Synthesis and properties of oligonucleotides having a phosphorus chiral center by incorporation of conformationally rigid 5'-cyclouridylic acid derivatives

This paper describes the design and synthesis of a conformationally rigid dimer building block Umpc3Um as a chiral center at the phosphate group with the S/N junction where c3 refers to a propylene bridge linked between the uracil 5-position and 5'-phosphate group of pUm. The extensive H1 NMR analysis of Umpc3Um suggests that the 5'-upstream Um has predominantly a C2'-endo conformation and the pc3Um moiety exists almost exclusively in a C3'-endo conformation. The absolute configuration of the diastereomers Umpc3Um(fast) (8a) and Umpc3Um(slow) (8b) was determined by CD spectroscopy as well as computer simulations. The oligonucleotides U4[Umpc3Um(fast)]U4 (13a) and U4[Umpc3Um(slow)]U4 (13b) incorporating 8a and 8b were synthesized by use of the phosphoramidite building blocks 11a and 11b, respectively. The Tm experiments of the duplexes formed between these modified oligomers and the complementary oligomers imply that the modified oligomer 13a having Umpc3Um(fast) has the Sp configuration at the chiral phosphoryl group.     

5' modification of duplex DNA with a ruthenium electron donor-acceptor pair using solid-phase DNA synthesis

Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.     

Stable and selective formation of hoogsteen-type triplexes and duplexes using twisted intercalating nucleic acids (TINA) prepared via postsynthetic Sonogashira solid-phase coupling reactions

Bulge insertions of (R)-1-O-[4-(1-pyrenylethynyl)phenylmethyl]glycerol (5) into the middle of homopyrimidine oligodeoxynucleotides (twisted intercalating nucleic acids, TINA) obtained via postsynthetic Sonogashira coupling reaction led to extraordinary high thermal stability of Hoogsteen-type triplexes and duplexes, whereas Watson-Crick-type duplexes of the same nucleotide content were destabilized. Modified oligonucleotides were synthesized using the phosphoramidite of (S)-1-(4,4'-dimethoxytriphenylmethyloxy)-3-(4-iodo-benzyloxy)-propan-2-ol followed by treatment of the oligonucleotide on a CPG-support with the Sonogashira-coupling reaction mixture containing different ethynylaryls. Bulged insertion of the pyrene derivative 5 into oligonucleotides was found to be the best among the tested modifications for binding to the Hoogsteen-type triplexes and duplexes. Thus, at pH 7.2 an oligonucleotide with cytidine content of 36% possessing two bulged insertions of 5 separated by three bases formed a stable triplex (T(m) = 43.0 degrees C), whereas the native oligonucleotide was unable to bind to the target duplex. The corresponding Watson-Crick-type duplex with the same oligonucleotide had T(m) of 38.0 degrees C at pH 7.2, while the T(m) of unmodified dsDNA was 47.0 degrees C. Experiments with mismatched oligonucleotides, luminescent properties, and potential applications of TINA technology is discussed.     

Chemical Synthesis of a 5'-Terminal TMG-Capped Triribonucleotide m(3)(2,2,7)G(5)(')pppAmpUmpA of U1 RNA

The 5'-terminal TMG-capped triribonucleotide, m(3)(2,2,7)G(5)(')pppAmpUmpA, has been synthesized by condensation of an appropriately protected triribonucleotide derivative of ppAmpUmpA with a new TMG-capping reagent. During this total synthesis, it was found that the regioselective 2'-O-methylation of 3',5'-O-(1,1,3,3-tetraisopropyldisiloxane-1,3-diyl)-N-(4-monomethoxytrityl)adenosine was achieved by use of MeI/Ag(2)O without affecting the base moiety. A new route to 2-N,2-N-dimethylguanosine from guanosine via a three-step reaction has also been developed by reductive methylation using paraformaldehyde and sodium cyanoborohydride. These key intermediates were used as starting materials for the construction of a fully protected derivative of pAmpUmpA and a TMG-capping reagent of Im-pm(3)(2,2,7)G. The target TMG-capped tetramer, m(3)(2,2,7)G(5)(')pppAmpUmpA, was synthesized by condensation of a partially protected triribonucleotide 5'-terminal diphosphate species, ppA(MMTr)mpUmpA, with Im-pm(3)(2,2,7)G followed by treatment with 80% acetic acid. The structure of m(3)(2,2,7)G(5)(')pppAmpUmpA was characterized by (1)H and (31)P NMR spectroscopy as well as enzymatic assay using snake venom phosphodiesterase, calf intestinal phosphatase, and nuclease P1.     

