Shear-induced particle segregation in binary mixtures:Verification of a percolation theory

Granular materials composed of different-sized grains may experience undesired segregation.Segrega-tion is detrimental for a lot of industries because it leads ...     

Thiosemicarbazide-Substituted Coumarins as Selective Inhibitors of the Tumor Associated Human Carbonic Anhydrases IX and XII

A novel series of thiosemicarbazide-substituted coumarins was synthesized and the inhibitory effects against four physiologically relevant carbonic anhydrase isoforms I, II, IX and XII showed selective activities on the tumor-associated IX and XII isozymes. Molecular modeling studies on selected compounds 14a and 22a were performed. The binding modes of such compounds were determined assuming their enzymatically active structures (i.e., cinnamic acid) in the thermodynamically favored, and not previously explored, E geometry. Molecular modelling suggests multiple interactions within the enzymatic cavity and may explain the high potency and selectivity reported for the hCAs IX and XII.     

Metabolic and Proteomic Analysis of Chlorella sorokiniana,Chloroidium saccharofilum,and Chlorella vulgaris Cells Cultured in Autotrophic,Photoheterotrophic, and Mixotrophic Cultivation Modes

Chlorella is one of the most well-known microalgal genera, currently comprising approximately a hundred species of single-celled green algae according to the AlgaeBase. Strains of the genus Chlorella have the ability to metabolize both inorganic and organic carbon sources in various trophic modes and synthesize valuable metabolites that are widely used in many industries. The aim of this work was to investigate the impact of three trophic modes on the growth parameters, productivities of individual cell components, and biochemical composition of Chlorella sorokiniana, Chloroidium saccharofilum, and Chlorella vulgaris cells with special consideration of protein profiles detected by SDS-PAGE gel electrophoresis and two-dimensional gel electrophoresis with MALDI-TOF/TOF MS. Mixotrophic conditions with the use of an agro-industrial by-product stimulated the growth of all Chlorella species, which was confirmed by the highest specific growth rates and the shortest biomass doubling times. The mixotrophic cultivation of all Chlorella species yielded a high amount of protein-rich biomass with reduced contents of chlorophyll a, chlorophyll b, carotenoids, and carbohydrates. Additionally, this work provides the first information about the proteome of Chloroidium saccharofilum, Chlorella sorokiniana, and Chlorella vulgaris cells cultured in molasses supplementation conditions. The proteomic analysis of the three Chlorella species growing photoheterotrophically and mixotrophically showed increased accumulation of proteins involved in the cell energy metabolism and carbon uptake, photosynthesis process, and protein synthesis, as well as proteins involved in intracellular movements and chaperone proteins.     

Neuroprotective Effect of Caffeine in Alzheimer’s Disease

Alzheimer’s disease (AD) is the leading cause of dementia, predicted to be the most significant health burden of the 21st century, with an estimated 131.5 million dementia patients by the year 2050. This review aims to provide an overview of the effect of caffeine on AD and cognition by summarizing relevant research conducted on this topic. We searched the Web of Science core collection and PubMed for studies related to the effect of caffeine on AD and cognition using title search terms: caffeine; coffee; Alzheimer’s; cognition. There is suggestive evidence from clinical studies that caffeine is neuroprotective against dementia and possibly AD (20 out of 30 studies support this), but further studies, such as the “ideal” study proposed in this review, are required to prove this link. Clinical studies also indicate that caffeine is a cognitive normalizer and not a cognitive enhancer. Furthermore, clinical studies suggest the neuroprotective effect of caffeine might be confounded by gender. There is robust evidence based on in vivo and in vitro studies that caffeine has neuroprotective properties in AD animal models (21 out of 22 studies support this), but further studies are needed to identify the mechanistic pathways mediating these effects.     

A longitudinal study of MR diffusion changes in normal appearing white matter of patients with early multiple sclerosis

