The Expanded Genetic Alphabet

All biological information, since the last common ancestor of all life on Earth, has been encoded by a genetic alphabet consisting of only four nucleotides that form two base pairs. Long‐standing efforts to develop two synthetic nucleotides that form a third, unnatural base pair (UBP) have recently yielded three promising candidates, one based on alternative hydrogen bonding, and two based on hydrophobic and packing forces. All three of these UBPs are replicated and transcribed with remarkable efficiency and fidelity, and the latter two thus demonstrate that hydrogen bonding is not unique in its ability to underlie the storage and retrieval of genetic information. This Review highlights these recent developments as well as the applications enabled by the UBPs, including the expansion of the evolution process to include new functionality and the creation of semi‐synthetic life that stores increased information.     

Solution Structure,Mechanism of Replication,and Optimization of an Unnatural Base Pair

As part of an ongoing effort to expand the genetic alphabet for in vitro and eventual in vivo applications, we have synthesized a wide variety of predominantly hydrophobic unnatural base pairs and evaluated their replication in DNA. Collectively, the results have led us to propose that these base pairs, which lack stabilizing edge‐on interactions, are replicated by means of a unique intercalative mechanism. Here, we report the synthesis and characterization of three novel derivatives of the nucleotide analogue d MMO2 , which forms an unnatural base pair with the nucleotide analogue d 5SICS . Replacing the para‐methyl substituent of d MMO2 with an annulated furan ring (yielding d FMO ) has a dramatically negative effect on replication, while replacing it with a methoxy (d DMO ) or with a thiomethyl group (d TMO ) improves replication in both steady‐state assays and during PCR amplification. Thus, d TMO –d 5SICS , and especially d DMO –d 5SICS , represent significant progress toward the expansion of the genetic alphabet. To elucidate the structure–activity relationships governing unnatural base pair replication, we determined the solution structure of duplex DNA containing the parental d MMO2 –d 5SICS pair, and also used this structure to generate models of the derivative base pairs. The results strongly support the intercalative mechanism of replication, reveal a surprisingly high level of specificity that may be achieved by optimizing packing interactions, and should prove invaluable for the further optimization of the unnatural base pair.     

Can a Six‐Letter Alphabet Increase the Likelihood of Photochemical Assault to the Genetic Code?

In 2014, two unnatural nucleosides, d5SICS and dNaM, were shown to selectively base pair and replicate with high fidelity in a modified strain of E. coli, thus effectively expanding its genetic alphabet from four to six letters. More recently, a significant reduction in cell proliferation was reported in cells cultured with d5SICS, and putatively with dNaM, upon exposure to brief periods of near‐visible radiation. The photosensitizing properties of the lowest‐energy excited triplet state of both d5SICS and dNaM were implicated in their cytotoxicity. Importantly, however, the excited‐state mechanisms by which near‐visible excitation populates the triplet states of d5SICS and dNaM are currently unknown. In this study, steady‐state and time‐resolved spectroscopies are combined with quantum‐chemical calculations in order to reveal the excited‐state relaxation mechanisms leading to efficient population of the triplet states in these unnatural nucleosides in solution. It is shown that excitation of d5SICS or dNaM with near‐visible light leads overwhelmingly to ultrafast population of their triplet states on the femtosecond time scale. The results presented in this work lend strong support to the proposal that photoexcitation of these unnatural nucleosides can accelerate oxidatively generated damage to DNA and other biomolecules within the cellular environment.     

Structural Basis for Expansion of the Genetic Alphabet with an Artificial Nucleobase Pair

Hydrophobic artificial nucleobase pairs without the ability to pair through hydrogen bonds are promising candidates to expand the genetic alphabet. The most successful nucleobase surrogates show little similarity to each other and their natural counterparts. It is thus puzzling how these unnatural molecules are processed by DNA polymerases that have evolved to efficiently work with the natural building blocks. Here, we report structural insight into the insertion of one of the most promising hydrophobic unnatural base pairs, the dDs–dPx pair, into a DNA strand by a DNA polymerase. We solved a crystal structure of KlenTaq DNA polymerase with a modified template/primer duplex bound to the unnatural triphosphate. The ternary complex shows that the artificial pair adopts a planar structure just like a natural nucleobase pair, and identifies features that might hint at the mechanisms accounting for the lower incorporation efficiency observed when processing the unnatural substrates.     

Site‐Specifically Arraying Small Molecules or Proteins on DNA Using An Expanded Genetic Alphabet

A class of replicable unnatural DNA base pairs formed between d 5SICS and either d MMO2 , d DMO , or d NaM were developed. To explore the use of these pairs to produce site‐specifically labeled DNA, the synthesis of a variety of derivatives bearing propynyl groups, an analysis of their polymerase‐mediated replication, and subsequent site‐specific modification of the amplified DNA by Click chemistry is reported. With the d 5SICS scaffold a propynyl ether linker is accommodated better than its aliphatic analogue, but not as well as the protected propargyl amine linker explored previously. It was also found that with the d MMO2 and d DMO analogues, the d MMO2 position para to the glycosidic linkage is best suited for linker attachment and that although aliphatic and ether‐based linkers are similarly accommodated, the direct attachment of an ethynyl group to the nucleobase core is most well tolerated. To demonstrate the utility of these analogues, a variety of them were used to site‐selectively attach a biotin tag to the amplified DNA. Finally, we use d 5SICS^CO –d NaM to couple one or two proteins to amplified DNA, with the double labeled product visualized by atomic force microscopy. The ability to encode the spatial relationships of arrayed molecules in PCR amplifiable DNA should have important applications, ranging from SELEX with functionalities not naturally present in DNA to the production, and perhaps “evolution” of nanomaterials.     

