Reibungsdämpfung durch Scheuerleisten: Ein praxisgerechtes Auslegungskonzept

Übersicht Die Fugen zusammengesetzter Bauteile sind einerseits für eine nachteilige Steifigkeitsminderung verantwortlich, tragen aber andererseits durch Reibungsvorgänge wesentlich zum Dämpfungsvermögen einer Konstruktion bei. Merkliche Reibungsdämpfung ohne gleichzeitigen Steifigkeitsverlust bewirken zusätzliche Fugen, die durch Anbringen sogenannter Scheuerleisten entstehen. Der Autor stellt ein Näherungsverfahren zur dämpfungsoptimalen Auslegung von Scheuerleisten vor. Ausgehend von der zu dämpfenden Schwingungsform liefert dieses Verfahren Kriterien für eine günstige Scheuerleistenanordnung, geeignete Leistenabmessungen und als wichtigstes Ergebnis eine dämpfungsoptimale Fugenpressung, die zu maximaler Energiedissipation führt. Schließlich kann das zu erwartende Dämpfungsmaß berechnet und damit das Ergebnis einer vorgesehenen Dämpfungsmaßnahme abgeschätzt werden.

---

Damping by friction ledges: a practical design concept

Summary On the one hand, mating surfaces of structures are responsible for a reduction of stiffness, on the other hand relative motion produces friction, which contributes considerably to the damping. Noticeable friction damping without simultaneous stiffness reduction can be achieved by adding further mating surfaces. Such interfaces are realized by fastening additional elements (e.g. beamlike) onto the structure. An analytic approximation method for these so-called friction ledges is described in this paper. Initiating from the mode shape to be damped the procedure yields criteria for the suitable positioning and design of the ledges. Most important of all is the damping optimized interface pressure, that leads to maximum energy dissipation. Finally, the expected damping rate can be computed, and therefore the result of the proposed measure assessed.

     

Quantum spheres

Spaces homogeneous under the action of the quantum SU(2) group are introduced and investigated. These spaces can be considered as noncommutative two-dimensional spheres of different radii. The geometry of the space built from those spheres makes possible one-particle dipole electric transitions with l=0.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Determination of traces of cobalt in the presence of nioxime and cetyltrimethylammonium bromide by adsorptive stripping voltammetry

A sensitive method of Co(II) determination by adsorptive stripping voltammetry is presented. The method exploits the enhancement of cobalt peak current observed in the system Co(II)-nioxime-cetyltrimethylammonium bromide-piperazine-N,N′-bis(2-ethanesulfonic acid). The calibration plot for an accumulation time of 60 s is linear from 5 × 10⁻¹¹ to 3 × 10⁻⁹ mol L⁻¹. The relative standard deviation is 3.8% for Co(II) determination at concentration 1 × 10⁻⁹ mol L⁻¹. The detection limit is 1.7 × 10⁻¹¹ mol L⁻¹. The validation of the method is performed by the analyses of certified reference materials and comparing the result of Co(II) determination in river water sample by the proposed method with those obtained by ET AAS. The main advantage of this new system is the micro-trace Co(II) determination by adsorptive stripping voltammetry, as compared to those described before, a low concentration of the supporting electrolyte used, and so commercially available reagents without additional purification can be used.     

Tetraphenylporphyrins monosubstituted with a crown ether in one phenyl ring. Synthesis and characterization

Summary The synthesis and spectroscopic characterization of seven new tetraphenyl-porphyrins (1–7) derivatized with 12-crown-4, 14-crown-4, 15-crown-5, or 18-crown-6 ether units inortho orpara position of one of the phenyl rings is described.

---

In einem Phenylring mit Kronenethern monosubstituierte Tetraphenylporphyrine. Synthese und Charakterisierung

Zusammenfassung Die Synthese und die spektroskopische Charakterisierung sieben neuer Tetraphenylporphyrine (1–7), die mit 12-Krone-4, 14-Krone-4, 15-Krone-5 oder 18-Krone-6 in derortho-oderpara-Position eines Phenylrings substituiert sind, werden beschrieben.

