Pyruvoyl, a novel amino protecting group on the solid phase peptide synthesis and the peptide condensation reaction

In one of the peptide condensation methods termed thioester method, an amino protecting group is required in the lysine side chain. In this study, to investigate the efficiency of the pyruvoyl group as an amino protecting group, we synthesized N^α-fluorenylmethoxycarbonyl (Fmoc)-N^ε-pyruvoyl-lysine and introduced it into peptides and glycopeptides by the ordinary Fmoc-based solid phase peptide synthesis. The pyruvoyl peptide could be condensed with a peptide thioester by the thioester method, and this protecting group was easily removed by o-phenylenediamine treatment without significant side reactions.     

Hydrazine-sensitive thiol protecting group for peptide and protein chemistry

In the search for a new Cys side-chain protecting group that is compatible to the solid-phase peptide synthesis yet can be removed under mild conditions, the Hqm and Hgm groups that are readily deprotected by using aqueous hydrazine have been developed. The utility of these groups for peptide and protein chemistry is tested by the total synthesis of a peptide antibiotic trifolitoxin and the human neutrophil defensin hNP2.     

A new protecting group for tryptophan in solid-phase peptide synthesis which protects against acid-catalyzed side reactions and facilitates purification by HPLC

The indole nucleus of Z-Trp-OBzl is modified by acylation of the indole nitrogen using Boc-N-methyl butyric acid followed by catalytic hydrogenation and introduction of the Fmoc group. The resulting derivative, Fmoc-Trp(Boc-Nmbu)-OH, is incorporated into peptide chains via solid-phase peptide synthesis (SPPS). After assembly of the peptide chain, the Boc group is cleaved by treatment with TFA. The peptide is isolated with the tryptophan residue modified with a cationic 4-(N-methylamino) butanoyl group, which improves the solubility of the peptide during HPLC purification. On treatment of the purified peptide at pH 9.5, the Nmbu group undergoes an intramolecular cyclization reaction; this results in the fully deprotected peptide and N-methylpyrrolidone.     

A new safety-catch protecting group and linker for solid-phase synthesis

The use of two derivatives of 2-methoxy-4-methylsulfinylbenzyl alcohol is demonstrated as a safety-catch protecting group and linker for solid-phase peptide synthesis. The protecting group and linker are stable to TFA and are readily removed under reductive acidolytic conditions.     

The 2-(N-formyl-N-methyl)aminoethyl group as a potential phosphate/thiophosphate protecting group in solid-phase oligodeoxyribonucleotide synthesis

[reaction in text] The 2-(N-formyl-N-methyl)aminoethyl deoxyribonucleoside phosphoramidite 1 has been synthesized and used in the solid-phase synthesis of an octadecathymidylic acid as a cost-efficient monomer for potential application in the preparation of therapeutic oligonucleotides. The 2-(N-formyl-N-methyl)aminoethyl group can be cleaved from oligonucleotides according to a unique thermolytic cyclodeesterification process at pH 7.0. In addition to being cost-effective, the use of 1 simplifies oligonucleotide postsynthesis processing by eliminating the utilization of concentrated ammonium hydroxide in oligonucleotide deprotection.     

Improvement of stability of phenacyloxycarbamidomethyl (Pocam) group,a cysteine protecting group removable with zinc reduction,under acidic conditions

In order to improve the stability of phenacyloxycarbamidomethyl (Pocam) group, a cysteine protecting group removable with zinc reduction, under acidic conditions, various alkyl substituents on the nitrogen atom of Pocam group were examined. As a result, attachment of an electron-withdrawing group improved the stability, and 2,2,2-trifluoroethyl (Tfe) group was most effective among four substituents tested. Tfe-Pocam group could be used in solid-phase peptide synthesis and peptide condensation reactions, and it was also useful for regioselective disulfide formation reactions.     

SUBPOL: a novel SUcrose-Based Polymer support for solid-phase peptide synthesis and affinity chromatography applications

A novel SUcrose-Based Polymer support (SUBPOL) with tailored morphology suitable for the use in solid-phase peptide synthesis (SPPS) is described, and its application as a hydrophilic affinity matrix for the specific removal of fibrinogen from human plasma is demonstrated. After suspension polymerization of partly methacrylated 2,1':4,6-di-O-isopropylidene sucrose and subsequent removal of the protecting groups, hydrophilic spherical polymer beads were obtained. The morphology of the resulting resin was controlled by variation of the porogen as well as the average degree of substitution with respect to the methacryloyl groups of the monomer mixture. After introduction of amino groups for a permanent attachment of immobilized peptide ligands, prevention of unintended esterification during SPPS was achieved by silylation of remaining hydroxy groups. Alternatively, a Rink amide linker was introduced prior to SPPS to allow cleavage and subsequent analysis of the peptide assembled on the SUBPOL resins. Two hexapeptides of sequence kwiivw and hffflw, consisting of d-amino acids, as well as a 19-mer peptide corresponding to the sequence GSGVRGDFGSLAPRVARQL of the VP1 protein from the foot-and-mouse disease virus (FMDV) were successfully prepared both manually or in a semi-automated process on SUBPOL resins according to the Fmoc/tBu strategy. Yields and purities were comparable to peptides prepared on commercially available polystyrene resins. A specific affinity adsorbent containing the fibrinogen-binding pentapeptide GPRPK was prepared by SPPS on SUBPOL resins of different morphology, and the strong impact of the affinity matrix on adsorption performance was demonstrated.     

