Ferrocenylethynyl derivatives of nucleoside triphosphates: synthesis, incorporation, electrochemistry, and bioanalytical applications

Modified dATP (2'-deoxyadenosine-5'-triphosphate) and dUTP (2'-deoxyuridine-5'-triphosphate) bearing ferrocene (Fc) labels linked via a conjugate acetylene spacer were prepared by single-step aqueous-phase cross-coupling reactions of 7-iodo-7-deaza-dATP or 5-iodo-dUTP with ethynylferrocene. The Fc-labeled dNTPs were good substrates for DNA polymerases and were efficiently incorporated to DNA by primer extension (PEX). Electrochemical analysis of the 2'-deoxyribonucleoside triphosphates (dNTPs) and PEX products revealed significant differences in redox potentials of the Fc label bound either to U or to 7-deazaA and between isolated dNTPs and conjugates incorporated to DNA. Prospective bioanalytical applications are outlined.     

Metal ion-promoted intramolecular electron transfer in a ferrocene-naphthoquinone linked dyad. Continuous change in driving force and reorganization energy with metal ion concentration

Thermal intramolecular electron transfer from the ferrocene (Fc) to naphthoquinone (NQ) moiety occurs efficiently by the addition of metal triflates (M(n)()(+): Sc(OTf)(3), Y(OTf)(3), Eu(OTf)(3)) to an acetonitrile solution of a ferrocene-naphthoquinone (Fc-NQ) linked dyad with a flexible methylene and an amide spacer, although no electron transfer takes place in the absence of M(n)()(+). The resulting semiquinone radical anion (NQ(*)(-)) is stabilized by the strong binding of M(n)()(+) with one carbonyl oxygen of NQ(*)(-)( )()as well as hydrogen bonding between the amide proton and the other carbonyl oxygen of NQ(*)(-). The high stability of the Fc(+)()-NQ(*)(-)/M(n)()(+)() complex allows us to determine the driving force of electron transfer by the conventional electrochemical method. The one-electron reduction potential of the NQ moiety of Fc-NQ is shifted to a positive direction with increasing concentration of M(n)()(+), obeying the Nernst equation, whereas the one-electron oxidation potential of the Fc moiety remains the same. The driving force dependence of the observed rate constant (k(ET)) of M(n)()(+)-promoted intramolecular electron transfer is well evaluated in light of the Marcus theory of electron transfer. The driving force of electron transfer increases with increasing concentration of M(n)()(+) [M(n)()(+)], whereas the reorganization energy of electron transfer decreases with increasing [M(n)()(+)] from a large value which results from the strong binding between NQ(*)(-) and M(n)()(+).     

Probing the Watson-Crick, wobble, and sugar-edge hydrogen bond sites of uracil and thymine

The nucleobases uracil (U) and thymine (T) offer three hydrogen-bonding sites for double H-bond formation via neighboring N-H and C=O groups, giving rise to the Watson-Crick, wobble and sugar-edge hydrogen bond isomers. We probe the hydrogen bond properties of all three sites by forming hydrogen bonded dimers of U, 1-methyluracil (1MU), 3-methyluracil (3MU), and T with 2-pyridone (2PY). The mass- and isomer-specific S1 <-- S0 vibronic spectra of 2PY.U, 2PY.3MU, 2PY.1MU, and 2PY.T were measured using UV laser resonant two-photon ionization (R2PI). The spectra of the Watson-Crick and wobble isomers of 2PY.1MU were separated using UV-UV spectral hole-burning. We identify the different isomers by combining three different diagnostic tools: (1) Selective methylation of the uracil N3-H group, which allows formation of the sugar-edge isomer only, and methylation of the N1-H group, which leads to formation of the Watson-Crick and wobble isomers. (2) The experimental S1 <-- S0 origins exhibit large spectral blue shifts relative to the 2PY monomer. Ab initio CIS calculations of the spectral shifts of the different hydrogen-bonded dimers show a linear correlation with experiment. This correlation allows us to identify the R2PI spectra of the weakly populated Watson-Crick and wobble isomers of both 2PY.U and 2PY.T. (3) PW91 density functional calculation of the ground-state binding and dissociation energies De and D0 are in agreement with the assignment of the dominant hydrogen bond isomers of 2PY.U, 2PY.3MU and 2PY.T as the sugar-edge form. For 2PY.U, 2PY.T and 2PY.1MU the measured wobble:Watson-Crick:sugar-edge isomer ratios are in good agreement with the calculated ratios, based on the ab initio dissociation energies and gas-phase statistical mechanics. The Watson-Crick and wobble isomers are thereby determined to be several kcal/mol less strongly bound than the sugar-edge isomers. The 36 observed intermolecular frequencies of the nine different H-bonded isomers give detailed insight into the intermolecular force field.     

