共查询到20条相似文献,搜索用时 125 毫秒
1.
The hydrolytic reactions of the phosphorodithioate analogue of uridylyl(3',5')uridine [3',5'-Up(s)2U] were followed by HPLC over a wide pH range at 363.2 K. Under acidic and neutral conditions, three reactions compete: (i) desulfurization to a mixture of the (Rp)- and (Sp)-diastereomers of the corresponding 3',5'- and 2',5'-phosphoromonothioates [3',5'- and 2',5'-Up(s)U], which are subsequently desulfurized to a mixture of uridylyl(3',5')- and -(2',5')uridine [3',5'- and 2',5'-UpU], (ii) isomerization to 2',5'-Up(s)2U, and (iii) cleavage to uridine, in all likelihood via a 2',3'-cyclic phosphorodithioate (2',3'-cUMPS2). Under alkaline conditions (pH > 8), only a hydroxide ion catalyzed hydrolysis to uridine via 2',3'-cUMPS2 takes place. At pH 3-7, all three reactions are pH-independent, the desulfurization being approximately 1 order of magnitude faster than the cleavage and isomerization. At pH < 3, all the reactions are hydronium ion catalyzed. On going to very acidic solutions, the cleavage gradually takes over the desulfurization and isomerization. Accordingly, the cleavage overwhelmingly predominates at pH < 0. The overall hydrolytic stability of 3',5'-Up(s)2U is comparable to that of (Sp)- and (Rp)-3',5'-Up(s)U (and to that of 3',5'-UpU, except at pH < 2). The rate of the hydroxide ion catalyzed hydrolysis of 3',5'-Up(s)2U is 37% and 53% of that of (Sp)- and (Rp)-3',5'-Up(s)U, respectively. The reactions, however, differ with the respect of the product accumulation. While the phosphoromonothioates produce a mixture of 2'- and 3'-thiophosphates as stable products, 3',5'-Up(s)2U is hydrolyzed to uridine without accumulation of the corresponding dithiophosphates. At pH < 3, where the hydrolysis is hydronium ion catalyzed, the kinetic thio-effect of the second thio substitution is small: under very acidic conditions (Ho -0.69), (Sp)-3',5'-Up(s)U reacts 1.6 times as fast as 3',5'-Up(s)2U, but the reactivity difference decreases on going to less acidic solutions. In summary, the hydrolytic stability of 3',5'-Up(s)2U closely resembles that of the corresponding phosphoromonothioate. While replacing one of the nonbridging phosphate oxygens of 3',5'-UpU with sulfur stabilizes the phosphodiester bond under acidic conditions by more than 1 order of magnitude, the replacement of the remaining nonbridging oxygen has only a minor influence on the overall hydrolytic stability. 相似文献
2.
Komiyama M Kina S Matsumura K Sumaoka J Tobey S Lynch VM Anslyn E 《Journal of the American Chemical Society》2002,124(46):13731-13736
The cooperative action of multiple Cu(II) nuclear centers is shown to be effective and selective in the hydrolysis of 2'-5' and 3'-5' ribonucleotides. Reported herein is the specific catalysis by two trinuclear Cu(II) complexes of L3A and L3B. Pseudo first-order kinetic studies reveal that the L3A trinuclear Cu(II) complex effects hydrolysis of Up(2'-5')U with a rate constant of 28 x 10(-)(4) min(-)(1) and Up(3'-5')U with a rate constant of 0.5 x 10(-)(4) min(-)(1). The hydrolyses of Ap(3'-5')A and Ap(2'-5')A proceed with rate constants of 24 x 10(-)(4) min(-)(1) and 0.5 x 10(-)(4) min(-)(1) respectively. The L3A trinuclear Cu(II) complex demonstrates high specificity for Up(2'-5')U and Ap(3'-5')A. Similar studies with the more rigid L3B trinuclear Cu(II) complex shows no selectivity and yields lower rate constants for hydrolysis. The selectivity observed with the L3A ligand is attributed to the geometry of the ligand-bound diribonucleotide which ultimately dictates the proximity of the attacking hydroxyl and the phosphoester to a Cu(II) center for activation and subsequent hydrolysis. 相似文献
3.