Synthesis and conformational properties of oligonucleotides incorporating 2'-O-phosphorylated ribonucleotides as structural motifs of pre-tRNA splicing intermediates

To synthesize oligonucleotides containing 2'-O-phosphate groups, four kinds of ribonucleoside 3'-phosphoramidite building blocks 6a-d having the bis(2-cyano-1,1-dimethylethoxy)thiophosphoryl (BCMETP) group were prepared according to our previous phosphorylation procedure. These phosphoramidite units 6a-d were not contaminated with 3'-regioisomers and were successfully applied to solid-phase synthesis to give oligodeoxyuridylates 15, 16 and oligouridylates 21, 22. Self-complementary Drew-Dickerson DNA 12mers 24-28 replaced by a 2'-O-phosphorylated ribonucleotide at various positions were similarly synthesized. In these syntheses, it turned out that KI(3) was the most effective reagent for oxidative desulfurization of the initially generated thiophosphate group to the phosphate group on polymer supports. Without using this conversion step, a tridecadeoxyuridylate 17 incorporating a 2'-O-thiophosphorylated uridine derivative was also synthesized. To investigate the effect of the 2'-phosphate group on the thermal stability and 3D-structure of DNA(RNA) duplexes, T(m) measurement of the self-complementary oligonucleotides obtained and MD simulation of heptamer duplexes 33-36 were carried out. According to these analyses, it was suggested that the nucleoside ribose moiety phosphorylated at the 2'-hydroxyl function predominantly preferred C2'-endo to C3'-endo conformation in DNA duplexes so that it did not significantly affect the stability of the DNA duplex. On the other hand, the 2'-modified ribose moiety was expelled to give a C3'-endo conformation in RNA duplexes so that the RNA duplexes were extremely destabilized.     

Structural studies of LNA:RNA duplexes by NMR: conformations and implications for RNase H activity

We have used NMR and CD spectroscopy to study the conformations of modified oligonucleotides (locked nucleic acid, LNA) containing a conformationally restricted nucleotide (T(L)) with a 2'-O,4'-C-methylene bridge. We have investigated two LNA:RNA duplexes, d(CTGAT(L)ATGC):r(GCAUAUCAG) and d(CT(L)GAT(L)AT(L)GC):r(GCAUAUCAG), along with the unmodified DNA:RNA reference duplex. Increases in the melting temperatures of +9.6 degrees C and +8.1 degrees C per modification relative to the unmodified duplex were observed for these two LNA:RNA sequences. The three duplexes all adopt right-handed helix conformations and form normal Watson-Crick base pairs with all the bases in the anti conformation. Sugar conformations were determined from measurements of scalar coupling constants in the sugar rings and distance information derived from 1H-1H NOE measurements; all the sugars in the RNA strands of the three duplexes adopt an N-type conformation (A-type structure), whereas the sugars in the DNA strands change from an equilibrium between S- and N-type conformations in the unmodified duplex towards more of the N-type conformation when modified nucleotides are introduced. The presence of three modified T(L) nucleotides induces drastic conformational shifts of the remaining unmodified nucleotides of the DNA strand, changing all the sugar conformations except those of the terminal sugars to the N type. The CD spectra of the three duplexes confirm the structural changes described above. On the basis of the results reported herein, we suggest that the observed conformational changes can be used to tune LNA:RNA duplexes into substrates for RNase H: Partly modified LNA:RNA duplexes may adopt a duplex structure between the standard A and B types, thereby making the RNA strand amenable to RNase H-mediated degradation.     

Conversion of single-stranded oligonucleotides into cloned duplexes and its consecutive application to short artificial genes.

