Paramagnetic resonance of Mn<Superscript>4+</Superscript> and Mn<Superscript>2+</Superscript> centers in lanthanum gallate single crystals

An increase in the manganese concentration in lanthanum gallate in the range 0.5–5.0% has been found to result in a complete replacement of individual Mn⁴⁺ ions by Mn²⁺ ions. The relative concentrations and binding energies of individual Mn⁴⁺, Mn³⁺, and Mn²⁺ ions have been determined. The spin Hamiltonians of the Mn²⁺ and Mn⁴⁺ centers in the rhombohedral and orthorhombic phases, respectively, have been constructed and the orientation of the principal axes of the fine-structure tensor of Mn⁴⁺ at room temperature has been found. The possibility of using electron paramagnetic resonance for determining the rotation angles of oxygen octahedra of lanthanum gallate with respect to the perovskite structure has been discussed.     

ESR determination of the thermal stability of Mn<Superscript>2+</Superscript> ion binding sites in different legume lectins

The legume lectins are a large family of homologous carbohydrate-binding proteins. Their carbohydrate specificity and quaternary structure vary widely. The carbohydrate binding activity of legume lectins depends on the simultaneous presence of calcium and transition-metal ions, especially the Mn²⁺ ion. In the present work, thermal stabilities of Mn²⁺ binding sites in pea, lentil, soybean and kidney-bean lectins have been studied by electron spin resonance spectroscopy in the temperature range of 120–400 K in different atmospheres. The evolution of parameters, such as the line width, peak-to-peak intensity associated with the hyperfine transition [m _I (+5/2) → m′ _I (−5/2)] at the lowest magnetic field side of the central electron transition [m _S (+1/2) → m′ _S (−1/2)] of the Mn⁺² ion, g-factor and hyperfine splitting was evaluated. Annealing was also performed at high temperatures (353, 373, 383, 403 and 443 K) and the oxidation activation energy of Mn²⁺ ions in the indicated legumes was determined.     

Growth defect W<Superscript>3+</Superscript>-W<Superscript>2+</Superscript> of CdWO<Subscript>4</Subscript> crystals

CdWO₄ crystals grown by the Czochralski method at the low-temperature gradient were investigated with electron spin resonance (ESR) spectroscopy. ESR spectra did not contain the spectra of impurity ions typical for the CdWO₄ structure, i.e., Fe³⁺, Mn²⁺, and Cr³⁺. At the same time, in the studied crystals a complex ESR spectrum having the hyperfine structure due to two nonequivalent tungsten atoms was observed (W¹⁸³;I=1/2; natural abundance, 14.28%). Angular dependence analysis and simulation of ESR spectra have shown that this novel spectrum is described by a spin-Hamiltonian with the following parameters:D=839 G,E=80 G,g _xx=2.01,g _yy=1.97,g _zz=1.987 and electron spinS=7/2. There is one magnetically nonequivalent position of the center in the crystal structure and the direction ofD _zz andg _zz corresponds to the direction of W_n-W_n+2 (or Cd_n-Cd_n+2) in the crystal structure. Because of the fact that it is in principle impossible to achieve the electron stateS=7/2 for the d-shell of one transition metal ion and taking into account the fact that such electron state is realized for two nonequivalent tungsten atoms, we suppose the defect structure to be the chain W²⁺-M⁺-W³⁺. In the structure of this defect the ion M⁺ is diamagnetic, the ions W²⁺ and W³⁺ have electron spinS=2 andS=3/2, respectively. The necessary condition for such defect to exist is to place this chain of ions in cadmium positions for the charge compensation. the reason for such defects to form is supposed to be the incorporation of M⁺ ions into the CdWO₄ lattice. The presence of W²⁺ and W³⁺ in Cd positions in the defect structure provides the charge compensation and the lowering of the lattice stress.     