Synthetic routes to 4'-(2,2-difluorospirocyclopropane) analogues of adenosine, cytidine, and uridine are described. Treatment of 2',3'-O-isopropylidene-4',5'-unsaturated compounds derived from adenosine and uridine with difluorocarbene (generated from PhHgCF3 and NaI) gave diastereomeric mixtures of the 2,2-difluorospirocyclopropane adducts. Stereoselectivity resulting from hindrance by the isopropylidene group favored addition at the beta face. Removal of base and sugar protecting groups gave new difluorospirocyclopropane nucleoside analogues. The protected uridine analogue was converted into its cytidine counterpart via a 4-(1,2,4-triazol-1-yl) intermediate. Stannyl radical-mediated deoxygenation of the 3'-O-TBS-2'-thionocarbamate derivatives gave the 2'-deoxy products of direct hydrogen transfer. In contrast, identical treatment of the 2'-O-TBS-3'-thionocarbamate isomers resulted in opening of the vicinal difluorocyclopropane ring upon generation of a C3' radical followed by homoallylic hydrogen transfer to give 4'-(1,1-difluoroethyl)-3',4'-unsaturated nucleoside derivatives. Structural aspects and biological effect considerations are discussed. 相似文献
4.
Hydrolyses of the two diastereomeric phosphoromonothioate analogs of uridine 2',3'-cyclic monophosphate [(R(P))- and (S(P))-2',3'-cUMPS] at 363.2 K have been followed by HPLC over pH-range 0-12. In aqueous alkali (pH > 9) only base-catalyzed endocyclic phosphoester hydrolysis to a nearly equimolar mixture of uridine 2'- and 3'-phosphoromonothioates (2'- and 3'-UMPS) takes place, analogously to the hydrolysis of uridine 2',3'-cyclic monophosphate (2',3'-cUMP). The (R(P))- and (S(P))-2',3'-cUMPS are hydrolyzed 50 and 30%, respectively, more slowly than 2',3'-cUMP. Under neutral and acidic conditions, desulfurization of the cyclic thiophosphates to 2',3'-cUMP competes with the phophoester hydrolysis, both reactions being acid-catalyzed at pH < 5. The desulfurization is most pronounced in strongly acidic solutions ([HCl] > 0.1 mol L(-)(1)), where more than 90% of the starting material is degraded via this route. At pH < 2, the thioates are considerably, i.e., more than 1 order of magnitude, more stable than 2',3'-cUMP. While the hydrolysis of 2',3'-cUMP is second-order in hydronium-ion concentration, that of 2',3'-cUMPS exhibits a first-order dependence. The reactivities of the two diastereomers are comparable with each other over the entire pH-range studied, the most significant difference being that the pH-independent desulfurization at pH > 5 is with the R(P)-isomer 5-fold faster than with the S(P)-isomer. In contrast to 2',3'-cUMP, depyrimidination of the starting material (i.e., release of the uracil base) competes with the hydrolysis of the thiophosphate moiety under neutral conditions (pH 6-8). 相似文献
5.
