A role for a single-stranded junction in RNA binding and specificity by the Tetrahymena group I ribozyme

We have investigated the role of a single-stranded RNA junction, J1/2, that connects the substrate-containing P1 duplex to the remainder of the Tetrahymena group I ribozyme. Single-turnover kinetics, fluorescence anisotropy, and single-molecule fluorescence resonance energy transfer studies of a series of J1/2 mutants were used to probe the sequence dependence of the catalytic activity, the P1 dynamics, and the thermodynamics of docking of the P1 duplex into the ribozyme's catalytic core. We found that A29, the center A of three adenosine residues in J1/2, contributes 2 orders of magnitude to the overall ribozyme activity, and double-mutant cycles suggested that J1/2 stabilizes the docked state of P1 over the undocked state via a tertiary interaction involving A29 and the first base pair in helix P2 of the ribozyme, A31·U56. Comparative sequence analysis of this group I intron subclass suggests that the A29 interaction sets one end of a molecular ruler whose other end specifies the 5'-splice site and that this molecular ruler is conserved among a subclass of group I introns related to the Tetrahymena intron. Our results reveal substantial functional effects from a seemingly simple single-stranded RNA junction and suggest that junction sequences may evolve rapidly to provide important interactions in functional RNAs.     

Tightening of active site interactions en route to the transition state revealed by single-atom substitution in the guanosine-binding site of the Tetrahymena group I ribozyme

Protein enzymes establish intricate networks of interactions to bind and position substrates and catalytic groups within active sites, enabling stabilization of the chemical transition state. Crystal structures of several RNA enzymes also suggest extensive interaction networks, despite RNA's structural limitations, but there is little information on the functional and the energetic properties of these inferred networks. We used double mutant cycles and presteady-state kinetic analyses to probe the putative interaction between the exocyclic amino group of the guanosine nucleophile and the N7 atom of residue G264 of the Tetrahymena group I ribozyme. As expected, the results supported the presence of this interaction, but remarkably, the energetic penalty for introducing a CH group at the 7-position of residue G264 accumulates as the reaction proceeds toward the chemical transition state to a total of 6.2 kcal/mol. Functional tests of neighboring interactions revealed that the presence of the CH group compromises multiple contacts within the interaction network that encompass the reactive elements, apparently forcing the nucleophile to bind and attack from an altered, suboptimal orientation. The energetic consequences of this indirect disruption of neighboring interactions as the reaction proceeds demonstrate that linkage between binding interactions and catalysis hinges critically on the precise structural integrity of a network of interacting groups.     

A phosphoramidate substrate analog is a competitive inhibitor of the Tetrahymena group I ribozyme

BACKGROUND: Phosphoramidate oligonucleotide analogs containing N3'-P5' linkages share many structural properties with natural nucleic acids and can be recognized by some RNA-binding proteins. Therefore, if the N-P bond is resistant to nucleolytic cleavage, these analogs may be effective substrate analog inhibitors of certain enzymes that hydrolyze RNA. We have explored the ability of the Tetrahymena group I intron ribozyme to bind and cleave DNA and RNA phosphoramidate analogs. RESULTS: The Tetrahymena group I ribozyme efficiently binds to phosphoramidate oligonucleotides but is unable to cleave the N3'-P5' bond. Although it adopts an A-form helical structure, the deoxyribo-phosphoramidate analog, like DNA, does not dock efficiently into the ribozyme catalytic core. In contrast, the ribo-phosphoramidate analog docks similarly to the native RNA substrate, and behaves as a competitive inhibitor of the group I intron 5' splicing reaction. CONCLUSIONS: Ribo-N3'-P5' phosphoramidate oligonucleotides are useful tools for structural and functional studies of ribozymes as well as protein-RNA interactions.     

Promiscuous catalysis by the tetrahymena group I ribozyme

Catalytic promiscuity, the ability of an enzyme to catalyze alternative reactions, has been suggested to have played an important role in the evolution of new catalytic activities in protein enzymes. Similarly, promiscuous activities may have been advantageous in an earlier RNA world. The Tetrahymena Group I ribozyme naturally catalyzes the site-specific guanosine attack on an anionic phosphate diester and has been shown to also catalyze aminoacyl transfer to water, albeit with a small rate acceleration (<10-fold). This inefficient catalysis could be due to the differences in charge and/or geometry requirements for the two reactions. Herein, we describe a new promiscuous activity of this ribozyme, the site-specific guanosine attack on a neutral phosphonate diester. This alternative substrate lacks the negative charge at the reaction center but, in contrast to the aminoacyl substrate, can undergo nucleophilic attack with the same geometry as the natural substrate. Our results show that the neutral phosphonate reaction is catalyzed about 1 x 106-fold, substantially better than the acyl transfer but far below the normal anionic substrate. We conclude that both charge and geometry are important factors for catalysis of the normal reaction and that promiscuous catalytic activities of ribozymes could have been created or enhanced by reorienting and swapping RNA domains.     