Electrochemical and spectroelectrochemical studies on UO(2)(saloph)L (saloph = N,N'-disalicylidene-o-phenylenediaminate,L=dimethyl sulfoxide or N,N-dimethylformamide)

To examine properties of pentavalent uranium, U(V), we have carried out electrochemical and spectroelectrochemical studies on UO(2)(saloph)L [saloph = N,N'-disalicylidene-o-phenylenediaminate, L = dimethyl sulfoxide (DMSO) or N,N-dimethylformamide (DMF)]. The electrochemical reactions of UO(2)(saloph)L complexes in L were found to occur quasireversibly. The reduction processes of UO(2)(saloph)L complexes were followed spectroelectrochemically by using an optical transparent thin layer electrode cell. It was found that the absorption spectra measured at the applied potentials from 0 to -1.650 V versus ferrocene/ferrocenium ion redox couple (Fc/Fc(+)) for UO(2)(saloph)DMSO in DMSO have clear isosbestic points and that the evaluated electron stoichiometry equals 1.08. These results indicate that the reduction product of UO(2)(saloph)DMSO is [U(V)O(2)(saloph)DMSO](-), which is considerably stable in DMSO. Furthermore, it was clarified that the absorption spectrum of the [U(V)O(2)(saloph)DMSO](-) complex has a very small molar absorptivity in the visible region and characteristic absorption bands due to the 5f(1) orbital at around 750 and 900 nm. For UO(2)(saloph)DMF in DMF, the clear isosbestic points were not observed in the similar spectral changes. It is proposed that the UO(2)(saloph)DMF complex is reduced to [U(V)O(2)(saloph)DMF](-) accompanied by the dissociation of DMF as a successive reaction. The formal redox potentials of UO(2)(saloph)L in L (E(0), vs Fc/Fc(+)) for U(VI)/U(V) couple were determined to be -1.550 V for L = DMSO and -1.626 V for L = DMF.     

Spectroelectrochemical identification of a pentavalent uranyl tetrachloro complex in room-temperature ionic liquid

Reduction of U(VI)O(2)Cl(4)(2-) in a mixture of 1-ethyl-3-methylimidazolium tetrafluoroborate and its chloride at E°' = -0.996 V vs Fc/Fc(+) and 298 K affords U(V)O(2)Cl(4)(3-), which is kinetically stable and exhibits typical character of U(V) in the UV-vis-NIR absorption spectrum.     

Opening mechanism of G.T/U pairs in DNA and RNA duplexes: a combined study of imino proton exchange and molecular dynamics simulation

The opening pathway of wobble pairs dG.T and rG.U has been investigated in four DNA and two RNA duplexes. Using NMR spectroscopy, we measured the imino proton exchange of both G(H1) and T/U(H3), catalyzed by ammonia, tris, and OH(-), and we calculated the free energy surface related to G.T/U opening by molecular dynamics simulations. Taken together the experimental and theoretical results, we suggest that wobble pairs open through a coupled rotation of the bases toward the major groove where exchange of both imino protons takes place with the surrounding water.     

Phenolate and phenoxyl radical complexes of Cu(II) and Co(III), bearing a new redox active N,O-phenol-pyrazole ligand

