Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

The role of nanocellulose fibers, starch and chitosan on multipolysaccharide based films

Thin nanocomposite films of thermoplastic starch, chitosan and cellulose nanofibers (bacterial cellulose or nanofibrillated cellulose) were prepared for the first time by solvent casting of water based suspensions of the three polysaccharides. The role of the different bioploymers on the final properties (thermal stability, transparency, mechanical performance and antimicrobial activity) of the films was related with their intrinsic features, contents and synergic effects resulting from the establishment of interactions between them. Thermoplastic starch displays an important role on the thermal stability of the films because it is the most stable polysaccharide; however it has a negative impact on the mechanical performance and transparency of the films. The addition of chitosan improves considerably the transparency (up to 50 % transmittance for 50 % of chitosan, in respect to the amount of starch), mechanical performance and antimicrobial properties (at least 25 % of chitosan and no more than 10 % of cellulose nanofibers are required to observe bacteriostatic or bactericidal activity) but decrease their thermal stability. The incorporation of cellulose nanofibers had the strongest positive impact on the mechanical properties of the materials (increments of up to 15 and 30 MPa on the Young′s modulus and Tensile strength, respectively, for films with 20 % of BC or NFC). Nonetheless, the impact in thermal stability and mechanical performance of the films, promoted by the addition of chitosan and cellulose nanofibres, respectively, was higher than the expected considering their percentage contents certainly because of the establishment of strong and complex interactions between the three polysaccharides.     

Effects of Regioisomerism on the Antiproliferative Activity of Hydroxystearic Acids on Human Cancer Cell Lines

A series of regioisomers of the hydroxystearic acid (HSA) was prepared, and the effect of the position of the hydroxyl group along the chain on a panel of human cancer cell lines was investigated. Among the various regioisomers, those carrying the hydroxyl at positions 5, 7, and 9 had growth inhibitor activity against various human tumor cell lines, including CaCo-2, HT29, HeLa, MCF7, PC3, and NLF cells. 10-HSA and 11-HSA showed a very weak effect. 8-HSA did not show inhibitory activity in all cell lines. The biological role of 7-HSA and 9-HSA is widely recognized, while little is known about the effects of 5-HSA. Therefore, the biological effects of 5-HSA in HeLa, HT29, MCF7, and NLF cell lines were investigated using the Livecyte’s ptychography technology, which allows correlating changes in proliferation, motility, and morphology as a function of treatment at the same time. 5-HSA not only reduces cell proliferation but also induces changes in cell displacement, directionality, and speed. It is important to characterize the biological effects of 5-HSA, this molecule being an important component of fatty acyl esters of hydroxy fatty acids (FAHFA), a class of endogenous mammalian lipids with noticeable anti-diabetic and anti-inflammatory effects.     

Characterisation of ancient Roman wall-painting fragments using non-destructive IBA and MA-XRF techniques

Scientific investigation is very important in studies addressing issues of archaeological and historical objects. Ion beam analysis (IBA) and macro X-ray fluorescence (MA-XRF) spectroscopy are remarkable tools to obtain information about elemental composition and imaging of historical artefacts with a non-invasive character. These investigation techniques were employed in the framework of a project aimed at supporting the characterization of materials and techniques related with the Roman wall painting. The archaeological excavations at Villa della Piscina in Rome have revealed a luxury building with a large pool (about 50 m long) and thermal baths and numerous fragments of plaster, coming from intentional demolitions referable to two distinct architectural contexts of the Villa during the imperial age, have been found. This work deals with studying the interesting wall pictorial apparatus of great cultural value of the heritage inherited from the Roman age in the area of the ancient city of Rome. The colour palette of the pigments investigated, in particular, by MA-XRF and particle-induced X-ray emission (PIXE) and has revealed Fe, Cu, Pb, Si and Hg as main elements. Traces of other constituents uncover the choice of the different colours chosen by the artists who had embellished the rooms of the Villa.     

On forced fast oscillations for delay differential equations on compact manifolds

We prove an existence result for forced oscillations of delay differential equations on compact manifolds with nonzero Euler-Poincaré characteristic. When the period is smaller than the delay we need the asymptotic fixed point index theory for C¹ maps due to Eells and Fournier, and Nussbaum.     

How important are temperature effects for cluster polarizabilities?

State-of-the-art first-principle all-electron density functional theory calculations on small sodium clusters are performed to study the temperature dependency of their polarizabilities. For this purpose Born-Oppenheimer molecular dynamics simulations with more than 100,000 time steps (>200 ps) are recorded employing gradient corrected functionals in combination with a double-zeta valence polarization basis set. For each cluster 18 trajectories between 50 and 900 K are collected. The cluster polarizabilities are then calculated along these trajectories employing a triple-zeta valence polarization basis set augmented with field-induced polarization functions. The analysis of these calculations shows that the temperature dependency of the sodium cluster polarizabilities varies strongly with cluster size. For several clusters characteristic changes in the polarizability per atom as a function of temperature are observed. It is shown that the inclusion of finite temperature effects resolves the long-standing mismatch between calculated and measured sodium cluster polarizabilities.     

Electrostatic interactions between a protein and oppositely charged micelles

Micellar solutions made of a fully fluorinated surfactant, LiPFN, form water-soluble complexes with lysozyme in a wide concentration range. Such complexes are stabilized by electrostatic and, very presumably, double-layer interactions. The mixtures were investigated by combining electrophoretic mobility, DLS, and dielectric relaxation methods. The former gives information on the surface charge density of protein-micelle complexes and indicates that the resulting adducts retain a negative charge (i.e., charge neutralization is incomplete). The double-layer thickness of proteins, micelles, and protein-micelle complexes is also connected to the dielectric relaxation frequency. Changes in particle size (inferred by DLS), charge density, and double-layer thickness are closely interrelated to each other. A model was developed to quantify such properties.     

Synthesis and Ruthenium-Catalyzed Enantioselective Hydrogenation of 3-O-Substituted 1,3-Dihydroxypropan-2-ones. Part 2

A number of 3-O-substituted 1,3-dihydroxypropan-2-ones have been synthesized in view of their potential use as prochiral precursors of optically active glycerols. Indeed, the oxo-ethers have been reduced to the corresponding 3-O-substituted glycerols via chiral Ru complexes derived from (S)-binap, ( =(?)-(S)-2,2′-bis(diphenylphosphino)-1,1′-binaphthalene) with enantiomeric excesses up to 93%. The steric course of the catalytic reduction appears to be essentially dependent on the steric encumbrance of the substituents; indeed, a dramatic increase of the enantiomeric excess is observed when the bulky trityl group is substituted by the less encumbering benzyl or octadecyl groups.     

Asymmetric synthesis and structure-activity studies of the fungal metabolites colletorin A,colletochlorin A and their halogenates analogues

The first asymmetric total synthesis of both enantiomers of the natural products colletorin A and colletochlorin A is presented. The proposed methodology is based on the coupling reaction between highly substituted aromatic Gilman cuprates and optically active allyl bromides, in turn obtained by Sharpless asymmetric dihydroxylation. The latter ensured a high degree of regio- and stereocontrol in the enantioselective step of the synthesis. The same synthetic strategy has been also applied for the preparation of differently halogenated synthetic analogues of colletochlorin A in high enantiomeric purity. The enantioselective synthesis of colletorin A and colletochlorin A allows to reliably assign their absolute configuration. Preliminary assessment of their herbicidal and insecticidal properties evidence the possibility to modulate the bioactivity of these compounds, highlighting its dependence on both the absolute stereochemistry and the halogen nature.