Polychloroprene rubbers used for adhesives: a small angle X-ray scattering preliminary investigation under stretching

Summary Three types of polychloroprene rubbers (Du Pont de Nemours Co. Neoprenes AD, WHV and W) used for adhesives and having different crystallization rates have been investigated.The mechanical properties of the Neoprenes samples were determined and the films were examined under stretching by SAXS for a preliminary investigation on their different superreticular order.

---

Zusammenfassung Drei Typen von Polychloropren-Kautschuk mit verschiedener Kristallisationsgeschwindigkeit (Neoprene AD, WHV und W von Du Pont de Nemours), die als Klebemittel dienen, wurden als gedehnte Filme mechanisch und röntgenographisch (SAXS) untersucht. Sie zeigen Unterschiede in der Überstruktur.

     

EFFECT OF BASE SEQUENCE ON THE ULTRAVIOLET IRRADIATION PRODUCTS OF DOUBLE-STRANDED POLYNUCLEOTIDES CONTAINING BROMOURACIL AND ADENINE

Abstract —The effects of ultraviolet irradiation of double-stranded synthetic polynucleotides containing BrU and A have been investigated. Homopolymer pairs and alternating copolymers composed of either ribo- or deoxyribo-nucleotides were prepared and were irradiated with either 313 nm or ˜ 285 nm light. Strand separation and a modest amount of strand breakage followed irradiation of the homopolymer pairs. Changes in the ultraviolet absorption spectra of the polymers during irradiation reflected the sum of hyperchromic increases caused by progressive strand separation and loss of absorbance caused by photoproduct formation. Extensive debromination occurred. An RNase digest of irradiated poly(rA)–poly¹⁴C(rBrU), analysed by column chromatography, showed components similar to those found previously upon irradiation of single-stranded poly(rBrU). Little photoproduct was released by RNase digestion as mononucleotides. The major photoproduct was in the dinucleotide fraction, and may be 5,5'-diuracil. Base sequence had a profound effect on the sensitivity of the polynucleotides. Irradiation of alternating copolymers with doses of light comparable to those that produced major photochemical changes in the homopolymer pairs brought about little if any change in the copolymers of alternating base sequence.     

Analysis and interpretation of excess molar properties of amphiphile + water systems : Part 3. Excess molar volumes of isopropoxyethanol + water and isobutoxyethanol + water

Excess molar volumes at 25°C, are reported for the systems isoPrOEtOH + water and isoBuOEtOH + water across their entire composition ranges. These data have been compared to those for their normal alkyl analogs in order to assess the effects of both - and β-chain branching.

The results are discussed in terms of the relative abilities of the amphiphiles to form structured aggregates.     

New Chemotypes for the Inhibition of (p)ppGpp Synthesis in the Quest for New Antimicrobial Compounds

Antimicrobial resistance (AMR) poses a serious threat to our society from both the medical and economic point of view, while the antibiotic discovery pipeline has been dwindling over the last decades. Targeting non-essential bacterial pathways, such as those leading to antibiotic persistence, a bacterial bet-hedging strategy, will lead to new molecular entities displaying low selective pressure, thereby reducing the insurgence of AMR. Here, we describe a way to target (p)ppGpp (guanosine tetra- or penta-phosphate) signaling, a non-essential pathway involved in the formation of persisters, with a structure-based approach. A superfamily of enzymes called RSH (RelA/SpoT Homolog) regulates the intracellular levels of this alarmone. We virtually screened several fragment libraries against the (p)ppGpp synthetase domain of our RSH chosen model Rel_Seq, selected three main chemotypes, and measured their interaction with Rel_Seq by thermal shift assay and STD-NMR. Most of the tested fragments are selective for the synthetase domain, allowing us to select the aminobenzoic acid scaffold as a hit for lead development.     

Shear-induced particle segregation in binary mixtures:Verification of a percolation theory

Granular materials composed of different-sized grains may experience undesired segregation.Segrega-tion is detrimental for a lot of industries because it leads ...     

Analysis of Plant–Plant Interactions Reveals the Presence of Potent Antileukemic Compounds

A method to identify anticancer compounds in plants was proposed based on the hypothesis that these compounds are primarily present in plants to provide them with an ecological advantage over neighboring plants and other competitors. According to this view, identifying plants that contain compounds that inhibit or interfere with the development of other plant species may facilitate the discovery of novel anticancer agents. The method was developed and tested using Magnolia grandiflora, Gynoxys verrucosa, Picradeniopsis oppositifolia, and Hedyosmum racemosum, which are plant species known to possess compounds with cytotoxic activities. Plant extracts were screened for growth inhibitory activity, and then a thin-layer chromatography bioautography assay was conducted. This located the major antileukemic compounds 1, 2, 4, and 5 in the extracts. Once the active compounds were located, they were extracted and purified, and their structures were determined. The growth inhibitory activity of the purified compounds showed a significant correlation with their antileukemic activity. The proposed approach is rapid, inexpensive, and can easily be implemented in areas of the world with high biodiversity but with less access to advanced facilities and biological assays.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Estrous cycle influences the expression of neuronal nitric oxide synthase in the hypothalamus and limbic system of female mice

Background  

Nitric oxide plays an important role in the regulation of male and female sexual behavior in rodents, and the expression of the nitric oxide synthase (NOS) is influenced by testosterone in the male rat, and by estrogens in the female. We have here quantitatively investigated the distribution of nNOS immunoreactive (ir) neurons in the limbic hypothalamic region of intact female mice sacrificed during different phases of estrous cycle.