A unique mechanism for RNA catalysis: the role of metal cofactors in hairpin ribozyme cleavage

Background: Ribozymes are biological catalysts that promote the hydrolysis and transesterification of phosphate diesters of RNA. They typically require divalent magnesium ions for activation, although it has proven difficult to differentiate structural from catalytic roles for the magnesium ions and to identify the molecular mechanism of catalysis. Direct inner-sphere coordination is usually invoked in the catalytic step, although there is no evidence to support the generality of such a pathway for all ribozymes.Results: We studied the catalytic pathway for the hairpin class of ribozyme. The substitutionally inert transition metal complex cobalt hexaammine [Co(NH₃)₆³⁺) was shown to be as active as Mg²⁺(aq) in promoting hairpin ribozyme activity, demonstrating that inner-sphere pathways are not used by this class of ribozyme. These results were confirmed by studies with R_P- and S_P-phosphorothioate substrate analogs which show a similar reactivity to that of the native substrate towards the magnesium-activated ribozyme. Monovalent cations enhance the activity of Co(NH₃)₆³⁺-promoted reactions, but inhibit Mg²⁺-activated catalysis, demonstrating a requirement for hydrated cations at several key sites in the ribozyme.Conclusions: These results provide clear support for a model of RNA catalysis that does not involve direct coordination of magnesium to the phosphate ester, nor activation of a bound water molecule. A mechanism in which catalysis is carried out by functional groups on the RNA ribozyme itself is possible; such functional groups are likely to have pK_a values that are appropriate for carrying out this catalysis. The metal cofactor would then serve to define the architecture of the catalytic pocket and contribute to the stabilization of transient species, as has been described earlier. Hydrolytic pathways in nucleic acid reactions are apparently more diverse than was previously thought, and the hairpin ribozyme falls into a mechanistically distinct class from the Tetrahymena and the hammerhead ribozymes.     

Simple and efficient cleavage reaction of the boc group in heterocyclic compounds

Dedicated to the memory of Pr. Ladjama Daif A series of chiral cyclosulfamides have been synthesized by alkaline cyclisation starting from N‐benzoylamino acids (Ala, Val, Leu, Phe) derivatives and chlorosulfonyl isocyanate. A simplified and regioselective deprotection of the cyclic compounds (cyclosulfamides) containing the tert‐butyloxycarbonyl group (Boc) has been achieved in good yield by fusion under reduced pressure.     

A hydrogen-bonding triad stabilizes the chemical transition state of a group I ribozyme

BACKGROUND: The group I intron is an RNA enzyme capable of efficiently catalyzing phosphoryl-transfer reactions. Functional groups that stabilize the chemical transition state of the cleavage reaction have been identified, but they are all located within either the 5'-exon (P1) helix or the guanosine cofactor, which are the substrates of the reaction. Functional groups within the ribozyme active site are also expected to assist in transition-state stabilization, and their role must be explored to understand the chemical basis of group I intron catalysis. RESULTS: Using nucleotide analog interference mapping and site-specific functional group substitution experiments, we demonstrate that the 2'-OH at A207, a highly conserved nucleotide in the ribozyme active site, specifically stabilizes the chemical transition state by approximately 2 kcal mol-1. The A207 2'-OH only makes its contribution when the U(-1) 2'-OH immediately adjacent to the scissile phosphate is present, suggesting that the 2'-OHs of A207 and U(-1) interact during the chemical step. CONCLUSIONS: These data support a model in which the 3'-oxyanion leaving group of the transesterification reaction is stabilized by a hydrogen-bonding triad consisting of the 2'-OH groups of U(-1) and A207 and the exocyclic amine of G22. Because all three nucleotides occur within highly conserved non-canonical base pairings, this stabilization mechanism is likely to occur throughout group I introns. Although this mechanism utilizes functional groups distinctive of RNA enzymes, it is analogous to the transition states of some protein enzymes that perform similar phosphoryl-transfer reactions.     