4-Thiouridine, 6-thioguanosine, and 6-thioinosine 3',5'-bisphosphates (9, 20, and 28) were synthesized in good yields by considerably improved methods. In the former two compounds, uridine and 2-N-phenylacetylguanosine were converted via transient O-trimethylsilylation to the corresponding 4- and 6-O-benzenesulfonyl intermediates (2 and 13), which, in turn, were allowed to react with 2-cyanoethanethiol in the presence of N-methylpyrrolidine to give 4-thiouridine (3) and 2-N-phenylacetyl-6-thioguanosine derivatives (14), respectively. In situ dimethoxytritylation of these thionucleoside derivatives gave the 5'-masked products 4 and 15 in high overall yields from 1 and 11. 6-S-(2-Cyanoethyl)-5'-O-(4,4'-dimethoxytrityl)-6-thioinosine (23) was synthesized via substitution of the 5'-O-tritylated 6-chloropurine riboside derivative 22 with 2-cyanoethanethiol. These S-(2-cyanoethyl)thionucleosides were converted to the 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-phosphoramidite derivatives 7, 18, and 26 or 3',5'-bisphosphate derivatives 8, 19, and 27. Treatment of 8, 19, and 27 with DBU gave thionucleoside 3',5'-bisphosphate derivatives 9, 20, and 28, which were found to be substrates of T4 RNA ligase. These thionucleoside 3',5'-bisphosphates were examined as donors for ligation with m3(2,2,7) G5'pppAmUmA, i.e., the 5'-terminal tetranucleotide fragment of U1 snRNA, The 4-thiouridine 3',5'-bisphosphate derivative 9 was found to serve as the most active substrate of T4 RNA ligase with a reaction efficiency of 96%. 相似文献
6.
Patching SG Middleton DA Henderson PJ Herbert RB 《Organic & biomolecular chemistry》2003,1(12):2057-2062
The synthesis of [2'-(13)C, 1,3-(15)N2]uridine 11 was achieved as follows. An epimeric mixture of D-[1-(13)C]ribose 3 and D-[1-(13)C]arabinose 4 was obtained in excellent yield by condensation of K13CN with D-erythrose 2 using a modification of the Kiliani-Fischer synthesis. Efficient separation of the two aldose epimers was pivotally achieved by a novel ion-exchange (Sm3+) chromatography method. D-[2-(13)C]Ribose 5 was obtained from D-[1-(13)C]arabinose 4 using a Ni(II) diamine complex (nickel chloride plus TEMED). Combination of these procedures in a general cycling manner can lead to the very efficient preparation of specifically labelled 13C-monosaccharides of particular chirality. 15N-labelling was introduced in the preparation of [2'-(13)C, 1,3-(15)N2]uridine 11 via [15N2]urea. Cross polarisation magic angle spinning (CP-MAS) solid-state NMR experiments using rotational echo double resonance (REDOR) were carried out on crystals of the labelled uridine to show that the inter-atomic distance between C-2' and N-1 is closely similar to that calculated from X-ray crystallographic data. The REDOR method will be used now to determine the conformation of bound substrates in the bacterial nucleoside transporters NupC and NupG. 相似文献
7.
[reaction: see text] A novel total synthesis of 3',5'-C-branched uridine azido acid has been accomplished using stereoselective aldehyde alkynylation, Ireland-Claisen rearrangement, and iodolactonization as the key reactions. Compared to traditional routes that start from carbohydrates, the present methodology is more efficient, flexible for future optimization, and provides access to both enantiomers of the products. Because the key chemistry does not involve the 3'- and 5'-C substituents, our route is a general approach to 3',5'-C alkyl nucleoside analogues. 相似文献
8.
The C-glucopyranosyl nucleosides (1-4) containing the N-acetyl glucosaminyl and uridine units have been synthesized as nonhydrolyzable substrate analogues of UDP-GlcNAc aimed to inhibit the chitin synthases. The key intermediate, 4-(2'-(N-acetylamino)-3', 4',6'-tri-O-benzyl-2'-deoxy-alpha-D-glucopyranosyl)but-2-enoic acid (5), was prepared from the perbenzylated (N-acetylamino)-alpha-C-allylglucoside (7), by successive oxidative cleavage, Wittig olefination, and ester deprotection. The coupling of the acid 5 with the hydroxyl or amine function of the uridine derivatives (6a or 6b) afforded, respectively, the ester 12 and amide 14. The dihydroxylation of the conjugated double bond in ester 12 or amide 14 was better achieved with osmium tetraoxide/barium chlorate, leading to the expected diols 13 and 15 as a mixture of two diastereoisomers. The desired compounds 1-4 were obtained after catalytic hydrogenation of compounds 12-15. 相似文献
9.
