Atomistic packing models for experimentally investigated swelling states induced by CO2 in glassy polysulfone and poly(ether sulfone)

Atomistic packing models have been created, which help to better understand the experimentally observed swelling behavior of glassy polysulfone and poly (ether sulfone), under CO₂ gas pressures up to 50 bar at 308 K. The experimental characterization includes the measurement of the time‐dependent volume dilation of the polymer samples after a pressure step and the determination of the corresponding gas concentrations by gravimetric gas‐sorption measurements. The models obtained by force‐field‐based molecular mechanics and molecular dynamics methods allow a detailed atomistic analysis of representative swelling states of polymer/gas systems, with respect to the dilation of the matrix. Also, changes of free volume distribution and backbone mobility are accessible. The behavior of gas molecules in unswollen and swollen polymer matrices is characterized in terms of sorption, diffusion, and plasticization. © 2006 Wiley Periodicals, Inc. J Polym Sci Part B: Polym Phys 44: 1874–1897, 2006     

Separation of Monovinyl and Divinyl Protochlorophyllides Using C30 Reverse Phase High Performance Liquid Chromatography Column: Analytical and Preparative Applications

A new, high performance liquid chromatography method has been developed for the separation of monovinyl- and divinyl-protochlorophyllides, using commercially available, C₃₀ reverse phase column and isocratic elution. This method can be used both for analytical applications and preparative scale purification of monovinyl- and divinyl-protochlorophyllides using the same column where submilimolar concentrations of the crude protochlorophyllide extract can be separated in one run. The purity of the obtained protochlorophyllides was demonstrated by spectroscopic methods, as well by the formation of aggregates in toluene.     

A fading effect in the X-ray diffraction contrast of dislocations

Fringes in the dislocation image in X-ray section topography are shown to fade away partially when unpolarized radiation is used. The fading effect is explained in terms of an analogy with the polarization beat in a wedge crystal. The polarization nature of the phenomenon is confirmed through numerical simulations of the contrast.Dedicated to Professor Dr. Ulrich Bonse on the occasion of his 60th birthday     

Origin of organic gaseous products formed in the thermal decomposition of formates

The gaseous products of the thermal decomposition of formates have been investigated and compared with the products of formaldehyde and synthesis gas transformation under analogous conditions in the presence of the solids formed in the thermal decomposition of particular formates. It was found that formaldehyde transformation leads to organic compounds identical to those obtained in the thermal decomposition of the respective formates, while synthesis gas does not react under such conditions. This fact substantiates the hypothesis that formaldehyde is a precursor of the organic compounds identified in the thermal decomposition of formates. The nature of the organic componds obtained in the thermal decomposition of formates indicates that the formaldehyde formed in the initial stages is then transformed in the Cannizzaro or Tishchenko reactions.

---

Zusammenfassung Die gasförmigen Produkte der thermischen Zersetzung von Formiaten wurden untersucht und mit den Produkten verglichen, die bei der Umwandlung von Formaldehyd und Synthesegas unter analogen Bedingungen in Gegenwart von bei der thermischen Zersetzung von speziellen Formiaten gebildeten Feststoffen entstehen. Formaldehydumwandlungen führen zu organischen Verbindungen, die identisch mit denen sind, die bei der thermischen Zersetzung des betreffenden Formiats gebildet werden, während Synthesegas unter solchen Bedingungen nicht reagiert. Dies erhärtet die Hypothese, daß Formaldehyd eine Vorstufe der bei der thermischen Zersetzung von Formiaten identifizierten organischen Verbindungen ist. Die Natur der bei der thermischen Zersetzung von Formiaten auftretenden organischen Verbindungen weist darauf hin, daß das in den ersten Reaktionsschritten gebildete Formaldehyd nach der Cannizzaro-oder Tishchenko-Reaktion weiterreagiert.

---

, , . , i , . . , , . , , , .

     

Quantum spheres

Spaces homogeneous under the action of the quantum SU(2) group are introduced and investigated. These spaces can be considered as noncommutative two-dimensional spheres of different radii. The geometry of the space built from those spheres makes possible one-particle dipole electric transitions with l=0.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Tetraphenylporphyrins monosubstituted with a crown ether in one phenyl ring. Synthesis and characterization

Summary The synthesis and spectroscopic characterization of seven new tetraphenyl-porphyrins (1–7) derivatized with 12-crown-4, 14-crown-4, 15-crown-5, or 18-crown-6 ether units inortho orpara position of one of the phenyl rings is described.

---

In einem Phenylring mit Kronenethern monosubstituierte Tetraphenylporphyrine. Synthese und Charakterisierung

Zusammenfassung Die Synthese und die spektroskopische Charakterisierung sieben neuer Tetraphenylporphyrine (1–7), die mit 12-Krone-4, 14-Krone-4, 15-Krone-5 oder 18-Krone-6 in derortho-oderpara-Position eines Phenylrings substituiert sind, werden beschrieben.

     

A fluorescent molecular imaging probe with selectivity for soluble tau aggregated protein

Soluble forms of aggregated tau misfolded protein, generally termed oligomers, are considered to be the most toxic species of the different assembly states that are the pathological components of neurodegenerative disorders. Therefore, a critical biomedical need exists for imaging probes that can identify and quantify them. We have designed and synthesized a novel fluorescent probe, pTP-TFE for which binding and selectivity profiles towards aggregated tau and Aβ proteins were assessed. Our results have shown pTP-TFE to be selective for early forms of soluble tau aggregates, with high affinity of dissociation constants (K_d) = 66 nM, and tenfold selectivity over mature tau fibrils. Furthermore, we found that pTP-TFE is selective for tau over Aβ aggregates and had good cell permeability. This selectivity of pTP-TFE towards early forms of aggregated tau protein ex vivo was also supported with studies on human brain tissue containing tau and Aβ pathology. To the best of our knowledge, this is the first fluorescent molecule to be reported to have this form of selectivity profile, which suggests that pTP-TFE is a unique probe candidate for imaging-based detection of early stages of Alzheimer''s disease and other tauopathies.

pTP-TFE imaging probe can distinguish soluble tau aggregated proteins from other aggregated proteins enabling earlier detection of neurodegenerative diseases.     

Pulse radiolysis and fourier transform infrared study of neopentyl peroxy radicals in the gas phase at 297 K

The ultraviolet absorption spectrum of the neopentyl peroxy radical (CH₃)₃CCH₂O₂, and the kinetics and products of its self reaction have been studied in the gas phase at 298 K. Absorption cross sections were quantified over the wavelength range 230–290 nm. The measured cross section at 250 nm was; Errors represent statistical (2σ) together with our estimate of potential systematic errors(15%). The kinetics of the decay of the UV absorption following the generation of the neopentyl peroxy radicals was complicated by the rapid decomposition of the (CH₃)₃CCH₂O radicals formed in channel (4a). By measuring the yield of t-butyl peroxy radicals, the branching ratio k_4a/(k_4a + k_4b) was determined to be 0.39 ± 0.03. The rate constant for the self reaction of neopentyl peroxy radicals was k₄ = (1.07 ± 0.22) × 10^?12 cm³ molecule^?1 s^?1. Quoted errors represent 2σ. These results are discussed with respect to the available literature data. © John Wiley & Sons, Inc.