The 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleosides in the solid-phase synthesis of oligoribonucleotides

Emerging RNA-based technologies for controlling gene expression have triggered a high demand for synthetic oligoribonucleotides and have motivated the development of ribonucleoside phosphoramidites that would exhibit coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites. To fulfill these needs, the novel 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleoside phosphoramidites 9a-d has been implemented (Schemes 1 and 2). The solid-phase synthesis of AUCCGUAGCUAACGUCAUGG was then carried out employing 9a-d as 0.2 M solutions in dry MeCN and 5-benzylthio-1H-tetrazole as an activator. The coupling efficiency of 9a-d averaged 99% within a coupling time of 180 s. Following removal of all base-sensitive protecting groups, cleavage of the remaining 2'-[4-(N-methylamino)benzyl] acetals from the RNA oligonucleotide was effected in buffered 0.1 M AcOH (pH 3.8) within 30 min at 90 degrees C. RP-HPLC and PAGE analyses of the fully deprotected AUCCGUAGCUAACGUCAUGG were comparable to those of a commercial RNA oligonucleotide sharing an identical sequence. Enzymatic digestion of the RNA oligomer catalyzed by bovine spleen phosphodiesterase and bacterial alkaline phosphatase revealed no significant amounts of RNA fragments containing (2'-->5')-internucleotidic phosphodiester linkages or noteworthy nucleobase modifications.     

The pK(a) of the internucleotidic 2'-hydroxyl group in diribonucleoside (3'-->5') monophosphates

Ionization of the internucleotidic 2'-hydroxyl group in RNA facilitates transesterification reactions in Group I and II introns (splicing), hammerhead and hairpin ribozymes, self-cleavage in lariat-RNA, and leadzymes and tRNA processing by RNase P RNA, as well as in some RNA cleavage reactions promoted by ribonucleases. Earlier, the pK(a) of 2'-OH in mono- and diribonucleoside (3'-->5') monophosphates had been measured under various nonuniform conditions, which make their comparison difficult. This work overcomes this limitation by measuring the pK(a) values for internucleotidic 2'-OH of eight different diribonucleoside (3'-->5') monophosphates under a set of uniform noninvasive conditions by 1H NMR. Thus the pK(a) is 12.31 (+/-0.02) for ApG and 12.41 (+/-0.04) for ApA, 12.73 (+/-0.04) for GpG and 12.71 (+/-0.08) for GpA, 12.77 (+/-0.03) for CpG and 12.88 (+/-0.02) for CpA, and 12.76 (+/-0.03) for UpG and 12.70 (+/-0.03) for UpA. By comparing the pK(a)s of the respective 2'-OH of monomeric nucleoside 3'-ethyl phosphates with that of internucleotidic 2'-OH in corresponding diribonucleoside (3'-->5') monophosphates, it has been confirmed that the aglycons have no significant effect on the pK(a) values of their 2'-OH under our measurement condition, except for the internucleotidic 2'-OH of 9-adeninyl nucleotide at the 5'-end (ApA and ApG), which is more acidic by 0.3-0.4 pK(a) units.     

Synthesis of the phosphoramidite derivatives of 2'-deoxy-2'-C-alpha-methylcytidine and 2'-deoxy-2'-C-alpha-hydroxymethylcytidine: analogues for chemical dissection of RNA's 2'-hydroxyl group

Oligonucleotides containing 2'-C-alpha-methyl and 2'-C-alpha-hydroxymethyl modifications enable strategies for delineation of the distinctive role fulfilled by the 2'-hydroxyl group in RNA structure and function. Synthetic routes to the phosphoramidite derivatives of 2'-deoxy-2'-C-alpha-methylcytidine (14%, 15 steps) and 2'-deoxy-2'-C-alpha-hydroxymethylcytidine (19%, 10 steps) from methyl 3,5-di-O-(4-chlorobenzyl)-alpha-d-ribofuranoside are developed.     