Electron paramagnetic resonance of Ce<Superscript>3+</Superscript> and Nd<Superscript>3+</Superscript> impurity ions in YBa<Subscript>2</Subscript>Cu<Subscript>3</Subscript>O<Subscript>6.13</Subscript>

The electron paramagnetic resonance (EPR) spectra of Ce³⁺ and Nd³⁺ impurity ions in unoriented powders of the YBa₂Cu₃O_6.13 compound are observed and interpreted for the first time. It is demonstrated that, upon long-term storage of the samples at room temperature, the EPR signals of these ions are masked by the spectral line (with the g factor of approximately 2) associated with the intrinsic magnetic centers due to the significant increase in its intensity.     

Study of EPR parameters and defect structure for two tetragonal impurity centers in MgO:Cr<Superscript>3+</Superscript> and MgO:Mn<Superscript>4+</Superscript> crystals

The electron paramagnetic resonance (EPR) parameters (g-factors g _‖, g _⊥ and zero-field splitting D) of two tetragonal 3d³ impurity centers M_3d-V_Mg and M_3d-Li⁺ (where M_3d = Cr³⁺ or Mn⁴⁺, V_Mg is the Mg²⁺ vacancy) in M_3d-doped MgO crystals are calculated from the high-order perturbation formulas including both the crystal-field (CF) and the charge-transfer (CT) mechanisms for 3d³ ions in the tetragonal symmetry. The calculated results are in reasonable agreement with the experimental values. From the calculations, it can be found that the relative importance of the CT mechanism for EPR parameters increases with increasing valence state of the 3d³ ion. So, for the high-valence 3d ⁿ ions in crystals, a reasonable explanation of EPR parameters should take into account both CF and CT mechanisms. The defect structures (characterized by the displacement ΔR of O²⁻ in the intervening M_3d and V_Mg or Li⁺ at the Mg²⁺ site) for these tetragonal impurity centers are obtained from the calculations. The results are consistent with the expectations based on the electrostatic interactions.     

A New Fluorescent Chemosensor Detecting Co<Superscript>2+</Superscript> and K<Superscript>+</Superscript> in DMF Buffered Solution

A new fluorescent chemosensor 2-(2-thiophene)imidazo [4,5,f]-1,10-phenanthroline (L) was prepared and characterized. By adding univalent or divalent metal ions such as Na⁺, K⁺, Mg²⁺, Ba²⁺, Mn²⁺, Fe²⁺, Co²⁺, Ni²⁺, Cu²⁺, Ag⁺, Zn²⁺, Cd²⁺ and Hg²⁺ ions into the solution of L in DMF under buffered conditions with the working pH ranging from 7.0 to 8.0, we found that L could be used to detect K⁺ ratiometricly and it could also be applied to sense Co²⁺ with the phenomenon of fluorescence quenching of L. While the response behavior of L was not discernibly affected by other examined metal ions.     

Specific features of the EPR spectra of KTaO<Subscript>3</Subscript>: Mn nanopowders

The electron paramagnetic resonance spectra of KTaO₃: Mn nanocrystalline powders in the temperature range from 77 to 620 K have been measured and studied for the first time. The change observed in the spectra has been investigated as a function of the doping level. The doping regions in which Mn²⁺ ions are individual paramagnetic impurities have been established, as well as the regions where the dipole-dipole and exchange interactions of these ions begin to occur. The spin-Hamiltonian constants for the spectrum of non-interacting individual Mn²⁺ ions have been determined as follows: g = 2.0022, D = 0.0170 cm⁻¹, and A = 85 × 10⁻⁴ cm⁻¹. A significant decrease in the axial constant D in the KTaO₃: Mn nanopowder, as compared to the single crystal, has been explained by the remoteness of the charge compensator from the paramagnetic ion and by the influence of the surface of the nanoparticle. It has been assumed that the Mn²⁺ ions are located near the surface and do not penetrate deep into the crystallites.     