The synthesis and characterisation of the new N,O-phenol-pyrazole pro-ligand, (pz)LH, comprising a pyrazole covalently linked to an o,p-di-tert-butyl-substituted phenol, are herein reported. In CH(2)Cl(2) at room temperature, the cyclic voltammogram (CV) of (pz)LH exhibits a quasi-reversible one-electron oxidation process (at E(1/2) = 0.66 V vs. Fc(+)/Fc) attributed to the formation of the phenoxyl radical cation [(pz)LH]˙(+). (pz)LH reacts with M(II)(BF(4))(2) (M = Cu, Co) in a 2:1 ratio to afford the bis-Cu(pz)L(2) (1) and tris-Co(pz)L(3) (2) complexes respectively. The X-ray structure of 1 reveals a Cu(II) ion in a square-planar trans-Cu(II)-N(2)O(2) coordination environment whereas that of 2 consists of a Co(III) ion with an octahedral mer-N(3)O(3) coordination sphere; formed by the chelation of two (in 1) or three (in 2) N,O-bidentate phenolate ligands respectively. Both structures are preserved in CH(2)Cl(2) solution, as revealed by their NMR (for 2) and EPR (for 1) data. The CVs of 1 and 2 consist of two (at E(1/2): 0.43 and 0.58 V vs. Fc(+)/Fc) and three (E(1/2) = 0.12, 0.54 and 0.89 V vs. Fc(+)/Fc) reversible one-electron oxidation processes, respectively. The one-electron electrochemical oxidation of 1 and 2 produces the oxidised species, 1(+) and 2(+), which are stable for several hours at room temperature under inert atmosphere in CH(2)Cl(2). The UV/vis and EPR data obtained for 1(+) and 2(+) are unambiguously consistent with the latter being formulated as Cu(II)- and Co(III)-phenoxyl radical complexes, as [Cu(II)((pz)L˙)((pz)L)](+) and [Co(III)((pz)L˙)((pz)L)(2)](+) respectively.     

Lanthanide(III)/actinide(III) differentiation in the cerium and uranium complexes [M(C5Me5)2(L)]0,+ (L=2,2'-bipyridine, 2,2':6',2''-terpyridine): structural, magnetic, and reactivity studies

Treatment of [Ce(Cp*)(2)I] or [U(Cp*)(2)I(py)] with 1 mol equivalent of bipy (Cp*=C(5)Me(5); bipy=2,2'-bipyridine) in THF gave the adducts [M(Cp*)(2)I(bipy)] (M=Ce (1 a), M=U (1 b)), which were transformed into [M(Cp*)(2)(bipy)] (M=Ce (2 a), M=U (2 b)) by Na(Hg) reduction. The crystal structures of 1 a and 1 b show, by comparing the U-N and Ce-N distances and the variations in the C-C and C-N bond lengths within the bidentate ligand, that the extent of donation of electron density into the LUMO of bipy is more important in the actinide than in the lanthanide compound. Reaction of [Ce(Cp*)(2)I] or [U(Cp*)(2)I(py)] with 1 mol equivalent of terpy (terpy=2,2':6',2'-terpyridine) in THF afforded the adducts [M(Cp*)(2)(terpy)]I (M=Ce (3 a), M=U (3 b)), which were reduced to the neutral complexes [M(Cp*)(2)(terpy)] (M=Ce (4 a), M=U (4 b)) by sodium amalgam. The complexes [M(Cp*)(2)(terpy)][M(Cp*)(2)I(2)] (M=Ce (5 a), M=U (5 b)) were prepared from a 2:1 mixture of [M(Cp*)(2)I] and terpy. The rapid and reversible electron-transfer reactions between 3 and 4 in solution were revealed by (1)H NMR spectroscopy. The spectrum of 5 b is identical to that of the 1:1 mixture of [U(Cp*)(2)I(py)] and 3 b, or [U(Cp*)(2)I(2)] and 4 b. The magnetic data for 3 and 4 are consistent with trivalent cerium and uranium species, with the formulation [M(III)(Cp*)(2)(terpy(*-))] for 4 a and 4 b, in which spins on the individual units are uncoupled at 300 K and antiferromagnetically coupled at low temperature. Comparison of the crystal structures of 3 b, 4 b, and 5 b with those of 3 a and the previously reported ytterbium complex [Yb(Cp*)(2)(terpy)] shows that the U-N distances are much shorter, by 0.2 A, than those expected from a purely ionic bonding model. This difference should reflect the presence of stronger electron transfer between the metal and the terpy ligand in the actinide compounds. This feature is also supported by the small but systematic structural variations within the terdentate ligands, which strongly suggest that the LUMO of terpy is more filled in the actinide than in the lanthanide complexes and that the canonical forms [U(IV)(Cp*)(2)(terpy(*-))]I and [U(IV)(Cp*)(2)(terpy(2-))] contribute significantly to the true structures of 3 b and 4 b, respectively. This assumption was confirmed by the reactions of complexes 3 and 4 with the H(.) and H(+) donor reagents Ph(3)SnH and NEt(3)HBPh(4), which led to clear differentiation of the cerium and uranium complexes. No reaction was observed between 3 a and Ph(3)SnH, while the uranium counterpart 3 b was transformed in pyridine into the uranium(IV) compound [U(Cp*)(2){NC(5)H(4)(py)(2)}]I (6), where NC(5)H(4)(py)(2) is the 2,6-dipyridyl(hydro-4-pyridyl) ligand. Complex 6 was further hydrogenated to [U(Cp*)(2){NC(5)H(8)(py)(2)}]I (7) by an excess of Ph(3)SnH in refluxing pyridine. Treatment of 4 a with NEt(3)HBPh(4) led to oxidation of the terpy(*-) ligand and formation of [Ce(Cp*)(2)(terpy)]BPh(4), whereas similar reaction with 4 b afforded [U(Cp*)(2){NC(5)H(4)(py)(2)}]BPh(4) (6'). The crystal structures of 6, 6' and 7 were determined.     