BACKGROUND AND PURPOSE: The stage at which normal appearing white matter (NAWM) abnormalities first appear in multiple sclerosis (MS) is not clear. The aim of our study was to monitor water diffusion changes over time in NAWM of patients with early MS.METHODS: Out of a consecutive series of patients enrolled in a MR study on clinically isolated syndrome (CIS), we selected 19 subjects who had completed a one year follow-up. The MR scans obtained at baseline and at 12 months were reviewed according to the new criteria on the diagnosis of MS. Lesion load on T2 and T1 weighted images and the trace of the apparent diffusion coefficient in NAWM were measured both at baseline and at 12 months in patients and in 12 healthy controls.RESULTS: In three patients the diagnosis of MS was done at baseline based on MR. Thirteen patients developed MS during the study and in three patients the diagnosis remained "possible MS." TADC in NAWM in patients was significantly higher than in controls at the 12 months' follow-up but not at baseline (controls mean tADC +/- sd = 0.745 +/- 0.02 mm(2)/sec x 10(-3); patients mean tADC(12) +/- sd = 0.767 +/- 0.02 mm(2)/sec x 10(-3); p < 0.02). TADC and T2 lesion load at 12 months were significantly correlated (p < 0.01). Patients exhibiting tADC(12) above a confidence interval had a significantly greater EDSS score at the same time period (EDSS(12) +/- sd = 1.9 +/- 0.5 and = 1.1 +/- 0.4 respectively; p < 0.01).CONCLUSIONS: This study suggests that diffusion MR cannot detect alterations in NAWM of patients with a CIS suggestive of MS. After one year, when most patients develop MS, diffusion MR abnormalities in NAWM become apparent. These abnormalities are correlated with T2 lesion load and may contribute to neurological impairment.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Preparation and Photocatalytic Performance of TiO2 Nanowire-Based Self-Supported Hybrid Membranes

Nowadays, the use of hybrid structures and multi-component materials is gaining ground in the fields of environmental protection, water treatment and removal of organic pollutants. This study describes promising, cheap and photoactive self-supported hybrid membranes as a possible solution for wastewater treatment applications. In the course of this research work, the photocatalytic performance of titania nanowire (TiO₂ NW)-based hybrid membranes in the adsorption and degradation of methylene blue (MB) under UV irradiation was investigated. Characterization techniques such as scanning electron microscopy (SEM), transmission electron microscopy (TEM), energy-dispersive X-ray spectroscopy (EDS), X-ray powder diffractometry (XRD) were used to study the morphology and surface of the as-prepared hybrid membranes. We tested the photocatalytic efficiency of the as-prepared membranes in decomposing methylene blue (MB) under UV light irradiation. The hybrid membranes achieved the removal of MB with a degradation efficiency of 90% in 60 min. The high efficiency can be attributed to the presence of binary components in the membrane that enhanced both the adsorption capability and the photocatalytic ability of the membranes. The results obtained suggest that multicomponent hybrid membranes could be promising candidates for future photocatalysis-based water treatment technologies that also take into account the principles of circular economy.     

Electrochemical characterization of core@shell CoFe2O4/Au composite

Quantum dots (QDs) have received considerable attention due to their unique optical and electrical properties. Although substantial research has focused on the potential applications and toxicological impacts of QDs, far less effort has been directed toward understanding their fate and transport in the environment. In this work, the effect of four coatings, polyethylene glycol functionalized polymer (PEGP), carboxyl derivatized polymer (COOHP), linoleic acid (LA), and polyacrylic acid-octylamine (PAA-OA), on the transport and retention of QDs in porous media were evaluated under environmentally relevant conditions. Aqueous QD suspensions (ca. 10 nM) were introduced into water-saturated columns packed with 40–50 mesh Ottawa sand at a pore-water velocity of 7.6 m/day. At an ionic strength (IS) of 3 mM and pH of 7, PEGP-coated QDs were completely retained within the column, while more than 60 % of COOHP-coated QDs were transported through a column run under identical conditions. When PAA-OA and LA were used as coatings, effluent QD recoveries increased to more than 65 and 89 % of the injected mass, respectively. Additionally, a decrease in pH from 9.5 to 5.0, or an increase of IS from 0 to 30 mM reduced the eluted mass of PAA-OA-coated QDs by more than 2 and 15 times, respectively. The relative mobility of coated QDs (LA > PAA-OA > COOHP > PEGP) was consistent with total interaction energy profiles between QDs and sand surfaces calculated based on Derjaguin–Landau–Verwey–Overbeek (DLVO) theory. At an IS of 3 mM (NaCl) and pH 7, a linear correlation was obtained between the fraction of eluted QDs and the magnitude of the primary interaction energy barrier. These findings demonstrate the strong dependence of QD transport on coating type and indicate that interaction energies based on DLVO theory can be used to predict the relative mobility of QDs in porous media.     

DSC study of stabilizing effect of antioxidant mixtures in styrene-butadiene rubber

The type of cooperation between antioxidants in the binary mixtures of four substituted diphenylamines and phenotiazine in the stabilization of styrene-butadiene rubber has been tested. Thermooxidation of the samples has been studied by differential scanning calorimetry under non-isothermal conditions. The protection factors of the individual stabilizers and their mixtures were determined. The synergy factors were applied to asses the type of cooperation of antioxidants in the mixtures. From their values it can be concluded that the type of cooperation depends on temperature. The highest synergistic effect has been observed for the mixture of phenotiazine and [4-(1-methyl-1-phenyl-ethyl)-phenyl]-phenylamine.