Structural Properties of Cr<Superscript>3+</Superscript>-Doped Cadmium Oxide Nanopowders

The Cr³⁺-doped cadmium oxide nanopowder is prepared at room temperature by a mild and simple solution method. The prepared powder is characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), optical, electron paramagnetic resonance (EPR) and Fourier transform infrared (FT-IR) techniques. The XRD powder pattern reveals the lattice structure and cell parameters are evaluated. The SEM image shows the stone-like morphology of the nanopowder. The optical absorption spectrum indicates the distorted octahedral site symmetry of Cr³⁺ ions. The crystal field Dq and interelectronic repulsion parameters B and C are evaluated. The EPR spectrum gives a resonance signal at g = 1.973 for Cr³⁺ ions. The FT-IR spectrum reveals the characteristic vibrations of cadmium oxide.     

Theoretical study of charge-exchange and excitation processes in collisions of He<Superscript>+</Superscript> ions with C<Superscript>5+</Superscript>, N<Superscript>6+</Superscript>, and O<Superscript>7+</Superscript> hydrogen-like ions

Data on the cross sections for single-electron charge exchange and excitation in collisions of He⁺ ions with C⁵⁺, N⁶⁺, and O⁷⁺ ions in the He⁺ ion energy range of 0.2–3.0 MeV are obtained for the first time. The cross sections for the single-electron charge transfer into the singlet and triplet 1snl states of C⁴⁺, N⁵⁺, and O⁶⁺ (2≤n≤5) ions and for the 1s → 2p _{0, ±1} electronic excitation of He⁺(1s) ions are calculated. The calculations were performed by solving close-coupling equations on the basis of ten two-electron quasi-molecular states.     

Submillimeter ESR spectra of Fe<Superscript>2+</Superscript> ions in synthetic and natural beryl crystals

Electron spin resonance spectra of non-Kramers bivalent iron (Fe²⁺) ions have been detected in synthetic and natural beryl crystals with an iron impurity. The observed ESR spectra have been attributed to resonance transitions of Fe²⁺ ions from the ground (singlet) state to excited (doublet) levels with the splitting Δ = 12.7 cm^–1 between the levels. The experimental angular and frequency dependences of the resonance field of the ESR signal have been described by the spin Hamiltonian with the effective spin S = 1. The analysis of the ESR data and optical absorption spectra indicates that the Fe²⁺ ions are situated in tetrahedral positions and substitute Be²⁺ cations in the beryl structure.     

Magnetic properties of LiNi<Subscript>0.5</Subscript>Mn<Subscript>0.47</Subscript>Al<Subscript>0.03</Subscript>O<Subscript>2</Subscript> as positive electrode for Li-ion batteries

The layered LiNi_0.5Mn_0.47Al_0.03O₂ was synthesized by wet chemical method and characterized by X-ray diffraction and analysis of magnetic measurements. The powders adopted the α-NaFeO₂ structure. This substitution of Al for Mn promotes the formation of Li(Ni_0.47²⁺Ni_0.03³⁺Mn_0.47⁴⁺Al_0.03³⁺)O₂ structures and induces an increase in the average oxidation state of Ni, thereby leading to the shrinkage of the lattice unit cell. The concentration of antisite defects in which Ni²⁺ occupies the (3a) Li lattice sites in the Wyckoff notation has been estimated from the ferromagnetic Ni²⁺(3a)–Mn⁴⁺(3b) pairing observed below 140 K. The substitution of 3% Al for Mn reduces the amount of antisite defects from 7% to 6.4–6.5%. The analysis of the magnetic properties in the paramagnetic phase in the framework of the Curie–Weiss law agrees well with the combination of Ni²⁺ (S = 1), Ni³⁺ (S = 1/2) and Mn⁴⁺ (S = 3/2) spin-only values. Delithiation has been made by the use of K₂S₂O₈. According to this process, known to be softer than the electrochemical one, the nickel ions in the (3b) sites are converted into Ni⁴⁺ in the high spin configuration, while Ni²⁺(3a)–Mn⁴⁺(3b) ferromagnetic pairs remain, as the Li⁺(3b) ions linked to the Ni²⁺(3a) ions in the antisite defects are not removed. The results show that the antisite defect is surrounded by Mn⁴⁺ ions, implying the nonuniform distribution of the cations in agreement with previous NMR and neutron experiments.     