Quenching of the electrochemiluminescence of tris(2,2'-bipyridine)ruthenium(II) by ferrocene and its potential application to quantitative DNA detection

Efficient and stable quenching of electrochemiluminescence (ECL) of tris(2,2'-bipyridine)ruthenium(II) by oxidizing ferrocene methanol (FcMeOH) at the electrode is reported. Bimolecular energy or electron transfer between Ru(bpy)(3)(2+*) and ferrocenium (Fc(+)), the oxidized species of Fc, along with suppression of radical reactions is suggested as the mechanism for quenching ECL. Fc shows more efficient quenching of ECL compared with the known quenchers phenol and 1,1-dimethyl-4,4'-bipyridine dication (MV(2+)). The ECL quenching rate constant was 5.6 x 10(10) M(-)(1) s(-)(1). Using Fc as a quencher label on a complementary DNA sequence, an intramolecular ECL quenching in hybridized oligonucleotide strands has been realized. With essentially complete quenching efficiency, this system has the potential for application to sequence-specific DNA detection.     

Electrochemiluminescent peptide nucleic acid-like monomers containing Ru(II)-dipyridoquinoxaline and Ru(II)-dipyridophenazine complexes

A series of Ru(II)-peptide nucleic acid (PNA)-like monomers, [Ru(bpy)(2)(dpq-L-PNA-OH)](2+) (M1), [Ru(phen)(2)(dpq-L-PNA-OH)](2+) (M2), [Ru(bpy)(2)(dppz-L-PNA-OH)](2+) (M3), and [Ru(phen)(2)(dppz-L-PNA-OH)](2+) (M4) (bpy = 2,2'-bipyridine, phen = 1,10-phenanthroline, dpq-L-PNA-OH = 2-(N-(2-(((9H-fluoren-9-yl)methoxy)carbonylamino)ethyl)-6-(dipyrido[3,2-a:2',3'-c]phenazine-11-carboxamido)hexanamido)acetic acid, dppz-L-PNA-OH = 2-(N-(2-(((9H-fluoren-9-yl) methoxy)carbonylamino)ethyl)-6-(dipyrido[3,2-f:2',3'-h]quinoxaline-2-carboxamido)acetic acid) have been synthesized and characterized by IR and (1)H NMR spectroscopy, mass spectrometry, and elemental analysis. As is typical for Ru(II)-tris(diimine) complexes, acetonitrile solutions of these complexes (M1-M4) show MLCT transitions in the 443-455 nm region and emission maxima at 618, 613, 658, and 660 nm, respectively, upon photoexcitation at 450 nm. Changes in the ligand environment around the Ru(II) center are reflected in the luminescence and electrochemical response obtained from these monomers. The emission intensity and quantum yield for M1 and M2 were found to be higher than for M3 and M4. Electrochemical studies in acetonitrile show the Ru(II)-PNA monomers to undergo a one-electron redox process associated with Ru(II) to Ru(III) oxidation. A positive shift was observed in the reversible redox potentials for M1-M4 (962, 951, 936, and 938 mV, respectively, vs Fc(0/+) (Fc = ferrocene)) in comparison with [Ru(bpy)(3)](2+) (888 mV vs Fc(0/+)). The ability of the Ru(II)-PNA monomers to generate electrochemiluminescence (ECL) was assessed in acetonitrile solutions containing tripropylamine (TPA) as a coreactant. Intense ECL signals were observed with emission maxima for M1-M4 at 622, 616, 673, and 675 nm, respectively. At an applied potential sufficiently positive to oxidize the ruthenium center, the integrated intensity for ECL from the PNA monomers was found to vary in the order M1 (62%) > M3 (60%) > M4 (46%) > M2 (44%) with respect to [Ru(bpy)(3)](2+) (100%). These findings indicate that such Ru(II)-PNA bioconjugates could be investigated as multimodal labels for biosensing applications.     