A general method to convert single-stranded, chemically synthesized oligonucleotides into cloned duplexes is described. Oligonucleotides supplied with 3'-terminal extensions that are complementary to 3'-protruding ends obtained by certain restriction enzymes can be cloned either directly or with the help of an adapter molecule into double-stranded vectors. Two methods have also been developed for consecutive cloning applications. According to these methods, the synthetic oligonucleotides (and their enzymatically prepared complementary strands) are joined, one after the other, inside a cloning vector, each joining requiring one cloning step. Synthetic genes are thus built up from oligonucleotides corresponding to only one strand of the DNA. The sequential assembly of the cloned duplex takes place in the 5' to 3' direction. Each oligonucleotide is supplied with a four-nucleotide-long 3'-terminal extension, but this sequence is eliminated when the joining takes place, leaving no limiting sequence between the oligonucleotides. The two consecutive cloning methods, the adapter and the polycloning site methods, are illustrated by the assembly of short artificial genes.     

Synthesis and Properties of Isobicyclo‐DNA

We present the synthesis of the isobicyclo‐DNA building blocks with the nucleobases A, C, G and T, as well as biophysical and biological properties of oligonucleotides derived thereof. The synthesis of the sugar part was achieved in 5 steps starting from a known intermediate of the tricyclo‐DNA synthesis. Dodecamers containing single isobicyclo‐thymidine incorporations, fully modified A‐ and T‐containing sequences, and fully modified oligonucleotides containing all four bases were synthesized and characterized. Isobicyclo‐DNA forms stable duplexes with natural nucleic acids with a pronounced preference for DNA over RNA as complements. The most stable duplexes, however, arise by self‐pairing. Isobicyclo‐DNA forms preferentially B‐DNA‐like duplexes with DNA and A‐like duplexes with complementary RNA as determined by circular dichroism (CD) spectroscopy. Self‐paired duplexes show a yet unknown structure, as judged from CD spectroscopy. Biochemical tests revealed that isobicyclo‐DNA is stable in fetal bovine serum and does not elicit RNaseH activity.     

Parallel-stranded DNA: enhancing duplex stability by the 'G-clamp' and a pyrrolo-dC derivative

The new pyrrolo-dC derivative 4 tethered with an alkylamino side chain via a triazole linker was synthesized. Oligonucleotides containing the G-clamp 3 or the pyrrolo-dC derivative 4 were prepared. Oligonucleotide synthesis and deprotection under standard conditions led to unwanted side product formation. The side product was identified as an acrylonitrile adduct of the aminoalkyl side chain. Changing the synthesis and work-up conditions to fast-deprotection chemistry and performing β-elimination of the cyanoethyl group on the solid support yielded pure oligonucleotides. Oligonucleotide duplexes with parallel chain orientation were constructed incorporating dA·dT and isoG(d)·dC base pairs. Replacement of dC-residues by the G-clamp 3 led to extraordinarily stable duplexes (ΔT(m) = +11 °C for two incorporations) in ps DNA, while the pyrrolo-dC derivative 4 behaved like dC. Surprisingly, the G-clamp 3 forms an even more stable base pair with 2'-deoxyisoguanosine in DNA with parallel chain orientation than with 2'-deoxyguanosine in aps DNA.     

Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) tethering a Hoechst 33258 analogue: triplex and duplex stabilization by simultaneous minor groove binding

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.     

Automated synthesis of 3'-metalated oligonucleotides

We report the first synthesis of a metallonucleoside bound to a solid support and subsequent oligonucleotide synthesis with this precursor. Large-scale syntheses of metal-containing oligonucleotides are achieved using a solid support modified with [Ru(bpy)(2)(impy')](2+) (bpy is 2,2'-bipyridine; impy' is 2'-iminomethylpyridyl-2'-deoxyuridine). A duplex formed with the metal-containing oligonucleotide exhibits superior thermal stability when compared to the corresponding unmetalated duplex (T(m) = 50 degrees C vs T(m) = 48 degrees C). Electrochemical (E(1/2) = 1.3 V vs NHE), absorption (lambda(max) = 480 nm), and emission (lambda(max) = 720 nm, tau = 44 ns, Phi = 0.11 x 10(-)(3)) data for the ruthenium-modified oligonucleotides indicate that the presence of the oligonucleotide does not perturb the electronic properties of the ruthenium complex. The absence of any change in the emission properties upon duplex formation suggests that the [Ru(bpy)(2)(impy)](2+) chromophore will be a valuable probe for DNA-mediated electron-transfer studies. Despite the relatively high Ru(III/II) reduction potential, oxidative quenching of photoexcited [Ru(bpy)(2)(impy)](2+) does not lead to oxidative damage of guanine or other DNA bases.     