O'Donoghue A Pyun SY Yang MY Morrow JR Richard JP 《Journal of the American Chemical Society》2006,128(5):1615-1621
The cleavage of the diribonucleoside UpU (uridylyl-3'-5'-uridine) to form uridine and uridine (2',3')-cyclic phosphate catalyzed by the dinuclear Zn(II) complex of 1,3-bis(1,4,7-triazacyclonon-1-yl)-2-hydroxypropane (Zn(2)(1)(H(2)O)) has been studied at pH 7-10 and 25 degrees C. The kinetic data are consistent with the accumulation of a complex between catalyst and substrate and were analyzed to give values of k(c) (s(-)(1)), K(d) (M), and k(c)/K(d) (M(-)(1) s(-)(1)) for the Zn(2)(1)(H(2)O)-catalyzed reaction. The pH rate profile of values for log k(c)/K(d) for Zn(2)(1)(H(2)O)-catalyzed cleavage of UpU shows the same downward break centered at pH 7.8 as was observed in studies of catalysis of cleavage of 2-hydroxypropyl-4-nitrophenyl phosphate (HpPNP) and uridine-3'-4-nitrophenyl phosphate (UpPNP). At low pH, where the rate acceleration for the catalyzed reaction is largest, the stabilizing interaction between Zn(2)(1)(H(2)O) and the bound transition states is 9.3, 7.2, and 9.6 kcal/mol for the catalyzed reactions of UpU, UpPNP, and HpPNP, respectively. The larger transition-state stabilization for Zn(2)(1)(H(2)O)-catalyzed cleavage of UpU (9.3 kcal/mol) compared with UpPNP (7.2 kcal/mol) provides evidence that the transition state for the former reaction is stabilized by interactions between the catalyst and the C-5'-oxyanion of the basic alkoxy leaving group. 相似文献
10.
Hydrolytic reactions of guanosyl-(3',3')-uridine and guanosyl-(3',3')-(2',5'-di-O-methyluridine) have been followed by RP HPLC over a wide pH range at 363.2 K in order to elucidate the role of the 2'-hydroxyl group as a hydrogen-bond donor upon departure of the 3'-uridine moiety. Under neutral and basic conditions, guanosyl-(3',3')-uridine undergoes hydroxide ion-catalyzed cleavage (first order in [OH(-)]) of the P-O3' bonds, giving uridine and guanosine 2',3'-cyclic monophosphates, which are subsequently hydrolyzed to a mixture of 2'- and 3'-monophosphates. This bond rupture is 23 times as fast as the corresponding cleavage of the P-O3' bond of guanosyl-(3',3')-(2',5'-di-O-methyluridine) to yield 2',5'-O-dimethyluridine and guanosine 2',3'-cyclic phosphate. Under acidic conditions, where the reactivity differences are smaller, depurination and isomerization compete with the cleavage. The effect of Zn(2+) on the cleavage of the P-O3' bonds of guanosyl-(3',3')-uridine is modest: about 6-fold acceleration was observed at [Zn(2+)] = 5 mmol L(-)(1) and pH 5.6. With guanosyl-(3',3')-(2',5'-di-O-methyluridine) the rate-acceleration effect is greater: a 37-fold acceleration was observed. The mechanisms of the partial reactions, in particular the effects of the 2'-hydroxyl group on the departure of the 3'-linked nucleoside, are discussed. 相似文献
11.
DEHYDRATION OF U.V. IRRADIATED URIDINE AND ITS DERIVATIVES 总被引:2,自引:0,他引:2
Abstract— Ultraviolet irradiation of uridine, oligonucleotides and long chain Poly U produces a variety of photoproducts including a hydrated base arising from the addition of water to the 5,6 double bond. Both the hydration and dehydration reactions in a nucleotide are sensitive to the position of the phosphate linkage. The 5' mononucleotide is less easily hydrated than the 3'. Conversely, the dehydration process in the nucleoside and the nucleotides is most rapid for uridine and decreases progressively in rate as a phosphate is added to the 2', 5' or 3' position respectively. In the compound UpU the dehydration is a two component reaction with the two dehydration rates similar to those of 5' and 3' mononucleotides respectively. In higher order oligonucleotides the dehydration rate is slower than any of the rates for 5' and 3' monophosphates or 3', 5' diphosphates. The dehydration rate decreases rapidly for oligonucleotides up to chain lengths of 6 or 8 and then decreases at a diminishing rate. Long chain Poly U (7gt; 200 nucleotides) dehydrates at approximately 1/5 the rate of Up. In addition the initial alkaline treatment to dehydrate irradiated Poly U may result in chain breakage but this effect is not seen in subsequent cycles of irradiation and dehydration. The chain length effect on dehydration rate is only slightly decreased by the presence of 7M urea in the dehydration mixture. Quantitative data is presented on the effect of ternpcrature, and pH on the rate constant for dehydration of Up and its derivatives. 相似文献
12.