Study of optical absorption and EPR spectra of Mn<Superscript>2+</Superscript> ion in cadmium maleate dihydrate

The optical absorption and EPR spectra of Mn²⁺ ion doped in cadmium maleate dihydrate have been theoretically investigated by diagonalizing the complete energy matrices for a d⁵ configuration ion in a trigonal ligand-field. According to the suggestion of the optical absorption studies, we assume that the Mn²⁺ ion enters the host lattice interstitially and the distorted octahedral symmetry for the impurity ion is trigonal. Moreover, the local lattice structure parameters of the system are determined. The results show that the six oxygen ions around the Mn²⁺ ion are at the same distance R=2.115 ?, and there are three Mn-O bonds forming an angle θ₁ of 66.26° with the C₃-axis and three others forming an angle θ₂ of 43.40°.     

Interaction of <Superscript>3</Superscript>He<Superscript>2+</Superscript> and Ar<Superscript>6+</Superscript> ions with acetylene,ethylene, and ethane molecules

Time-of-flight mass spectroscopy methods are employed for studying processes occurring during capture of electrons by ³He²⁺ and Ar⁶⁺ multiply charged ions with energy 6z keV (z is the ion charge) from C₂H _n molecules (n = 2, 4, 6) with different multiplicities of C-C bonds. Fragmentation schemes of the molecular ions formed in such processes are established from analysis of correlations of recording times for all fragment ions. The absolute values of the cross sections of capture of an electron and capture with ionization are measured, as well as the cross sections of formation of fragment ions in these processes. The absolute values of total capture cross sections for several electrons are determined.     

Electron paramagnetic resonance parameters of Mn<Superscript>4+</Superscript> ion in h-BaTiO<Subscript>3</Subscript> crystal from a two-mechanism model

The EPR parameters (g factors g _‖, g _⊥ and zero-field splitting D) of Mn⁴⁺ ion in h-BaTiO₃ crystal are calculated from the complete high-order perturbation formulas based on a two-mechanism model for the EPR parameters of 3d ³ ions in trigonal symmetry. In the model, not only the widely used crystal-field mechanism, but also the charge-transfer mechanism (which is not considered in crystal-field theory) are included. The calculated results are in reasonable agreement with the experimental values. The relative importance of charge-transfer mechanism to EPR parameters and the defect structure of Mn⁴⁺ centre in h-BaTiO₃ crystal obtained from the calculations are discussed.      

The influence of divalent metal ions on low pH induced LacDNA structural changes as probed with UV resonance Raman spectroscopy

UV (275 nm) resonance Raman spectra of LacDNA 22‐mer duplex [d(TAATGTGAGTTAGCTCACTCAT) · d(ATGAGTGAGCTAACTCACATTA)], which contain protein binding sites within the E. coli lac promoter, were measured at two pH values (6.4 and 3.45) in the absence and presence of Mn²⁺ and Ca²⁺ metal ions, respectively. Also, the UV (275 nm) resonance Raman markers of the corresponding oligonucleotide d(TAATGTGAGTTAGCTCACTCAT) and of its complementary anti‐sense strand d(ATGAGTGAGCTAACTCACATTA) were established and tentatively assigned. Large changes in the UV (275 nm) resonance Raman spectra of LacDNA duplex were observed at pH 3.45 as compared with the corresponding spectrum at pH 6.4, in the absence of divalent metal ions and at low concentrations of Ca²⁺ ions, respectively. Major changes comprise: adenine protonation, GC base pair protonation, DNA bases unstacking and changes in the hydrogen bonding strength between the strands of different LacDNA complexes, respectively. Divalent metal ions (Mn²⁺ and Ca²⁺) were found to inhibit LacDNA protonation even at low concentrations. Manganese(II) ions are much more effective in this regard, as compared with calcium(II) ions. Binding of Mn²⁺ ions to N7 of guanine and, possibly, in a lesser extent to adenine was observed as judging from the difference Raman bands at 1315, 1354 and 1493 cm⁻¹. Copyright © 2013 John Wiley & Sons, Ltd.     

