Molecular structure,experimental and theoretical 1H and 13C NMR chemical shift assignment of cyclic and acyclic α,β‐unsaturated esters

The experimental ¹H and ¹³C NMR spectra of 13 phenyl cinnamates and four 4‐methylcoumarins were investigated and their chemical shifts assigned on the basis of the two‐dimensional spectra. For the unsubstituted cinnamic acid phenyl ester, optimized molecular structures were calculated at a B3LYP/6‐311++G(d,p) level of theory. ¹H and ¹³C NMR chemical shifts were also calculated with the GIAO method at the B3LYP/6‐311 + G(2d,p) level of theory. The comparison between experimental and calculated NMR chemical shift suggests that the experimental spectra are formed from the superposition spectra of the two lowest energy conformers of the compound in solution. The most stable s‐cis configuration found in our studies is also the conformation adopted for a related phenyl cinnamate in solid state. The experimental results were analyzed in terms of the substituent effects. Copyright © 2013 John Wiley & Sons, Ltd.     

Molecular structure of alkali metal 4‐nitrobenzoates

The influence of lithium, sodium, potassium, rubidium, and cesium on the electronic system of the 4‐nitrobenzoic acid molecule was studied. The vibrational (FT‐IR, FT‐Raman) and NMR (¹H and ¹³C) spectra for 4‐nitrobenzoic acid salts of alkali metals were recorded. The assignment of vibrational spectra was done. Characteristic shifts of band wavenumbers and change in band intensities along the metal series were observed. Good correlation between the wavenumbers of the vibrational bands in the IR and Raman spectra for 4‐nitrobenzoates and ionic potential, electronegativity, atomic mass, and affinity of metals were found. The chemical shifts of protons and carbons (¹H, ¹³C NMR) in the series of studied alkali metal 4‐nitrobenzoates were observed too. Optimized geometrical structures of studied compounds were calculated by HF, B3PW91, B3LYP methods using 6‐311++G** basis set. The theoretical IR, Raman, and NMR spectra were obtained. The theoretical vibrational spectra were interpreted by means of potential energy distributions (PEDs) using VEDA 3 program. The calculated parameters were compared to experimental characteristic of studied compounds. Copyright © 2007 John Wiley & Sons, Ltd.     

The analysis of pH‐dependent protonated conformers of 1‐hydroxyethylidene‐1,1‐diphosphonic acid by means of FT‐Raman spectroscopy,multivariate curve resolution and DFT modelling

1‐Hydroxyethylidene‐1,1‐diphosphonic acid (HEDP) solutions in the pH range 0.98–13.00 were analysed using FT‐Raman spectroscopy and ³¹P and ²³Na NMR spectroscopy. Vibrational bands for different protonated species were observed in the Raman spectra, whereas only a single NMR signal that shifted with pH was observed for all samples over the entire pH range. No significant shift in the ²³Na NMR signal was observed, confirming that formation of Na⁺(aq) complexes did not take place; hence, no interference with the different protonated forms of HEDP occurred. Vibrational bands were assigned using density functional theory(DFT)‐calculated spectra of the most likely conformers in solution. Multivariate curve resolution was performed on the Raman spectra in the region containing the PO stretching vibrations to determine the number of protonated species formed over the entire pH range. Chemometric analysis compares very favourably with the experimental species distribution diagram which was generated using the reported log K_H values. Copyright © 2009 John Wiley & Sons, Ltd.     

NMR Studies of Hindered Rotation and Magnetic Anisotropy: The Diels–Alder Adducts of Phencyclone with N‐Phenylmaleimide and N‐(2‐Trifluoromethylphenyl)maleimide. Ab Initio Calculations for Optimized Structures