C J Welch X X Zhou J Chattopadhyaya 《Acta chemica Scandinavica. Series B: Organic chemistry and biochemistry》1986,40(10):817-825
The synthesis of 5'-GpGpUpGpU-3' is reported to demonstrate the synthetic use of the 6-methyl-3-pyridyl group for the protection of the O-4 and O-6 imide functions of uridine and guanosine, respectively. The 2'- and 5'-hydroxyl functions of the key intermediates were protected with two acid-labile groups: 3-methoxy-1,5-dicarbomethoxypentane-3-yl (MDMP) and 9-(4-octadecyloxyphenyl)xanthen-9-yl (C18Px), respectively. The internucleotide phosphotriesters were protected with 2-chlorophenyl and the 9-fluorenylmethyl group was employed for 3'-terminal phosphate protection. 相似文献
13.
Solution self-assembly, spontaneous deprotonation, and crystal structures of bipyrazolate-bridged metallomacrocycles with dimetal centers 总被引:5,自引:0,他引:5
Yu SY Huang HP Li SH Jiao Q Li YZ Wu B Sei Y Yamaguchi K Pan YJ Ma HW 《Inorganic chemistry》2005,44(25):9471-9488
A series of nanosized cavity-containing bipyrazolate-bridged metallomacrocycles with dimetal centers, namely, {[(bpy)M]8L4}(NO3)8 [L=3,3',5,5'-tetramethyl-4,4'-bipyrazolyl, Pd, Pt; 1,4-bis-4'-(3',5'-dimethyl)-pyrazolylbenzene), Pd; and 1,4-bis-4'-(3',5'-dimethyl)-pyrazolylbiphenyl, Pd], {[(phen)M]8L4}(NO3)8 [L=3,3',5,5'-tetramethyl-4,4'-bipyrazolyl, Pd, Pt; 1,4-bis-4'-(3',5'-dimethyl)-pyrazolylbenzene, Pd; and 1,4-bis-4'-(3',5'-dimethyl)-pyrazolylbiphenyl, Pd], {[(bpy)Pd]6L3}(NO3)6 [L=1,4-bis-4'-(3',5'-dimethyl)-pyrazolylbenzene,], {[(phen)Pd]6L3}(NO3)6 [L=1,4-bis-4'-(3',5'-dimethyl)-pyrazolylbenzene,], {[(bpy)Pd]4L2}(NO3)4 [L=1,3-bis-4'-(3',5'-dimethyl)-pyrazolylbenzene, and 1,2-bis-4'-(3',5'-dimethyl)-pyrazolylbenzene,], and {[(phen)Pd]4L2}(NO3)4 [L=1,3-bis-4'-(3',5'-dimethyl)-pyrazolylbenzene, and 1,2-bis-4'-(3',5'-dimethyl)-pyrazolylbenzene,] (where bpy=2,2'-bipyridine and phen=1,10-phenanthroline) have been synthesized through a directed self-assembly approach that involves spontaneous deprotonation of the 1H-bipyrazolyl ligands in aqueous solution. These complexes, with weak Pd(II)...Pd(II) or Pt(II)...Pt(II) interactions, have been characterized by elemental analysis, 1H and 13C NMR, cold-spray ionization or electrospray ionization mass spectrometry, UV-visible spectroscopy, and luminescence spectroscopy. Complexes and have also been characterized by single-crystal X-ray diffraction analysis. 相似文献
14.