Construction of a Live‐Attenuated HIV‐1 Vaccine through Genetic Code Expansion

A safe and effective vaccine against human immunodeficiency virus type 1 (HIV‐1) is urgently needed to combat the worldwide AIDS pandemic, but still remains elusive. The fact that uncontrolled replication of an attenuated vaccine can lead to regaining of its virulence creates safety concerns precluding many vaccines from clinical application. We introduce a novel approach to control HIV‐1 replication, which entails the manipulation of essential HIV‐1 protein biosynthesis through unnatural amino acid (UAA*)‐mediated suppression of genome‐encoded blank codon. We successfully demonstrate that HIV‐1 replication can be precisely turned on and off in vitro.     

Steric effects in RNA interference: probing the influence of nucleobase size and shape

Nonpolar nucleosides with varying size and shape have been used to study the hydrogen-bonding stabilization and steric effects on RNA interference. The uracil and adenine residues of siRNA guide strands have been replaced by nonpolar isosteres of uracil and adenine and by steric variants. RNAi experiments targeting Renilla luciferase mRNA have shown close correlation between siRNA thermal stability and gene suppression. Interestingly, siRNA modified at position 7 on the guide strand does not follow this correlation, having substantial RNAi activity despite low thermal stability. Sequence-selectivity studies were carried out at this position with mutated target mRNAs and nucleobase analogues with varied size (2,4-difluoro- and 2,4-dichlorobenzene) and different shape (2,3-dichlorobenzene, 4-methylbenzimidazole). The results point out the importance of nucleobase shape and steric effects in RNA interference.     

Structural Properties of Hachimoji Nucleic Acids and Their Building Blocks: Comparison of Genetic Systems with Four,Six and Eight Alphabets

Expansion of the genetic alphabet is an ambitious goal. A recent breakthrough has led to the eight-base (hachimoji) genetics having canonical and unnatural bases. However, very little is known on the molecular-level features that facilitate the candidature of unnatural bases as genetic alphabets. Here we amalgamated DFT calculations and MD simulations to analyse the properties of the constituents of hachimoji DNA and RNA. DFT reveals the dominant syn conformation for isolated unnatural deoxyribonucleosides and at the 5′-end of oligonucleotides, although an anti/syn mixture is predicted at the nonterminal and 3′-terminal positions. However, isolated ribonucleotides prefer an anti/syn mixture, but mostly prefer anti conformation at the nonterminal positions. Further, the canonical base pairing combinations reveals significant strength, which may facilitate replication of hachimoji DNA. We also identify noncanonical base pairs that can better tolerate the substitution of unnatural pairs in RNA. Stacking strengths of 51 dimers reveals higher average stacking stabilization of dimers of hachimoji bases than canonical bases, which provides clues for choosing energetically stable sequences. A total of 14.4 μs MD simulations reveal the influence of solvent on the properties of hachimoji oligonucleotides and point to the likely fidelity of replication of hachimoji DNA. Our results pinpoint the features that explain the experimentally observed stability of hachimoji DNA.     

The Structural Basis for Processing of Unnatural Base Pairs by DNA Polymerases

Unnatural base pairs (UBPs) greatly increase the diversity of DNA and RNA, furthering their broad range of molecular biological and biotechnological approaches. Different candidates have been developed whereby alternative hydrogen-bonding patterns and hydrophobic and packing interactions have turned out to be the most promising base-pairing concepts to date. The key in many applications is the highly efficient and selective acceptance of artificial base pairs by DNA polymerases, which enables amplification of the modified DNA. In this Review, computational as well as experimental studies that were performed to characterize the pairing behavior of UBPs in free duplex DNA or bound to the active site of KlenTaq DNA polymerase are highlighted. The structural studies, on the one hand, elucidate how base pairs lacking hydrogen bonds are accepted by these enzymes and, on the other hand, highlight the influence of one or several consecutive UBPs on the structure of a DNA double helix. Understanding these concepts facilitates optimization of future UBPs for the manifold fields of applications.     

Temperature dependence of internucleotide nitrogen–nitrogen scalar couplings in RNA

The temperature dependence of internucleotide nitrogen–nitrogen scalar couplings ^2hJ(N,N) across hydrogen bonds in adenine–uracil (A–U) and guanine–cytosine (G–C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 K. The value of ^2hJ(N,N) was observed to decrease monotonically for all four base pairs with increasing temperature. The temperature dependence of ^2hJ(N,N) was found to be more pronounced for the A–U base pair than for G–C base pairs. An earlier study of cross‐correlation effects at 296 K appeared to indicate a reduced mobility of the A–U base pair, as evidenced by small contributions of chemical shift modulation to relaxation rates. Copyright © 2002 John Wiley & Sons, Ltd.     

Debugging Eukaryotic Genetic Code Expansion for Site‐Specific Click‐PAINT Super‐Resolution Microscopy

Super‐resolution microscopy (SRM) greatly benefits from the ability to install small photostable fluorescent labels into proteins. Genetic code expansion (GCE) technology addresses this demand, allowing the introduction of small labeling sites, in the form of uniquely reactive noncanonical amino acids (ncAAs), at any residue in a target protein. However, low incorporation efficiency of ncAAs and high background fluorescence limit its current SRM applications. Redirecting the subcellular localization of the pyrrolysine‐based GCE system for click chemistry, combined with DNA‐PAINT microscopy, enables the visualization of even low‐abundance proteins inside mammalian cells. This approach links a versatile, biocompatible, and potentially unbleachable labeling method with residue‐specific precision. Moreover, our reengineered GCE system eliminates untargeted background fluorescence and substantially boosts the expression yield, which is of general interest for enhanced protein engineering in eukaryotes using GCE.