Synthesis of the DNA-[Ru(tpy)(dppz)(CH(3)CN)](2+) conjugates and their photo cross-linking studies with the complementary DNA strand

We here report our studies on the conjugation of photoreactive Ru(2+) complex to oligonucleotides (ODNs), which give a stable duplex with the complementary target DNA strand. These functionalized DNA duplexes bearing photoreactive Ru(2+) complex can be specifically photolyzed to give the reactive aqua derivative, [Ru(tpy)(dppz)(H(2)O)](2+)-ODN (tpy = 2,2':6',2' '-terpyridine; dppz = dipyrido[3,2-a:2',3'-c]phenazine), in situ, which successfully cross-links to give photoproduct(s) in the duplex form with the target complementary DNA strand. Thus, the stable precursor of the aquaruthenium complex, the monofunctional polypyridyl ruthenium complex [Ru(tpy)(dppz)(CH(3)CN)](2+), has been site-specifically tethered to ODN, for the first time, by both solid-phase synthesis and postsynthetic modifications. (i) In the first approach, pure 3'-[Ru(tpy)(dppz)(CH(3)CN)](2+)-ODN conjugate has been obtained in 42% overall yield (from the monomer blocks) by the automated solid-phase synthesis on a support labeled with [Ru(tpy)(dppz)Cl](+) complex with subsequent liberation of the crude conjugate from the support under mild conditions and displacement of the Cl(-) ligand by acetonitrile in the coordination sphere of the Ru(2+) label. (ii) In the second approach, the single-modified (3'- or 5'- or middle-modified) or 3',5'-bis-modified Ru(2+)-ODN conjugates were prepared in 28-50% yield by an amide bond formation between an active ester of the metal complex and the ODNs conjugated with an amino linker. The pure conjugates were characterized unambiguously by ultraviolet-visible (UV-vis) absorption spectroscopy, enzymatic digestion followed by HPLC quantitation, polyacrylamide gel electrophoresis (PAGE), and mass spectrometry (MALDI-TOF as well as by ESI). [Ru(tpy)(dppz)(CH(3)CN)](2+)-ODNs form highly stabilized ODN.DNA duplexes compared to the unlabeled counterpart (DeltaT(m) varies from 8.4 to 23.6 degrees C) as a result of intercalation of the dppz moiety; they undergo clean and selective photodissociation of the CH(3)CN ligand to give the corresponding aqua complex, [Ru(tpy)(dppz)(H(2)O)](2+)-ODNs (in the aqueous medium), which is evidenced from the change of their UV-vis absorption properties and the detection of the naked Ru(2+)-ODN ions generated in the course of the matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometric analysis. Thus, when [Ru(tpy)(dppz)(CH(3)CN)](2+)-ODN conjugate was hybridized to the complementary guanine (G)-rich target strand (T), and photolyzed in a buffer (pH 6.8), the corresponding aqua complex formed in situ immediately reacted with the G residue of the opposite strand, giving the cross-linked product. The highest yield (34%) of the photo cross-linked product obtained was with the ODN carrying two reactive Ru(2+) centers at both 3'- and 5'-ends. For ODNs carrying only one Ru(2+) complex, the yield of the cross-linked adduct in the corresponding duplex is found to decrease in the following order: 3'-Ru(2+)-ODN (22%) > 5'-Ru(2+)-ODN (9%) > middle-Ru(2+)-ODN (7%). It was also found that the photo cross-coupling efficiency of the tethered Ru(2+) complex with the target T strand decreased as the stabilization of the resulting duplex increased: 3'-Ru(2+)-ODN (VI.T) (DeltaT(m)(b) = 7 degrees C) < 5'-Ru(2+)-ODN (V.T) (DeltaT(m)(b) = 16 degrees C) < middle-Ru(2+)-ODN (VII.T) (DeltaT(m)(b) = 24.3 degrees C, Table 2). This shows that, with the rigidly packed structure, as in the duplex with middle-Ru(2+)-ODN, the metal center flexibility is considerably reduced, and consequently the accessibility of target G residue by the aquaruthunium moiety becomes severely restricted, which results in a poor yield in the cross-coupling reaction. The cross-linked product was characterized by PAGE, followed by MALDI-TOF MS.     