     

Reintroducing anisotropic interactions in magic-angle-spinning NMR of half-integer quadrupolar nuclei: 3D MQMAS

Selective reintroduction of anisotropic interactions such as the chemical shift anisotropy (CSA) and homonucler dipolar (HMD) coupling were implemented in a high-resolution NMR spectroscopy for half-integer quadrupolar nuclei. Rotary resonance recoupling (R(3)) combined with the multiple-quantum magic-angle spinning (MQMAS) in a three-dimensional (3D) experiment provides not only site-specific high-resolution spectra to yield the quadrupolar interaction parameters but also the CSA or HMD interaction parameters. This 3D experiment provides an avenue for the complete local structural information of half-integer quadrupolar nuclei. Three-dimensional MQMAS experiments incorporating R(3) of HMD and CSA interactions were demonstrated on model compounds containing (11)B, (23)Na, and (87)Rb nuclei.     

Mechanism of the thermal decomposition of hydrophosphites of lithium,sodium and potassium

The thermal decomposition of some M ₂ ^I HPO₃ (M-Li, Na, K) phosphites under nitrogen atmosphere was investigated. A stepwise mechanism of thermal decomposition has been proposed.

---

Zusammenfassung Es wurde die thermische Zersetzung von Phosphiten M ₂ ^I HPO₃ (M-Li, Na, K) in Stickstoffatmosphere untersucht. Die Schritte des Mechanismus der thermischen Zersetzung wurden vorgeschlagen.

     

Binary and ternary chromium(III) complexes with cellular reductants and DNA components isolated from redox type systems. Part 1. Chromium(VI)–cysteine–adenine (adenosine,ATP)

The reduction of CrO₃ with an excess of L-cysteine and its interaction with DNA fragments (adenine, adenosine) and ATP nucleotide was studied by analysis of the isolated solid products. The precipitates were characterised by elemental analyses, FAB mass spectral data, spectroscopic methods (u.v.–vis., f.i.r., i.r.) and magnetic measurements. The Cr^III complexes obtained appear to be various Cr^III cysteinate and adenine or ATP (but not adenosine) ternary species of the addition type bound through the hydrogen bonding network.     

Groups of paramagnetic centres in coal samples with different carbon contents

Complex systems of paramagnetic centres existing in demineralised flame coal (71.4 wt% C), medium-rank coal (85.6 wt% C) and anthracite (94.9 wt% C) were analysed by electron paramagnetic resonance spectroscopy (EPR). Different groups of paramagnetic centres were searched in macerals (exinite, vitrinite, inertinite) of coals with carbon contents of 73.8 wt% C and 85.6 wt% C. Experimental EPR spectra were fitted by different superposition of theoretical lines. Total concentration of paramagnetic centres both in coal and macerals increases with carbon content in the sample. Total concentration of paramagnetic centres in macerals increases from exinite to inertinite. Four groups of paramagnetic centres were found in medium-rank coal, and only two groups exist in flame coal and anthracite. The EPR spectrum of medium-rank coal is a superposition of two broad and two narrow lines. Both broad and narrow, and two narrow lines were measured in EPR spectra of flame coal and anthracite, respectively. Two types of paramagnetic centres with broad lines and one group with narrow lines exist in exinite and vitrinite from medium-rank coal. Two narrow components were observed in EPR spectra of its inertinite. Two different broad electron paramagnetic resonance signals were detected for macerals from low-coalificated coal. Paramagnetic centres systems of medium-rank coal samples reveal the most complex character. Broad EPR lines were not observed for the higher coalificated samples, i.e., anthracite and inertinite from medium-rank coal. Narrow lines do not occur in EPR spectra of low-coalificated macerals. Strong dipolar interactions and fast spin-lattice relaxation processes are characteristic for paramagnetic centres with broad lines. Strong exchange interactions and short spin-lattice relaxation time were measured for paramagnetic centres with the narrowest EPR signals.     

Thiyl radical interaction with pyrimidine C5-C6 double bond

Addition and elimination interaction of thiyl radicals with the C5-C6 double bond in pyrimidines was studied by the pulse radiolysis technique in aqueous solution with the use of different monitoring systems. For this purpose, p-thiocresol, cysteamine hydrochloride, and mercaptoethanol were used. The rate constants of addition and elimination of thiyl radicals were determined by applying the modified version of ACUCHEM (computer program for modeling complex reaction systems). Aliphatic thiyl radicals add to the pyrimidine C5-C6 double bond with k = 1.0-3.0 x 10(7) dm3 mol(-1) s(-1), whereas elimination takes place with k = 0.7-2.0 x 10(5) s(-1). Quantum chemical calculations at the B3LYP/6-31G(d)/PCM level show that the addition should occur at the C6 position of the pyrimidine ring and that the energy of interaction between thiyl radicals and the pyrimidine double bond C5-C6 is low.