The synthesis, electrochemistry, and optical spectroscopy of an extensive series of cofacial bis[(porphinato)zinc(II)] compounds are reported. These species were synthesized using sequential palladium-catalyzed cross-coupling and cobalt-mediated [2+2+2] cycloaddition reactions. This modular methodology enables facile control of the nature of macrocycle-to-macrocycle connectivity and allows unprecedented modulation of the redox properties of face-to-face porphyrin species. We report the synthesis of 5,6-bis[(5',5'-10',20'-bis[4-(3-methoxy-3-methylbutoxy)phenyl]porphinato)zinc(II)]indane (1), 5,6-bis[(2'-5',10',15',20'-tetraphenylporphinato)zinc(II)]indane (2), 5-([2'-5',10',15',20'-tetraphenylporphinato]zinc(II))-6-[(5"-10',20'-bis[4-(3-methoxy-3-methylbutoxy)phenyl]porphinato)zinc(II)]indane (3), 5-([2'-5',10',15',20'-tetrakis(trifluoromethyl)porphinato]zinc(II))-6-[(5' '-10' ',20' '-bis[4-(3-methoxy-3-methylbutoxy)phenyl]porphinato)zinc(II)]indane (4), 5-(2'-5',10',15',20'-[tetrakis(trifluoromethyl)porphinato]zinc(II))-6-[(2'-5',10',15',20'-tetraphenylporphinato)zinc(II)]indane (5), 5,6-bis([2'-5',15'-diphenyl-10',20'-(trifluoromethyl)porphinato]zinc(II))indane (6), and 5,6-bis([2'-5',10',15',20'-tetrakis(trifluoromethyl)porphinato]zinc(II))indane (7); 4-7 define the first examples of cofacial bis[(porphinato)metal] compounds in which sigma-electron-withdrawing perfluoroalkyl groups serve as macrocycle substituents, while 2, 6, and 7 constitute the first such structures that possess a beta-to-beta linkage topology. Cyclic voltammetric studies show that the electrochemically determined HOMO and LUMO energy levels of these cofacial bis(porphinato) complexes can be lowered by 780 and 945 mV, respectively, relative to the archetypal members of this class of compounds; importantly, these orbital energy levels can be modulated over well-defined increments throughout these wide potentiometric domains. Analyses of these cofacial bis[(porphinato)metal] potentiometric data, in terms of the absolute and relative frontier orbital energies of their constituent [porphinato]zinc(II) building blocks, as well as the nature of macrocycle-to-macrocycle connectivity, provide predictive electronic structural models that rationalize the redox behavior of these species. 相似文献
15.
Pezzella A Panzella L Natangelo A Arzillo M Napolitano A d'Ischia M 《The Journal of organic chemistry》2007,72(24):9225-9230
Chemical or enzymatic oxidation of 5,6-dihydroxyindole (1) leads to the rapid deposition of a black solid resembling eumelanin pigments by way of a complex oligomerization/polymerization process that proceeds in the early stages via dimers 2-3 and trimers 5-6 characterized by 2,4'- and 2,7'-couplings. Despite extensive efforts, the structures of the higher oligomers, which define the structural architecture and physicochemical properties of the eumelanin particles, have so far defied elucidation. Using a dimer-dimer coupling strategy that has recently allowed the first successful entry to a tetramer of 1, we report now three additional tetramers obtained by oxidation of 5,5',6,6'-tetrahydroxy-2,7'-biindolyl (3) with the peroxidase/H2O2 system. On the basis of extensive 2D NMR and mass spectrometric analysis, the products were identified as 5,5',5',5',6,6',6',6'-octaacetoxy-7,2':3',3':2',7'-tetraindolyl (acetylated 8, 3%), 5,5',5',5',6,6',6',6' '-octaacetoxy-2,7':4',4':7',2'-tetraindolyl (acetylated 9, 4%), and 5,5',5',5',6,6',6',6'-octaacetoxy-2,7':2',3':2',7'-tetraindolyl (acetylated 10, 5%), in which the inner units are linked through unexpected 3,3'-, 4,4'-, and 2,3'-linkages. If verified in further studies, the newly uncovered coupling patterns would entail important consequences for current models of eumelanin structure based on one-dimensional structural chains with extended pi-electron conjugation or pi-stacked flat oligomer aggregates. 相似文献
16.
