out. For each probe we have measured fluorescence decays for emission wavelength of 390 and 480 nm in the varying concentration of potassium ion. We have calculated average lifetimes <τ> for every system as well as the fractional distribution α_i of emitting species.     

Cavity resonant mode in a metal film perforated with two-dimensional triangular lattice hole arrays

The transmission property of metallic films with two-dimensional hole arrays is studied experimentally and numerically. For a triangular lattice subwavelength hole array in a 150 nm thick Ag film, both cavity resonance and planar surface modes are identified as the sources of enhanced optical transmissions. Semi-analytical models are developed for calculating the dispersion relation of the cavity resonant mode. They agree well with the experimental results and full-wave numerical calculations. Strong interaction between the cavity resonant mode and surface modes is also observed.