Photoinduced Electron Transfer in Clicked Ferrocene-BODIPY-Fullerene Conjugates

Ferrocene-BODIPY (Fc-BDP) conjugates in which one or two ferrocene entities are linked to the β-positions of the BODIPY core by an ethynyl bridge have been developed. These derivatives were easily and efficiently grafted onto a dual-clickable fullerene platform using CuAAC reactions, leading to a clickable Fc-BDP-C₆₀ triad and a clickable [Fc]₂-BDP-C₆₀ tetrad which can be used for further derivatization with complex structures. Due to the extended π-conjugation and the presence of an intramolecular charge transfer band from Fc to BDP, all these conjugates display a broad absorption in the visible region, which is bathochromically shifted when two Fc are appended to the BDP core. Ultrafast multistep electron transfers leading to charge stabilization were demonstrated in the Fc-BDP-C₆₀ triad and [Fc]₂-BDP-C₆₀ tetrad by femtosecond transient absorption studies.     

Structural, spectroscopic and redox properties of uranyl complexes with a maleonitrile containing ligand

The reaction of uranyl nitrate hexahydrate with the maleonitrile containing Schiff base 2,3-bis[(4-diethylamino-2-hydroxybenzylidene)amino]but-2-enedinitrile (salmnt((Et(2)N)(2))H(2)) in methanol produces [UO(2)(salmnt((Et2N)2))(H(2)O)] (1) where the uranyl equatorial coordination plane is completed by the N(2)O(2) tetradentate cavity of the (salmnt((Et(2)N)(2)))(2-) ligand and a water molecule. The coordinated water molecule readily undergoes exchange with pyridine (py), dimethylsulfoxide (DMSO), N,N-dimethylformamide (DMF) and triphenylphosphine oxide (TPPO) to give a series of [UO(2)(salmnt((Et(2)N)(2)))(L)] complexes (L = py, DMSO, DMF, TPPO; 2-5, respectively). X-Ray crystallography of 1-5 show that the (salmnt((Et(2)N)(2)))(2-) ligand is distorted when coordinated to the uranyl moiety, in contrast to the planar structure observed for the free protonated ligand (salmnt((Et(2)N)(2))H(2)). The Raman spectra of 1-5 only display extremely weak bands (819-828 cm(-1)) that can be assigned to the typically symmetric O=U=O stretch. This stretching mode is also observed in the infrared spectra for all complexes 1-5 (818-826 cm(-1)) predominantly caused by the distortion of the tetradentate (salmnt((Et(2)N)(2)))(2-) ligand about the uranyl equatorial plane resulting in a change in dipole for this bond stretch. The solution behaviour of 2-5 was studied using NMR, electronic absorption and emission spectroscopy, and cyclic voltammetry. Complexes 2-5 exhibit intense absorptions in the visible region of the spectrum due to intramolecular charge transfer (ICT) transitions and the luminescence lifetimes (< 5 ns) indicate the emission arises from ligand-centred excited states. Reversible redox processes assigned to the {UO(2)}(2+)/{UO(2)}(+) couple are observed for complexes 2-5 (2: E(1/2) = -1.80 V; 3,5: E(1/2) = -1.78 V; 4: E(1/2) = -1.81 V : vs. ferrocenium/ferrocene {Fc(+)/Fc}, 0.1 M Bu(4)NPF(6)) in dichloromethane (DCM). These are some of the most negative half potentials for the {UO(2)}(2+)/{UO(2)}(+) couple observed to date and indicate the strong electron donating nature of the (salmnt((Et(2)N)(2)))(2-) ligand. Multiple uranyl redox processes are clearly seen for [UO(2)(salmnt((Et(2)N)(2)))(L)] in L (L = py, DMSO, DMF; 2-4: 0.1 M Bu(4)NPF(6)) indicating the relative instability of these complexes when competing ligands are present, but the reversible {UO(2)}(2+)/{UO(2)}(+) couple for the intact complexes can still be assigned and shows the position of this couple can be modulated by the solvation environment. Several redox processes were also observed between +0.2 and +1.2 V (vs. Fc(+)/Fc) that prove the redox active nature of the maleonitrile-containing ligand.     

