Metabolic and Proteomic Analysis of Chlorella sorokiniana,Chloroidium saccharofilum,and Chlorella vulgaris Cells Cultured in Autotrophic,Photoheterotrophic, and Mixotrophic Cultivation Modes

Chlorella is one of the most well-known microalgal genera, currently comprising approximately a hundred species of single-celled green algae according to the AlgaeBase. Strains of the genus Chlorella have the ability to metabolize both inorganic and organic carbon sources in various trophic modes and synthesize valuable metabolites that are widely used in many industries. The aim of this work was to investigate the impact of three trophic modes on the growth parameters, productivities of individual cell components, and biochemical composition of Chlorella sorokiniana, Chloroidium saccharofilum, and Chlorella vulgaris cells with special consideration of protein profiles detected by SDS-PAGE gel electrophoresis and two-dimensional gel electrophoresis with MALDI-TOF/TOF MS. Mixotrophic conditions with the use of an agro-industrial by-product stimulated the growth of all Chlorella species, which was confirmed by the highest specific growth rates and the shortest biomass doubling times. The mixotrophic cultivation of all Chlorella species yielded a high amount of protein-rich biomass with reduced contents of chlorophyll a, chlorophyll b, carotenoids, and carbohydrates. Additionally, this work provides the first information about the proteome of Chloroidium saccharofilum, Chlorella sorokiniana, and Chlorella vulgaris cells cultured in molasses supplementation conditions. The proteomic analysis of the three Chlorella species growing photoheterotrophically and mixotrophically showed increased accumulation of proteins involved in the cell energy metabolism and carbon uptake, photosynthesis process, and protein synthesis, as well as proteins involved in intracellular movements and chaperone proteins.     

Neuroprotective Effect of Caffeine in Alzheimer’s Disease

Alzheimer’s disease (AD) is the leading cause of dementia, predicted to be the most significant health burden of the 21st century, with an estimated 131.5 million dementia patients by the year 2050. This review aims to provide an overview of the effect of caffeine on AD and cognition by summarizing relevant research conducted on this topic. We searched the Web of Science core collection and PubMed for studies related to the effect of caffeine on AD and cognition using title search terms: caffeine; coffee; Alzheimer’s; cognition. There is suggestive evidence from clinical studies that caffeine is neuroprotective against dementia and possibly AD (20 out of 30 studies support this), but further studies, such as the “ideal” study proposed in this review, are required to prove this link. Clinical studies also indicate that caffeine is a cognitive normalizer and not a cognitive enhancer. Furthermore, clinical studies suggest the neuroprotective effect of caffeine might be confounded by gender. There is robust evidence based on in vivo and in vitro studies that caffeine has neuroprotective properties in AD animal models (21 out of 22 studies support this), but further studies are needed to identify the mechanistic pathways mediating these effects.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Preparation and Photocatalytic Performance of TiO2 Nanowire-Based Self-Supported Hybrid Membranes

Nowadays, the use of hybrid structures and multi-component materials is gaining ground in the fields of environmental protection, water treatment and removal of organic pollutants. This study describes promising, cheap and photoactive self-supported hybrid membranes as a possible solution for wastewater treatment applications. In the course of this research work, the photocatalytic performance of titania nanowire (TiO₂ NW)-based hybrid membranes in the adsorption and degradation of methylene blue (MB) under UV irradiation was investigated. Characterization techniques such as scanning electron microscopy (SEM), transmission electron microscopy (TEM), energy-dispersive X-ray spectroscopy (EDS), X-ray powder diffractometry (XRD) were used to study the morphology and surface of the as-prepared hybrid membranes. We tested the photocatalytic efficiency of the as-prepared membranes in decomposing methylene blue (MB) under UV light irradiation. The hybrid membranes achieved the removal of MB with a degradation efficiency of 90% in 60 min. The high efficiency can be attributed to the presence of binary components in the membrane that enhanced both the adsorption capability and the photocatalytic ability of the membranes. The results obtained suggest that multicomponent hybrid membranes could be promising candidates for future photocatalysis-based water treatment technologies that also take into account the principles of circular economy.     

DSC study of stabilizing effect of antioxidant mixtures in styrene-butadiene rubber

The type of cooperation between antioxidants in the binary mixtures of four substituted diphenylamines and phenotiazine in the stabilization of styrene-butadiene rubber has been tested. Thermooxidation of the samples has been studied by differential scanning calorimetry under non-isothermal conditions. The protection factors of the individual stabilizers and their mixtures were determined. The synergy factors were applied to asses the type of cooperation of antioxidants in the mixtures. From their values it can be concluded that the type of cooperation depends on temperature. The highest synergistic effect has been observed for the mixture of phenotiazine and [4-(1-methyl-1-phenyl-ethyl)-phenyl]-phenylamine.     

On network form and function

Moving from the observation that drainage network configurations minimizing total energy dissipation are stationary solutions of the general equation describing landscape evolution, we review theoretical and observational evidence on river patterns and their scale-invariant structure. Exact results complemented by numerical annealing of the basic equation in the presence of additive noise suggest that configurations at (or very close to) the global minimum of energy dissipation differ from dynamically accessible states, which have rather different scaling properties and conform much better to natural forms. Thus we argue that, at least in the fluvial landscape, Nature works through imperfect searches for dynamically accessible optimal configurations. We also show that optimal networks are spanning loopless configurations only under precise physical requirements. This is stated in a form applicable to generic networks, suggesting that other branching structures occurring in Nature (e.g. scale-free and looping) may possibly arise through optimality to selective pressures. Indeed, we show that this is the case.     

The Beneficial Role of Random Strategies in Social and Financial Systems

In this paper we focus on the beneficial role of random strategies in social sciences by means of simple mathematical and computational models. We briefly review recent results obtained by two of us in previous contributions for the case of the Peter principle and the efficiency of a Parliament. Then, we develop a new application of random strategies to the case of financial trading and discuss in detail our findings about forecasts of markets dynamics.     

On Pythagoras Theorem for Products of Spectral Triples

We discuss a version of Pythagoras theorem in noncommutative geometry. Usual Pythagoras theorem can be formulated in terms of Connes’ distance, between pure states, in the product of commutative spectral triples. We investigate the generalization to both non-pure states and arbitrary spectral triples. We show that Pythagoras theorem is replaced by some Pythagoras inequalities, that we prove for the product of arbitrary (i.e. non-necessarily commutative) spectral triples, assuming only some unitality condition. We show that these inequalities are optimal, and we provide non-unital counter-examples inspired by K-homology.     

On the Landau-Teller approximation for energy exchanges with fast degrees of freedom

We revisit the Landau-Teller heuristic approach to adiabatic invariants and, following Rapp, use it to investigate the energy exchanges between the different degrees of freedom, in simple Hamiltonian systems describing the collision of fast rotating or vibrating molecules with a fixed wall. We critically compare the theoretical results with particularly accurate numerical computations (quite small energy exchanges, namely of one part over 10³⁰, are measured).     

Three-dimensional image fusion by use of multiwavelength digital holography

We present three-dimensional (3D) image fusion by use of digital holography. We demonstrate experimentally that, through the image fusion technique with multiresolution wavelet decomposition, it is possible to increase the details and contrast of 3D reconstructed images obtained by multiwavelength digital holography. Although there is substantial activity in the fields of image fusion and holography, to the best of our knowledge, this is the first report of 3D image fusion by use of digital holography.