Catalytic role of metal ion in the selection of competing reaction paths: a first principles molecular dynamics study of the enzymatic reaction in ribozyme

By using finite temperature first principles molecular dynamics, the mechanism of the enzymatic reaction of ribozyme was investigated for both the anionic and the radical charge states of the modeled RNA fragment. In the case of the anionic system, a pseudorotation and the subsequent 3' --> 2' migration occur in a vacuum, rather than the self-cleavage of the phosphodiester. On the other hand, when either a divalent metal ion (Mg(2+)) catalyst or the continuous hydrogen bond network of the solvent is present, the reaction path of the anionic species changes dramatically, going toward the transesterification channel. In a radical system, the transesterification can occur without a metal catalyst, as a consequence of the displacement of a hole (empty electronic state) along the reaction path. Thus, the present analysis suggests that a metal ion might be essential not only in lowering the activation barrier but also in selecting the reaction path among those corresponding to possible different charge states of the intermediate structure in vivo. Furthermore, simulation of the anionic species in solution shows that, in the absence of a metal catalyst, water molecules cooperate with the proton transfer via a proton wire mechanism and the hydrogen bond network plays a crucial role in preventing pseudorotations. On the other hand, when a metal cation is present in the vicinity of the site where the nucleophilic attack occurs, the hydrogen bond network is interrupted and detachment of the proton, enhanced by the catalyst, does not give rise to any proton-transfer process.     

Probing the active site of a diels-alderase ribozyme by photoaffinity cross-linking

The active site of a Diels-Alderase ribozyme is located in solution by photoaffinity cross-linking using a productlike azidobenzyl probe. Two key nucleotides are identified that contact the Diels-Alder product in a conformation-dependent fashion. The design of such probes does not require knowledge of the three-dimensional structure of the ribozyme, and the technique yields both static and dynamic structural information. This work establishes photoaffinity cross-linking as an empirical approach that is applied here for the first time to an artificial ribozyme.     

Intrinsic contribution of the 2'-hydroxyl to RNA conformational heterogeneity

Canonical duplex RNA assumes only the A-form conformation at the secondary structure level while, in contrast, a wide range of noncanonical, tertiary conformations of RNA occur. Here, we show how the 2'-hydroxyl controls RNA conformational properties. Quantum mechanical calculations reveal that the orientation of the 2'-hydroxyl significantly alters the intrinsic flexibility of the phosphodiester backbone, favoring the A-form in duplex RNA when it is in the base orientation and facilitating sampling of a wide range of noncanonical, tertiary structures when it is in the O3' orientation. Influencing the orientation of the 2'-hydroxyl are interactions with the environment, as evidenced by crystallographic survey data, indicating the 2'-hydroxyl to sample more of the O3' orientation in noncanonical RNA structures. These results indicate that the 2'-hydroxyl acts as a "switch", both limiting the conformation of RNA to the A-form at the secondary structure level and allowing RNA to sample a wide range of noncanonical tertiary conformations.     

The role of radicals in the Belousov-Zhabotinsky reaction

A new theory of the Belousov-Zhabotinsky (BZ) reaction, the Radicalator model, is presented. This model is based on a negative feedback loop involving a fast reaction between malonyl and bromine dioxide radicals. Experimental evidence for the validity of the model is given for BZ systems in 3 M and 1 M sulfuric acid solution.     

The atomic-level regulation of single-atom site catalysts for the electrochemical CO2 reduction reaction

The electrochemical CO₂ reduction reaction (CO₂RR) is viewed as a promising way to remove the greenhouse gas CO₂ from the atmosphere and convert it into useful industrial products such as methane, methanol, formate, ethanol, and so forth. Single-atom site catalysts (SACs) featuring maximum theoretical atom utilization and a unique electronic structure and coordination environment have emerged as promising candidates for use in the CO₂RR. The electronic properties and atomic structures of the central metal sites in SACs will be changed significantly once the types or coordination environments of the central metal sites are altered, which appears to provide new routes for engineering SACs for CO₂ electrocatalysis. Therefore, it is of great importance to discuss the structural regulation of SACs at the atomic level and their influence on CO₂RR activity and selectivity. Despite substantial efforts being made to fabricate various SACs, the principles of regulating the intrinsic electrocatalytic performances of the single-atom sites still needs to be sufficiently emphasized. In this perspective article, we present the latest progress relating to the synthesis and catalytic performance of SACs for the electrochemical CO₂RR. We summarize the atomic-level regulation of SACs for the electrochemical CO₂RR from five aspects: the regulation of the central metal atoms, the coordination environments, the interface of single metal complex sites, multi-atom active sites, and other ingenious strategies to improve the performance of SACs. We highlight synthesis strategies and structural design approaches for SACs with unique geometric structures and discuss how the structure affects the catalytic properties.

Electrochemical CO₂ reduction reaction (CO₂RR) is a promising way to remove CO₂ and convert it into useful industrial products. Single-atom site catalysts provide opportunities to regulate the active sites of CO₂RR catalysts at the atomic level.