Redox-induced coordination isomerization of a phosphoniobenzophospholide

1-Triphenylphosphoniobenzo[c]phospholide 1 reacts with [M(CO)(5)Br] (M = Mn, Re) and [Mn(CO)(3)(naphthalene)][BF(4)] to give complexes cis-[M(CO)(4)(1)Br] (5 a,b) and [Mn(CO)(3)(1)][BF(4)] (6 a[BF(4)]), respectively, featuring eta(1)(P)- and eta(5)(pi)-coordination of the phosphole ring. The corresponding reactions with [M(2)(CO)(10)] proceed with conservation of the metal-metal bond and yield, depending on the reaction temperature, dinuclear complexes [M(2)(CO)(8)(1)] (M=Mn, 7 a) or [M(2)(CO)(6)(1)(2)] (M=Mn, Re, 8 a,b) with mu(2)-bridging eta(1)(P):eta(2)(Pdbond;C) coordination of the phosphole moiety. All complexes formed were characterized by spectroscopic data; 5 b, 6 a[BF(4)], and 8 a,b were characterized by X-ray diffraction studies as well. The structural and (31)P NMR data of the dinuclear manganese complex 8 a suggest that the interaction between the metal atoms and the eta(2)-bound Pdbond;C double bond moieties is dominated by the L-->M charge-transfer contribution; this hints at a very low back-donation ability of the central M(2)(CO)(6) fragment. Investigation of the reactions of the Mn complexes 6 a and 8 a with Mg or ferrocenium hexafluorophosphate ([Fc][PF(6)]), respectively, revealed that the chemically reversible mutual interconversion between both species was feasible. Likewise, oxidation of the rhenium complex 8 b with [Fc][PF(6)] gave spectroscopic evidence for the formation of a Re analogue of 6 a. Electrochemical studies suggested that the oxidation 8 a-->2 6 a involves two consecutive single-electron-transfer steps, the first of which is electrochemically reversible and produces a metastable radical cation that is detectable by ESR spectroscopy. The mutual interconversion between 6 a and 8 a represents the first case of a reversible coordination isomerization of a phosphaarene that is triggered by a redox process and might stimulate further studies directed at the use of dinuclear phosphaarene complexes in redox-catalysis.     

Complexation studies of iodides of trivalent uranium and lanthanides (Ce and Nd) with 2,2'-bipyridine in anhydrous pyridine solutions

In anhydrous pyridine solution at 294 K, U(III) and Ce(III) triiodides were found to form both 1:1 (ML) and 1:2 (ML(2)) complexes with bipyridine (bipy = L) while Nd(III) triodide formed only a 1:2 complex. The 1:3 (ML(3)) complexes were identified at low temperature with a large excess of L. Conductometry measurements showed for U(III) a large increase in the conductivity when increasing the molar ratio L:U. The complex UL(2) was found to be a 1:1 electrolyte and the species UI(2)(+) was more reactive toward L in comparison with UI(3). For Ce(III) and Nd(III), MI(2)(+) and MI(3) present about the same affinity for L. The stability of the complexes is limited, and U(III) possesses a slightly higher affinity for bipy than the trivalent lanthanides. Interestingly, a preference for the formation of ML(2) complex was shown for all the studied M(III) ions. The driving force for complex formation was always the enthalpy, and, surprisingly for a bidendate ligand (bipy), no favorable entropy contribution to complex formation was observed. The X-ray crystal structures of [CeI(3)(bipy)(2)(py)](4).5py.bipy and UI(3)(bipy)(2)(py).2py were determined. The structures of the molecules MI(3)(bipy)(2)(py) are almost identical for U and Ce. The mean M(III)-N(bipy) bond distances are equal to 2.67(3) A for Ce(III) and 2.65(4) A for U(III). The slightly smaller M(III)-N(bipy) distances observed for U(III) would reflect a slightly more important covalent character of the U(III)-N(bipy) bonds, in agreement with the slightly better affinity of U(III) than Ce(III) or Nd(III) toward bipy observed in solution and with the fact that the enthalpy is the driving force for complex formation.     