2'-Ribose-ferrocene oligonucleotides for electronic detection of nucleic acids

We have synthesized two novel phosphoramidites with a ferrocenyl moiety at the 2'-ribose position linked through a butoxy linker. Using automated DNA/RNA synthesis techniques, oligonucleotides containing ferrocene at various positions were prepared and characterized by HPLC, MALDI-TOF mass spectrometry, and electrochemistry. Thermal stability studies of the ferrocene-modified DNA duplexes revealed that introduction of one or two ferrocenyl complexes does not result in an observed change of the T(m) values of the corresponding DNA duplexes when compared to the nonmodified hybrids. These data indicate that the introduction of a ferrocenyl group at the 2'-position of the ribose ring containing either a purine or pyrimidine base has no effect on the stability of the modified DNA. The electrochemical behavior of the ferrocene-containing DNA was examined by cyclic voltammetry. The modified 2'-ferrocene-oligonucleotides are electrochemically active and can be used as signaling probes for the electronic detection of nucleic acids on bioelectronic sensors.     

Molecular dynamics simulation and binding energy calculation for estimation of oligonucleotide duplex thermostability in RNA-based therapeutics

For oligonucleotide-based therapeutics, a thorough understanding of the thermodynamic properties of duplex formation is critical to developing stable and potent drugs. For unmodified small interfering RNA (siRNA), DNA antisense oligonucleotide (AON) and locked nucleic acid (LNA), DNA/LNA modified oligonucleotides, nearest neighbor (NN) methods can be effectively used to quickly and accurately predict duplex thermodynamic properties such as melting point. Unfortunately, for chemically modified olignonucleotides, there has been no accurate prediction method available. Here we describe the potential of estimating melting temperature (T(m)) for nonstandard oligonucleotides by using the correlation of the experimental T(m) with the calculated duplex binding energy (BE) for oligonucleotides of a given length. This method has been automated into a standardized molecular dynamics (MD) protocol through Pipeline Pilot (PP) using the CHARMm component in Discovery Studio (DS). Results will be presented showing the correlation of the predicted data with experiment for both standard and chemically modified siRNA and AON.     

2'-O-[2-(guanidinium)ethyl]-modified oligonucleotides: stabilizing effect on duplex and triplex structures

[structure: see text] Oligonucleotides with a novel 2'-O-[2-(guanidinium)ethyl] (2'-O-GE) modification have been synthesized using a novel protecting group strategy for the guanidinium group. This modification enhances the binding affinity of oligonucleotides to RNA as well as duplex DNA (DeltaT(m) 3.2 degrees C per modification). The 2'-O-GE modified oligonucleotides exhibited exceptional resistance to nuclease degradation. The crystal structure of a palindromic duplex formed by a DNA oligonucleotide with a single 2'-O-GE modification was solved at 1.16 A resolution.     

Stabilization by extra-helical thymines of a DNA duplex with Hoogsteen base pairs

We present the crystal structure of the DNA duplex formed by d(ATATATCT). The crystals contain seven stacked antiparallel duplexes in the asymmetric unit with A.T Hoogsteen base pairs. The terminal CT sequences bend over so that the thymines enter the minor groove and form a hydrogen bond with thymine 2 of the complementary strand in the Hoogsteen duplex. Cytosines occupy extra-helical positions; they contribute to the crystal lattice through various kinds of interactions, including a unique CAA triplet. The presence of thymine in the minor groove apparently contributes to the stability of the DNA duplex in the Hoogsteen conformation. These observations open the way toward finding under what conditions the Hoogsteen duplex may be stabilized in vivo. The present crystal structure also confirms the tendency of A.T-rich oligonucleotides to crystallize as long helical stacks of duplexes.     

