The dynamics of multidimensional cosmological models in the presence of quantum effects. I. The case FRW ×T D at high temperatures

The dynamical system approach is applied to the study of dynamics of multidimensional cosmological models with topology FRW ×T ^D (D-dimensional torus) in the presence of high-temperature quantum effects. The stability methods developed in the paper of Szydowski (Gen. Rel. Grav.,20, 221, 1988) are used in the analysis of typical states of the metric in the neighborhood of singularities and for large time values. The problems of dynamical dimensional reduction, structure of singularities, isotropization, etc., are discussed in this context.     

A fading effect in the X-ray diffraction contrast of dislocations

Fringes in the dislocation image in X-ray section topography are shown to fade away partially when unpolarized radiation is used. The fading effect is explained in terms of an analogy with the polarization beat in a wedge crystal. The polarization nature of the phenomenon is confirmed through numerical simulations of the contrast.Dedicated to Professor Dr. Ulrich Bonse on the occasion of his 60th birthday     

Application of platinum gauze activated by hydrogen to the adsorption separation of silver traces and their determination by aas or spectrophotometry

A method ("electrosorption") has been developed for separation of silver from copper by its deposition through internal electrolysis with hydrogen adsorbed on a platinum surface. The silver can then be stripped and determined by atomic-absorption spectrometry or the dithizone method. The activation of the platinum surface with adsorbed hydrogen can be achieved either electrolytically or by passing hydrogen gas through the solution in which the platinum is immersed. The method of electrosorption has been successfully applied to determination of trace levels of silver in copper metal.     

Evaluation of a purge-and-trap injection system for capillary gas chromatography-microwave induced plasma-atomic emission spectrometry for the determination of volatile selenium compounds in water

A method is presented for the selective determination of the volatile selenium species dimethylselenide and dimethyldiselenide, using a commercially available purge-and-trap injection system coupled to capillary gas chromatography-microwave induced plasma-atomic emission spectrometry. The efficiency of the purging step was evaluated and the parameters affecting the purge and trap processes were optimized. The method was applied to the determination of volatile selenium compounds in lake water. Relative detection limits of 2ng/l for dimethylselenide and dimethyldiselenide, corresponding to an absolute detection limit of 10 pg, were achieved.     

Origin of organic gaseous products formed in the thermal decomposition of formates

The gaseous products of the thermal decomposition of formates have been investigated and compared with the products of formaldehyde and synthesis gas transformation under analogous conditions in the presence of the solids formed in the thermal decomposition of particular formates. It was found that formaldehyde transformation leads to organic compounds identical to those obtained in the thermal decomposition of the respective formates, while synthesis gas does not react under such conditions. This fact substantiates the hypothesis that formaldehyde is a precursor of the organic compounds identified in the thermal decomposition of formates. The nature of the organic componds obtained in the thermal decomposition of formates indicates that the formaldehyde formed in the initial stages is then transformed in the Cannizzaro or Tishchenko reactions.

---

Zusammenfassung Die gasförmigen Produkte der thermischen Zersetzung von Formiaten wurden untersucht und mit den Produkten verglichen, die bei der Umwandlung von Formaldehyd und Synthesegas unter analogen Bedingungen in Gegenwart von bei der thermischen Zersetzung von speziellen Formiaten gebildeten Feststoffen entstehen. Formaldehydumwandlungen führen zu organischen Verbindungen, die identisch mit denen sind, die bei der thermischen Zersetzung des betreffenden Formiats gebildet werden, während Synthesegas unter solchen Bedingungen nicht reagiert. Dies erhärtet die Hypothese, daß Formaldehyd eine Vorstufe der bei der thermischen Zersetzung von Formiaten identifizierten organischen Verbindungen ist. Die Natur der bei der thermischen Zersetzung von Formiaten auftretenden organischen Verbindungen weist darauf hin, daß das in den ersten Reaktionsschritten gebildete Formaldehyd nach der Cannizzaro-oder Tishchenko-Reaktion weiterreagiert.

---

, , . , i , . . , , . , , , .

     

Complexing properties of methyl and phenyl glycine derivatives in their compounds with H+, Ni(II), Cu(II), and Zn(II)

The influence of the solvent and the substituents on the complexing properties of methyl and phenyl glycine derivatives is discussed. On the basis of a computer analysis of potentiometric titration results, the composition and the stability constants of the complexes ofN-methylglycine,N,N-dimethylglycine,N-phenylglycine and phenylglycine with H⁺ and with Ni(II), Cu(II), Zn(II) were determined. The ligand-metal coordination mode as well as the zwitterion level in percent in ligand/proton systems were determined by spectral analyses and equilibria studies.

---

Komplexbildung der Methyl- und Phenylglycin-Derivate in ihren Verbindungen mit dem Proton und Ni(II), Cu(II) und Zn(II)

Zusammenfassung Der Einfluß des Lösungsmittels und der Substituenten auf die komplexbildenden Eigenschaften der Methyl- und Phenylglycin-Derivate wird diskutiert. Anhand einer Computer-Analyse von potentiometrischen Daten wurden die Zusammensetzung und die Beständigkeitskonstanten der Komplexe vonN-Methylglycin,N,N-Dimethylglycin,N-Phenylglycin und Phenylglycin mit H⁺, Ni(II), Cu(II) und Zn(II) festgestellt. Mittels spektroskopischer Methoden und Gleichgewichtstudien wurde der Koordinationstyp des Liganden mit dem Metall festgestellt sowie der Prozentanteil des Zwitterions im Ligand/Proton-System.

     

Quantum spheres

Spaces homogeneous under the action of the quantum SU(2) group are introduced and investigated. These spaces can be considered as noncommutative two-dimensional spheres of different radii. The geometry of the space built from those spheres makes possible one-particle dipole electric transitions with l=0.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Preparation of unsymmetrical disulfides by using sulfines1

Acidolytic cleavage of unsymmetrically substituted dithioacetal monoxides, ArCH(SR)S(O)Me has been used to prepare linear unsymmetrical disulfides RSSMe. Disproportionation was suppressed by the addition of a small amount of benzyl mercaptan. The required starting materials were conveniently obtained from appropriately substituted sulfines ArC(=SO)SR and methyl lithium. The following disulfides were prepared: R =n-C₄H₉ (73.5%), n-C₇H₁₅ (78%), Ph (77.3%), AcO(CH₂)₁₀ (81.5%).The unsymmetrical dithioacetal PhCH(SEt)SC₇H₁₅-n gave upon oxidation with one equivalent of peracid a mixture of two dithioacetal monoxides which on treatment with HClO₄ led to three disulfides. This result is discussed in term of the mechanism of acidolysis.