Trimming Crystallizable Fragment (Fc) Glycans Enables the Direct Enzymatic Transfer of Biomacromolecules to Antibodies as Therapeutics**

Glycoengineering has provided powerful tools to construct site-specific antibody conjugates. However, only small-molecule payloads can be directly transferred to native or engineered antibodies using existing glycoengineering strategies. Herein, we demonstrate that reducing the complexity of crystallizable fragment (Fc) glycans could dramatically boost the chemoenzymatic modification of immunoglobulin G (IgG) via an engineered fucosyltransferase. In this platform, antibodies with Fc glycans engineered to a simple N-acetyllactosamine (LacNAc) disaccharide are successfully conjugated to biomacromolecules, such as oligonucleotides and nanobodies, in a single step within hours. Accordingly, we synthesized an antibody-conjugate-based anti-human epidermal growth factor receptor 2 (HER2)/ cluster of differentiation 3 (CD3) bispecific antibody and used it to selectively destroy patient-derived cancer organoids by reactivating endogenous T lymphocyte cells (T cells) inside the organoid. Our results highlight that this platform is a general approach to construct antibody-biomacromolecule conjugates with translational values.     

Gold and silver complexes with the ferrocenyl phosphine FcCH2PPh2

Linear gold(I) and silver(I) complexes with the ferrocenyl phosphine FcCH2PPh2 [Fc = (eta5-C5H5)Fe(eta5-C5H4)] of the types [AuR(PPh2CH2Fc)], [M(PPh3)(PPh2CH2Fc)]OTf, and [M(PPh2CH2Fc)2]OTf (M = Au, Ag) have been obtained. Three-coordinate gold(I) and silver(I) derivatives of the types [AuCl(PPh2CH2Fc)2] and [M(PPh2CH2Fc)3]X (M = Au, X = ClO4; M = Ag, X = OTf) have been obtained from the corresponding gold and silver precursors in the appropriate molar ratio, although some of them are involved in equilibria in solution. The crystal structures of [AuR(PPh2CH2Fc)] (R = Cl, C6F5), [AuL(PPh2CH2Fc)]OTf (L = PPh3, FcCH2PPh2), [Au(C6F5)3(PPh2CH2Fc)], and [Ag(PPh2CH2Fc)3]OTf have been determined by X-ray diffraction studies.     

Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) tethering a Hoechst 33258 analogue: triplex and duplex stabilization by simultaneous minor groove binding

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.     

A novel RNA motif based on the structure of unusually stable 2',5'-linked r(UUCG) loops

We have recently shown that hairpins containing 2',5'-linked RNA loops exhibit superior thermodynamic stability compared to native hairpins comprised of 3',5'-RNA loops [Hannoush, R. N.; Damha, M. J. J. Am. Chem. Soc. 2001, 123, 12368-12374]. A remarkable feature of the 2',5'-r(UUCG) tetraloop is that, unlike the corresponding 3',5'-linked tetraloop, its stability is virtually independent of the hairpin stem composition. Here, we determine the solution structure of unusually stable hairpins of the sequence 5'-G(1)G(2)A(3)C(4)-(U(5)U(6)C(7)G(8))-G(9)(U/T(10))C(11)C(12)-3' containing a 2',5'-linked RNA (UUCG) loop and either an RNA or a DNA stem. The 2',5'-linked RNA loop adopts a new fold that is completely different from that previously observed for the native 3',5'-linked RNA loop. The 2',5'-RNA loop is stabilized by (a). U5.G8 wobble base pairing, with both nucleotide residues in the anti-conformation, (b). extensive base stacking, and (c). sugar-base and sugar-sugar contacts, all of which contribute to the extra stability of this hairpin structure. The U5:G8 base pair stacks on top of the C4:G9 loop-closing base pair and thus appears as a continuation of the stem. The loop uracil U6 base stacks above U5 base, while the cytosine C7 base protrudes out into the solvent and does not participate in any of the stabilizing interactions. The different sugar pucker and intrinsic bonding interactions within the 2',5'-linked ribonucleotides help explain the unusual stability and conformational properties displayed by 2',5'-RNA tetraloops. These findings are relevant for the design of more effective RNA-based aptamers, ribozymes, and antisense agents and identify the 2',5'-RNA loop as a novel structural motif.     