Abstract

N‐Phenylmaleimide, 2, and N‐(2‐trifluoromethylphenyl)maleimide, 3, were separately added to phencyclone, 1, to yield the corresponding phencyclone Diels–Alder adducts, 4 and 5. The resulting adducts (and some precursors) have been characterized by one‐ and two‐dimensional ¹H and ¹³C NMR at 300 and 75 MHz, and by ¹⁹F NMR at 282 MHz, at ambient temperatures. The NMR data are consistent, for both adducts, with: (a) hindered rotation of the bridgehead unsubstituted phenyl groups about the C(sp²)–C(sp³) bonds, based on slow exchange limit (SEL) spectra and (b) endo adduct configuration based on magnetic anisotropic effects in the ¹H NMR. The NMR spectra of the phencyclone adduct, 4, of N‐phenylmaleimide, indicate free rotation on the NMR timescales (fast exchange limit, FEL spectra) about the N‐phenyl bond. The spectra for the adduct, 5, of N‐(2‐trifluoromethylphenyl)maleimide are interpreted as consistent with SEL regimes, for the N‐aryl rotations, with a single rotamer present in which the trifluoromethyl group is directed “out of” the adduct cavity, and away from the phenanthrenoid moiety. This conclusion is based, in part, on NMR data suggesting the apparent slow N‐aryl bond rotation in a pair of atropisomers corresponding to the acetic acid addition products from the N‐(2‐trifluoromethylphenyl)maleimide. Evidence of magnetic anisotropic effects due to the phenanthrenoid moiety and proximal carbonyls is discussed. ¹H, ¹³C, and ¹⁹F assignments are presented and interpreted. Molecular modeling calculations at the Hartree–Fock level, 6‐31G* basis set, were performed to provide geometry optimizations for energy‐minimized structures of selected compounds.     

Analysis of the optical properties of poly(3‐octylthiophene) partially dedoped

In this work, poly(3‐octylthiophene) (P3OT) films were synthesized electrochemically in non‐aqueous media through the oxidation of the monomer, (3‐octylthiophene), using a standard three‐electrode cell in acetonitrile with 0.05 mol L^?1 LiClO₄ or 0.05 mol L^?1 Et₄NBF₄. The polymeric films were deposited on fluorine tin oxide (FTO). The partial dedoping was obtained in NH₄OH solution, providing a good chemical stability of the formed material. The films obtained through this method have been characterized by Fourier‐transform infrared spectroscopy (FT‐IR), electron paramagnetic resonance (EPR), UV–Vis absorption, and photoluminescence (PL) spectroscopy. The FT‐IR and EPR spectra together gave the results that led to characterization of two structures (pristine and non‐pristine forms of thiophene rings) while forming the P3OT polymer chain. These results were associated with the stabilization of pristine chains and mixed chains (non‐pristine structures) in the polymeric film. Their bands in the PL spectra are wide and asymmetric and their adjustments by Gaussian functions was necessary; this was the main indication that there are two distinct contributions to the emission spectra. These two contributions are attributed to the emission by mixed chains (Gaussian centered at higher energy) and by pristine chains (Gaussian of lower energy) present in the formed polymeric material. Copyright © 2010 John Wiley & Sons, Ltd.     

Spectroscopic (FT‐IR,FT‐Raman,UV, 1H,and 13C NMR) and theoretical studies of m‐anisic acid and lithium,sodium, potassium,rubidium, and caesium m‐anisates

In order to understand the nature of the interactions of biologically important ligands, it is necessary to carry out the physico‐chemical studies of these compounds with their biological targets (e.g., receptors in the cell or important cell components). Results of this study make it possible to predict some properties of a molecule, such as its reactivity, durability of complex compounds, and kinship to enzymes. In this paper the effect of alkali metal cations (Li, Na, K, Rb, and Cs) on the electronic structure of m‐methoxybenzoic acid (m‐anisic acid) was studied. The experimental IR (in solid state and solution), Raman, UV (in solid state and solution), ¹H, and ¹³C NMR spectra of m‐methoxybenzoic acid, and its salts were registered, assigned, and analyzed. Some of the obtained results were compared with published data for o‐anisic acid and o‐anisates. The structures of anisic acid and Li, Na, and K m‐anisates were optimized at the B3LYP/6‐311++G** level. The IR, ¹H, and ¹³C NMR spectra and NPA, ChelpG, and MK atomic charges were calculated. The change of metal along with the series: Li → Na → K → Rb → Cs caused: (1) the change in the electronic charge distribution in anisate anion that is seen via the occurrence of the systematic shifts of several bands in the experimental and theoretical IR and Raman spectra of anisates; (2) systematic ¹H and ¹³C NMR chemical shifts; (3) hypsochromic shifts in UV spectra of salts as compared to ligands. Copyright © 2009 John Wiley & Sons, Ltd.     