Synthesis and structural characterization of integrally oxidized, metal-free phthalocyanine compounds: [H(2)(pc)][IBr(2)] and [H(2)(pc)](2)[IBr(2)]Br.C(10)H(7)Br

The first integrally oxidized metal-free phthalocyanine compounds have been synthesized by chemical oxidation. Phthalocyanine (H(2)(pc), pc = phthalocyaninato) was oxidized with IBr to afford the compounds [H(2)(pc)][IBr(2)] (1) and [H(2)(pc)](2)[IBr(2)]BrAC(10)H(7)Br (2), whose structures were determined by means of single-crystal X-ray diffraction methods: [H(2)(pc)][IBr(2)], P2(1)/c, a = 8.0272(9) A, b = 21.258(2) A, c = 18.1439(2) A, beta = 113.975(2) degrees, V = 2828.8(5) A(3), T = 153 K, Z = 4; [H(2)(pc)](2)[IBr(2)]Br.C(10)H(7)Br, P, a = 8.4724(6) A, b = 13.5794(10) A, c = 13.8403(10) A, alpha = 90.854(1) degrees, beta = 103.417(1) degrees, gamma = 97.049(1)E degrees, V = 1535.61(19) A(3), T = 153 K, Z = 1. The extended structure of [H(2)(pc)][IBr(2)] comprises slipped columns of pc rings stacked along the a axis in adjacent columns at approximately 70 degrees to one another. IBr(2-) ions occupy the interstitial columns. The extended structure of [H(2)(pc)](2)[IBr(2)]Br.C(10)H(7)Br comprises slant stacks of pc rings along the crystallographic a axis with IBr(2-) ions, Br(-) ions, and disordered 1-bromonaphthalene molecules in the adjacent, parallel columns. The overall reaction for the formation of 1 is 2H(2)(pc) + 4IBr --> 2[H(2)(pc)][IBr(2)] + I(2), and the overall reaction for the formation of 2 (not including solvent) is 2H(2)(pc) + 3IBr --> [H(2)(pc)](2)Br[IBr(2)] + I(2).     

Neomycin-neomycin dimer: an all-carbohydrate scaffold with high affinity for AT-rich DNA duplexes

A dimeric neomycin-neomycin conjugate 3 with a flexible linker, 2,2'-(ethylenedioxy)bis(ethylamine), has been synthesized and characterized. Dimer 3 can selectively bind to AT-rich DNA duplexes with high affinity. Biophysical studies have been performed between 3 and different nucleic acids with varying base composition and conformation by using ITC (isothermal calorimetry), CD (circular dichroism), FID (fluorescent intercalator displacement), and UV (ultraviolet) thermal denaturation experiments. A few conclusions can be drawn from this study: (1) FID assay with 3 and polynucleotides demonstrates the preference of 3 toward AT-rich sequences over GC-rich sequences. (2) FID assay and UV thermal denaturation experiments show that 3 has a higher affinity for the poly(dA)·poly(dT) DNA duplex than for the poly(dA)·2poly(dT) DNA triplex. Contrary to neomycin, 3 destabilizes poly(dA)·2poly(dT) triplex but stabilizes poly(dA)·poly(dT) duplex, suggesting the major groove as the binding site. (3) UV thermal denaturation studies and ITC experiments show that 3 stabilizes continuous AT-tract DNA better than DNA duplexes with alternating AT bases. (4) CD and FID titration studies show a DNA binding site size of 10-12 base pairs/drug, depending upon the structure/sequence of the duplex for AT-rich DNA duplexes. (5) FID and ITC titration between 3 and an intramolecular DNA duplex [d(5'-A(12)-x-T(12)-3'), x = hexaethylene glycol linker] results in a binding stoichiometry of 1:1 with a binding constant ～10(8) M(-1) at 100 mM KCl. (6) FID assay using 3 and 512 hairpin DNA sequences that vary in their AT base content and placement also show a higher binding selectivity of 3 toward continuous AT-rich than toward DNA duplexes with alternate AT base pairs. (7) Salt-dependent studies indicate the formation of three ion pairs during binding of the DNA duplex d[5'-A(12)-x-T(12)-3'] and 3. (8) ITC-derived binding constants between 3 and DNA duplexes have the following order: AT continuous, d[5'-G(3)A(5)T(5)C(3)-3'] > AT alternate, d[5'-G(3)(AT)(5)C(3)-3'] > GC-rich d[5'-A(3)G(5)C(5)T(3)-3']. (9) 3 binds to the AT-tract-containing DNA duplex (B* DNA, d[5'-G(3)A(5)T(5)C(3)-3']) with 1 order of magnitude higher affinity than to a DNA duplex with alternating AT base pairs (B DNA, d[5'-G(3)(AT)(5)C(3)-3']) and with almost 3 orders of magnitude higher affinity than a GC-rich DNA (A-form, d[5'-A(3)G(5)C(5)T(3)-3']).     