Furan- and selenophene-2-carboxylato derivatives of dimolybdenum and ditungsten (M[quadruple bond]M): a comparison of their chemical and photophysical properties

From the reactions between M(2)(T(i)PB)(4), where T(i)PB = 2,4,6-triisopropylbenzoate and two equivalents each of 2-furan carboxylic acid, FuCO(2)H, and 2-selenophene carboxylic acid, SpCO(2)H in toluene, the new compounds trans-M(2)(T(i)PB)(2)(O(2)CFu)(2) (1a M = Mo, 2a M = W) and trans-M(2)(T(i)PB)(2)(O(2)CSp)(2) (1b M = Mo, 2b M = W) were formed. These new compounds have been characterized by (1)H NMR, steady-state UV-Vis-NIR absorption and emission spectroscopy, cyclic and differential pulse voltammetry, and fs and ns transient absorption spectroscopy. The compound Mo(2)(T(i)PB)(2)(O(2)CSp)(2) (1b) has been characterized by single crystal X-ray crystallography. These data are compared with those previously reported for related 2-thiophene carboxylate derivatives: M(2)(T(i)PB)(2)(O(2)CTh)(2). The physico-chemical data correlate well with electronic structure calculations performed on model compounds. All compounds have detectible S(1) photoexcited states with lifetimes that vary from ～5 ps to < 1 ps. The molybdenum compounds have T(1) states with microsecond lifetimes that are assigned as MMδδ* whereas the T(1) states for tungsten are (3)MLCT with lifetimes on the order of nanoseconds. In all cases, shorter lifetimes were seen in complexes containing heavier atoms.     

Fluorescent and Electrochemical Sensing of Polyphosphate Nucleotides by Ferrocene Functionalised with Two ZnII(TACN)(pyrene) Complexes

The [Fc? bis{Zn^II(TACN)(Py)}] complex, comprising two Zn^II(TACN) ligands (Fc=ferrocene; Py=pyrene; TACN=1,4,7‐triazacyclononane) bearing fluorescent pyrene chromophores linked by an electrochemically active ferrocene molecule has been synthesised in high yield through a multistep procedure. In the absence of the polyphosphate guest molecules, very weak excimer emission was observed, indicating that the two pyrene‐bearing Zn^II(TACN) units are arranged in a trans‐like configuration with respect to the ferrocene bridging unit. Binding of a variety of polyphosphate anionic guests (PPi and nucleotides di‐ and triphosphate) promotes the interaction between pyrene units and results in an enhancement in excimer emission. Investigations of phosphate binding by ³¹P NMR spectroscopy, fluorescence and electrochemical techniques confirmed a 1:1 stoichiometry for the binding of PPi and nucleotide polyphosphate anions to the bis(Zn^II(TACN)) moiety of [Fc? bis{Zn^II(TACN)(Py)}] and indicated that binding induces a trans to cis configuration rearrangement of the bis(Zn^II(TACN)) complexes that is responsible for the enhancement of the pyrene excimer emission. Pyrophosphate was concluded to have the strongest affinity to [Fc? bis{Zn^II(TACN)(Py)}] among the anions tested based on a six‐fold fluorescence enhancement and 0.1 V negative shift in the potential of the ferrocene/ferrocenium couple. The binding constant for a variety of polyphosphate anions was determined from the change in the intensity of pyrene excimer emission with polyphosphate concentration, measured at 475 nm in CH₃CN/Tris‐HCl (1:9) buffer solution (10.0 mM , pH 7.4). These measurements confirmed that pyrophosphate binds more strongly (K_b=(4.45±0.41)×10⁶ M ^?1) than the other nucleotide di‐ and triphosphates (K_b=1–50×10⁵ M ^?1) tested.