Stereoselective syntheses of both the natural (C5'- S) and unnatural (C5'- R) diastereoisomers of uracil polyoxin C methyl ester have been developed. The key stereocontrolled step involves nucleophilic addition of trimethylsilyl cyanide to the appropriate chiral sulfinimine derived from 2',3'-protected 5'-formyluridine and (S)-(-)-tert-butanesulfinamide or (R)-(+)-tert-butanesulfinamide, respectively. A variety of substrate mimics designed to function as inhibitors of chitin synthase have been synthesized by conjugation of the methyl ester of uracil polyoxin C (UPOC) with activated isoxazole carboxylic acids. Amide bond formation was accomplished via coupling of the amino functionality of UPOC methyl ester with a free isoxazole acid using HBTU or alternatively an isoxazole pentafluorophenyl ester. The substrate mimics incorporate features of the nucleoside-peptide antibiotics, the polyoxins and the nikkomycins, as well as features of the transition state structure expected during polymerization of the natural chitin synthase substrate uridine diphosphoryl-N-acetylglucosamine (UDP-GlcNAc), namely, a metal-binding site and glycosyl oxocarbenium ion mimic. 相似文献
17.
Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method 总被引:1,自引:0,他引:1
Hayakawa Y Kawai R Hirata A Sugimoto JI Kataoka M Sakakura A Hirose M Noyori R 《Journal of the American Chemical Society》2001,123(34):8165-8176
The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core). 相似文献
18.
DaZhiLI XinYaHE HuiWANG LiSUN BingChengLIN 《中国化学快报》2004,15(9):1079-1082
The interactions between amnesic red-tide toxin, domoic acid (DA) and 14mer double-stranded DNA (dsDNA with three kinds of sequences) were studied by capillary zone electrophoresis (CZE). For the dsDNA with a sequence of 5‘-CCCCCTATACCCGC-3‘, the amount of free dsDNA decreases with the increase of added DA, and the signal of DA-dsDNA complex was observed. Meanwhile, the other two dsDNAs, 5‘-(C)12GC-3‘ and 5‘-(AT)7-3‘, the existence of DA could not lead to the change of dsDNA signal and indicated that there is no interaction between DA and these two dsDNAs. 相似文献
19.
Földesi A Trifonova A Dinya Z Chattopadhyaya J 《The Journal of organic chemistry》2001,66(20):6560-6570
The diastereospecific chemical syntheses of uridine-2',3',4',5',5' '-(2)H(5) (21a), adenosine-2',3',4',5',5' '-(2)H(5) (21b), cytidine-2',3',4',5',5' '-(2)H(5)(2)H(5) (21c), and guanosine-2',3',4',5',5' '-(2)H(5) (21d) (>97 atom % (2)H at C2', C3', C4', and C5'/C5' ') have been achieved for their use in the solution NMR structure determination of oligo-RNA by the Uppsala "NMR-window" concept (refs 4a-c, 5a, 6), in which a small (1)H segment is NMR-visible, while the rest is made NMR-invisible by incorporation of the deuterated blocks 21a-d. The deuterated ribonucleosides 21a-d have been prepared by the condensation of appropriately protected aglycone with 1-O-acetyl-2,3,5-tri-O-(4-toluoyl)-alpha/beta-D-ribofuranose-2,3,4,5,5'-(2)H(5) (19), which has been obtained via diastereospecific deuterium incorporation at the C2 center of appropriate D-ribose-(2)H(4) derivatives either through an oxidation-reduction-inversion sequence or a one-step deuterium-proton exchange in high overall yield (44% and 24%, respectively). 相似文献