Solution structure of a HNA-RNA hybrid

BACKGROUND: Synthetic nucleic acid analogues with a conformationally restricted sugar-phosphate backbone are widely used in antisense strategies for biomedical and biochemical applications. The modified backbone protects the oligonucleotides against degradation within the living cell, which allows them to form stable duplexes with sequences in target mRNAs with the aim of arresting their translation. The biologically most active antisense oligonucleotides also trigger cleavage of the target RNA through activation of endogenous RNase H. Systematic studies of synthetic oligonucleotides have also been conducted to delineate the origin of the chirality of DNA and RNA that are both composed of D-nucleosides. RESULTS: Hexitol nucleic acids (HNA) are the first example of oligonucleotides with a six-membered carbohydrate moiety that can bind strongly and selectively to complementary RNA oligomers. We present the first high resolution nuclear magnetic resonance structure of a HNA oligomer bound to a complementary RNA strand. The HNA-RNA complex forms an anti-parallel heteroduplex and adopts a helical conformation that belongs to the A-type family. Possibly, due to the rigidity of the rigid chair conformation of the six-membered ring both the HNA and RNA strand in the duplex are well defined. The observed absence of end-fraying effects also indicate a reduced conformational flexibility of the HNA-RNA duplex compared to canonical dsRNA or an RNA-DNA duplex. CONCLUSIONS: The P-P distance across the minor groove, which is close to A-form, and the rigid conformation of the HNA-RNA complex, explain its resistance towards degradation by Rnase H. The A-form character of the HNA-RNA duplex and the reduced flexibility of the HNA strand is possibly responsible for the stereoselectivity of HNA templates in non-enzymatic replication of oligonucleotides, supporting the theory that nucleosides with six-membered rings could have existed at some stage in molecular evolution.     

Synthesis and antisense properties of fluoro cyclohexenyl nucleic acid (F-CeNA), a nuclease stable mimic of 2'-fluoro RNA

We report the design and synthesis of 2'-fluoro cyclohexenyl nucleic acid (F-CeNA) pyrimidine phosphoramidites and the synthesis and biophysical, structural, and biological evaluation of modified oligonucleotides. The synthesis of the nucleoside phosphoramidites was accomplished in multigram quantities starting from commercially available methyl-D-mannose pyranoside. Installation of the fluorine atom was accomplished using nonafluorobutanesulfonyl fluoride, and the cyclohexenyl ring system was assembled by means of a palladium-catalyzed Ferrier rearrangement. Installation of the nucleobase was carried out under Mitsunobu conditions followed by standard protecting group manipulations to provide the desired pyrimidine phosphoramidites. Biophysical evaluation indicated that F-CeNA shows behavior similar to that of a 2'-modified nucleotide, and duplexes with RNA showed slightly lower duplex thermostability as compared to that of the more rigid 3'-fluoro hexitol nucleic acid (FHNA). However, F-CeNA modified oligonucleotides were significantly more stable against digestion by snake venom phosphodiesterases (SVPD) as compared to unmodified DNA, 2'-fluoro RNA (FRNA), 2'-methoxyethyl RNA (MOE), and FHNA modified oligonucleotides. Examination of crystal structures of a modified DNA heptamer duplex d(GCG)-T*-d(GCG):d(CGCACGC) by X-ray crystallography indicated that the cyclohexenyl ring system exhibits both the (3)H(2) and (2)H(3) conformations, similar to the C3'-endo/C2'-endo conformation equilibrium seen in natural furanose nucleosides. In the (2)H(3) conformation, the equatorial fluorine engages in a relatively close contact with C8 (2.94 ?) of the 3'-adjacent dG nucleotide that may represent a pseudo hydrogen bond. In contrast, the cyclohexenyl ring of F-CeNA was found to exist exclusively in the (3)H(2) (C3'-endo like) conformation in the crystal structure of the modified A-form DNA decamer duplex [d(GCGTA)-T*-d(ACGC)](2.) In an animal experiment, a 16-mer F-CeNA gapmer ASO showed similar RNA affinity but significantly improved activity compared to that of a sequence matched MOE ASO, thus establishing F-CeNA as a useful modification for antisense applications.