Condensation Product of Phenylalanine and Salicylaldehyde: Fluorescent Sensor for Zn<Superscript>2+</Superscript>

The condensation product of phenylalanine and salicylaldehyde (L) was synthesised and characterised which was found to be selective fluorescent “off-on” sensor for Zn²⁺ ion with the detection limit 10^?5 M. The sensor is free of interferences from metal ions - Na⁺, K⁺, Al³⁺, Mn²⁺, Co²⁺, Ni²⁺, Cu²⁺, Pb²⁺, Cd²⁺ and Hg²⁺. The Fluorescence and the UV/visible spectral data reveals a 1:1 interaction between the sensor and Zn²⁺ ion with binding constant 10⁸. The DFT and TDDFT calculations confirm the structures of the sensor and the sensor-Zn²⁺ complex.     

Electron paramagnetic resonance of Mn<Superscript>2+</Superscript> ions in single crystals of yttrium aluminum borate YAl<Subscript>3</Subscript>(BO<Subscript>3</Subscript>)<Subscript>4</Subscript>

Single crystals of yttrium aluminum borate YAl₃(BO₃)₄ doped with manganese ions are studied using electron paramagnetic resonance spectroscopy. It is shown that manganese ions introduced at low concentrations into the sample predominantly occupy yttrium ion sites in the crystal structure. The shape of the electron paramagnetic resonance spectrum unambiguously indicates that the valence of manganese ions in this case is equal to 2+. The parameters of the spin Hamiltonian of Mn²⁺ ions in the YAl₃(BO₃)₄ matrix are determined at room temperature. The magnitude and sign of the fine structure parameter D allow the conclusion that the YAl₃(BO₃)₄ single crystals doped with manganese ions have a strong crystal field at the yttrium ion sites and easy-axis anisotropy.     

Migration of Mn<Superscript>2+</Superscript> excitations in Cd<Subscript>0.5</Subscript>Mn<Subscript>0.5</Subscript>Te crystal

The experimentally obtained intensity decay curves for the 2-eV intracenter luminescence band of Mn²⁺ ions in Cd_0.5Mn_0.5Te semiconductor solid solution at a temperature of 77 K have been simulated by the Monte Carlo method. The calculations show that the initial nonexponential behavior of the intensity decay curves at the band wings, as well as the time dependence of the band peak energy, are determined by the fast migration of excitations through the Mn²⁺ ion subsystem. There are more than 200 jumps per each emitted photon, and the migration rate increases by almost two orders of magnitude in comparison with the rate at 4 K. The analysis of the simulation results and the calculation based on the experimental data show the interaction between ions to be resonant. The estimate derived from the Anderson criterion suggests that the excited state is not delocalized. An increase in the migration rate with an increase in temperature significantly reduces the inhomogeneous broadening dispersion.     

EPR study on the La2/3Ca1/3Mn1−x Cu x O y system

The interaction between Mn and Cu ions is studied by measuring the resistance and electron paramagnetic resonance (EPR) at different temperatures of the Cu-doped compound La_2/3Ca_1/3Mn_1−xCu_xO_y. A new transition inR-T curve and substantial enhancement in magnetoresistance are induced by the substitution of Mn ions by Cu ions. The EPR measurement shows that two resonance signals appear at temperature lower than the spin-ordering temperature of Mn ions. A tentative interpretation for the observed phenomena is proposed by considering the interaction between the Cu/Mn ions besides the Mn³⁺/Mn⁴⁺ ions.     

Three-body muon-transfer collisions from hydrogen isotope to He<Superscript>2+</Superscript> and Li<Superscript>3+</Superscript> ions

The muon transfer rates from hydrogen isotopes (p,d) to ^3,4He²⁺ and ^6,7Li³⁺ ions are calculated in the hyperspherical close coupling method. Well converged results are obtained. The present rates are comparable to those of existing calculations for He²⁺, but they are much larger for Li³⁺. The resonance parameters are also calculated for resonances near the (Hμ)_1s threshold.