Application of NMR Spectroscopy and Mass Spectrometry to the Structural Elucidation of Modified Flavan‐3‐ols and Their Coupling Reaction Products*

NMR and MS techniques were used for the unambiguous structural elucidation of synthesized modified monomeric and dimeric flavan‐3‐ols presenting different substituents on the A‐ring C8 position. The full characterization of the synthesized compounds was achieved by concerted use of NMR and ESI‐MS techniques. Assignments of proton and carbon atoms was achieved through analysis of the 1D ¹H and ¹³C NMR spectra combined with homo‐ and heteronuclear 2D NMR experiments. In each case, HMBC correlation between proton H2 and carbon C8a was observed allowing assignment of this carbon, which represents the key for attribution of the A‐ring carbon atoms. The synthesis and structural characterization of activated monomeric and dimeric flavanols were also achieved and used as precursors for preparation of natural and modified dimeric procyanidin derivatives. The preparation of various dimeric species involving modified flavanols was explored through different coupling reactions. The structures of the compounds formed were characterized on the basis of their MS and NMR spectral analysis. Dimeric species were characterized through proton–proton and proton–carbon correlations, which distinguished between the different flavanol moieties and established their sequences.     

Proton and Carbon‐13 NMR Studies of the Phencyclone Adducts of Medium Alkyl Chain‐Length N‐n‐Alkylmaleimides. Hindered Rotations and Magnetic Anisotropic Effects. Ab initio Calculations for Optimized Structures

Abstract

The Diels–Alder adducts, 3a–e, of phencyclone, 1, have been prepared from a series of N‐n‐alkylmaleimides, 2, with medium chain‐length n‐alkyl groups. The maleimides were obtained by cyclodehydration of the N‐n‐alkylmaleamic acids, 4, formed from reaction of maleic anhydride with the corresponding n‐alkylamines. The five adducts prepared included derivatives from n‐heptyl, 3a; n‐octyl, 3b; n‐nonyl, 3c; n‐decyl, 3d; and n‐dodecyl, 3e. The NMR spectra of the adducts were studied in CDCl₃ at ambient temperatures at 300 MHz for proton and 75 MHz for carbon‐13, with full proton assignments achieved by high‐resolution COSY45 spectra for the aryl and the alkyl regions. Slow exchange limit (SEL) spectra were observed for both ¹H and ¹³C spectra showing slow rotation on the NMR timescales of the unsubstituted bridgehead phenyl groups. Endo Diels–Alder adduct stereochemistry was supported by striking magnetic anisotropic shielding effects in the ¹H spectra of the alkyl groups, with the NCH₂ CH ₂ signal of each adduct appearing upfield of tetramethylsilane (TMS) at ca. ?0.32 ppm. Proton NMR spectra for precursor maleamic acids and maleimides are reported, with some solvent effects found (CDCl₃ vs. d ₆‐acetone) for the carbon‐bound HC?CH protons of 4. Ab initio molecular modeling calculations at the Hartree‐Fock level using the 6‐31G* basis set have been performed for two key conformers of the phencyclone adduct of N‐n‐octylmaleimide, as a representative structure for these hindered adducts, to estimate geometric parameters for the adduct. A syn conformer, with the alkyl chain directed into the adduct cavity, was found to be ca. 0.23 kcal/mol lower energy than an anti conformer (in which the alkyl chain was directed away from the phenanthrenoid moiety).     

Reaction of bicyclo[2.2.1]hept‐5‐ene‐endo‐2‐ylmethylamine and nitrophenyl glycidyl ethers

Reactions of 2‐nitro‐, 4‐nitro‐ and 2,4‐dinitrophenylglycidyl ethers with bicyclo[2.2.1]hept‐5‐ene‐endo‐2‐ylmethylamine in isopropanol have been studied. The mixtures of products were chromatographed on silica gel and eluted with ether or ether/2‐propanol (1:1), the structures of individual products have been confirmed by IR spectra, NMR ¹H, ¹³C spectra, using experiments that involve homonuclear and heteronuclear scalar coupling interactions (COSY, TOCSY, HMQC, HMBC), and mass spectrometry. Amino alcohols as the major products of regioselective aminolysis of epoxides (according to the Krasusky rule) have been obtained. The minor products were the compounds with two hydroxyalkyl fragments at the nitrogen atom. In case of dinitrophenylglycidyl ether, it was the minor product of aryl nucleophilic substitution (S_NAr). The abnormal course of aminolysis has been confirmed by the results of quantum‐chemical calculations of activation barries and Free Gibbs energies of the competitive reactions of epoxides (at the B3LYP/6‐311 + G(d,p) level of theory). Copyright © 2010 John Wiley & Sons, Ltd.     