4-Methoxybenzyloxymethyl group, a racemization-resistant protecting group for cysteine in Fmoc solid phase peptide synthesis

The 4-methoxybenzyloxymethyl (MBom) group was introduced for sulfhydryl protection of Cys in combination with Fmoc chemistry. The MBom group proved to substantially suppress racemization of Cys during its incorporation mediated by phosphonium or uronium reagents. Furthermore, this group was found to significantly reduce racemization of the C-terminal Cys linked to a hydroxyl resin during repetitive base treatment, in comparison with the usually used trityl (Trt) and acetamidomethyl (Acm) groups.     

Phenylhydrazide as an enzyme-labile protecting group in peptide synthesis

The enzymatic cleavage of amino acid phenylhydrazides with the enzyme tyrosinase (EC 1.14.18.1) offers a new, mild, and selective method for C-terminal deprotection of peptides. The advantages of the described methodology are the very mild oxidative removal of the protecting group at room temperature and pH 7, a high chemo- and regioselectivity, and the availability of the biocatalyst. Even in oxygen-saturated solution, the oxidation of sensitive methionine residues was not observed. These features make the methodology suitable for the synthesis of sensitive peptide conjugates. Mechanistic data suggest that the hydrolysis of the oxidized adducts proceeds by a free-radical mechanism.     

Ethoxyethylidene protecting group prevents N-overacylation in aminooxy peptide synthesis

We report herein an improved synthetic route for the preparation of homogenous aminooxy peptides suitable for oxime ligation. Aminooxyacetic acid (Aoa) was protected with 1-ethoxyethylidene group (Eei) then incorporated either using PyBOP or as N-hydroxysuccinimidyl ester at N-terminal end or at a lysine side chain into model peptides in solution and on solid support. Due to the Eei protecting group, these new reagents prevent the N-overacylation side reaction in comparison with Boc-Aoa derivatives. Subsequent deprotection under mild acidic conditions gave the corresponding pure aminooxylated peptides.     

The 3-(N-tert-butylcarboxamido)-1-propyl group as an attractive phosphate/thiophosphate protecting group for solid-phase oligodeoxyribonucleotide synthesis

Among the various phosphate/thiophosphate protecting groups suitable for solid-phase oligonucleotide synthesis, the 3-(N-tert-butylcarboxamido)-1-propyl group is one of the most convenient, as it can be readily removed, as needed, under thermolytic conditions at neutral pH. The deprotection reaction proceeds rapidly (t(1/2) approximately 100 s) through an intramolecular cyclodeesterification reaction involving the amide function and the release of the phosphate/thiophosphate group as a 2-(tert-butylimino)tetrahydrofuran salt. Incorporation of the 3-(N-tert-butylcarboxamido)-1-propyl group into the deoxyribonucleoside phosphoramidites 1a-d is achieved using inexpensive raw materials. The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioate analogue is comparable to that of commercial 2-cyanoethyl deoxyribonucleoside phosphoramidites. These oligonucleotides were phosphate/thiophosphate-deprotected within 30 min upon heating at 90 degrees C in Phosphate-Buffered Saline (PBS buffer, pH 7.2). Since no detectable nucleobase modification or significant phosphorothioate desulfurization occurs, the 3-(N-tert-butylcarboxamido)-1-propyl group represents an attractive alternative to the 2-cyanoethyl group toward the large-scale preparation of therapeutic oligonucleotides.     

o-Nitrobenzoyl group as a new amino protecting group for peptide synthesis and the synthesis of some anthranilyl peptides

N (o-nitrobenzoyl)amino acids can be coupled with other amino acids using DCC and the resulting product on hydrogenation gives peptides, containing the anthranilyl group as —NH₂ end group. N (anthranilyl)amino acids or peptides can also be obtained by reaction of isatoic anhydride on amino acids or peptides. The anthranilyl end group is easily cleaved by metal (Cu⁺²) catalysed hydrolysis to give α-amino acid peptides and the insoluble copper(II) anthranilate.     

Total synthesis of cucurbitoside A using a novel fluorous protecting group

The first total synthesis of cucurbitoside A was achieved using a new fluorous N-phenylcarbamoyl (^FCar) protecting group. The ^FCar group was introduced into carbohydrates in high yield and was selectively removed with Bu₄NNO₂ without damaging other acyl protecting groups. The synthetic intermediates were easily isolated by fluorous solid-phase extraction.     

2-(2-pyridyl-)ethyl esters A new carboxyl protecting group in peptide synthesis

2-(2-pyridyl-)ethyl esters are used as chemically inert, highly selective protecting groups that are removable under mild conditions via a two step procedure.     

A novel phase-switching protecting group for multi-step parallel solution phase synthesis

A new phase-tag 1 which facilitates the parallel solution phase synthesis of carboxylic acids, esters, and carboxamides is reported. The new phase tag assists compound purification by enabling the selective resin capture of reaction products in either a reversible pH dependent manner (solid-phase extraction), or irreversibly in a Diels-Alder reaction.     

O-Glycosyl trichloroacetimidates bearing Fmoc as temporary hydroxy protecting group: a new access to solid-phase oligosaccharide synthesis

Different O-glycosyl trichloroacetimidates bearing base sensitive Fmoc protected hydroxy groups were efficiently prepared with CCl(3)CN using a catalytic amount of sodium hydride. The resulting glycosyl donors were engaged in glycosylation reactions both in solution and on solid support with a new ester-type linker with good results. In both approaches, Fmoc groups were afterward quantitatively cleaved using mild basic conditions.