Analysis of G‐quadruplex conformations using Raman and polarized Raman spectroscopy

G‐quadruplexes (G4s) are four‐stranded DNA structures formed within nucleic acid sequences that are rich in guanines. G4 formation within DNA strands is believed to have significant biological relevance for the control of cell replication and gene expression. Therefore, the development and validation of experimental techniques that can easily and reliably characterize G4 structures under biologically relevant measurement conditions, like Raman spectroscopy, are desirable for G4‐targeted structure based drug design. Here we report Raman and polarized Raman studies of solutions of three oligonucleotides, thrombin binding aptamer (TBA) 5′‐GGTTGGTGTGGTTGG‐3′, human telomeric (HT) 5′‐(TTAGGG)₄‐3′, and a modified c‐Myc NHE‐III₁ sequence (MycL1) 5′‐TGAGGGTGGGTAGGGTGGGTAA‐3′, which were previously reported to form four distinct intramolecular G4 structures in the presence of Na⁺ or K⁺, as determined by NMR. Our results support the previously proposed antiparallel (TBA), antiparallel and hybrid (HT), and parallel with double‐chain reversal (DCR) loop (MycL1) structures. Large sample‐dependent variations in the intensity of bands associated with deoxyribose backbone modes in the 840–930 cm⁻¹ and 1420–1460 cm⁻¹ spectral regions were observed. Most notably, a highly polarized deoxyribose ring symmetric stretch (~930 cm⁻¹) appeared strongly in the solution spectra for HT and TBA, but was very weak or absent in the solution spectrum for MycL1 and the drop deposition (dried sample) spectra for all three oligonucleotides. It is hypothesized that the intensity of this band is likely controlled by furanose ring structure uniformity and/or solvent accessibility to certain nucleotide binding sites. Raman depolarization ratios measured for the G4s in solution were generally very similar to those previously reported for canonical B DNA, with the possible exception of base ring modes that consistently yielded slightly lower depolarization ratios for G4s compared to B DNA. The results further underscore the utility of Raman and polarized Raman spectroscopy for G4 structure elucidation under biologically relevant solution conditions. Copyright © 2015 John Wiley & Sons, Ltd.     

Self‐trapped N?H vibrational states in the polymorphs of glycine,L‐ and DL‐alanine

The polarized Raman spectra of the oriented single crystals of L ‐ and DL ‐alanine, α‐, β‐ and γ‐polymorphs of glycine have been studied at 3–300 K. Regularly spaced band packets have been observed in the spectral range of 2500–3000 cm⁻¹, with intensity decreasing noticeably on heating. These band packets were interpreted as the manifestations of the existence of N H self‐trapped states in these systems at low temperatures. The analysis of the polarized spectra has shown that the self‐trapping is observed exclusively for the NH stretching vibration of the amino groups, which is related to the NH···O hydrogen bonds along the head‐to‐tail chains of zwitterions in the crystal structures. The wavenumber of this NH stretching vibration, however, was proposed to depend not solely on the length of this NH···O hydrogen bond, but also on the lengths of all the other NH···O hydrogen bonds formed by the NH₃⁺ and the COO⁻ groups in the structure linking the head‐to‐tail chains with each other. The arguments in favor of the hypothesis that the self‐trapping in these systems can be mediated by zero‐point quantum motions, and not by lattice phonons, are considered. The unusually low wavenumber (2500 cm⁻¹) observed for the NH stretching vibration and indicating at the formation of a very strong NH···O bond is interpreted based on considering the effect of the crystalline environment on the formation and properties of the NH···O bonds in the head‐to‐tail chains of amino acid zwitterions. The results are interesting for understanding the factors determining the dynamics and structural instability of crystalline amino acids and also for biophysical chemistry, as the hydrogen bonded chains formed by amino acid zwitterions in the crystals can mimic the peptide chains. Copyright © 2009 John Wiley & Sons, Ltd.     

Synthesis,X-ray crystal structure and optical properties research of novel diphenyl sulfone-based bis-pyrazoline derivatives

A series of novel bis-pyrazoline derivatives were synthesized by the reaction of chalcone and (sulfonylbis(3,1-phenylene))bis(hydrazine) in 20–34% yields. The structures of the compounds were determined by IR, ¹H NMR, HRMS spectra, and a representative compound 3b was confirmed based on the X-ray crystallographic analysis. Absorption and fluorescence spectra of these compounds in dichloromethane solution were investigated. The results showed that the emission maxima varied from 415 to 444 nm mainly depending on C3 substituents of pyrazoline moiety. The compounds had higher quantum yields, when C3 substituent was an electron-withdrawing p-chlorophenyl group. Moreover, absorption spectra and emission spectra exhibited a blue-shift and a red-shift with increasing the polarity of solvents, respectively. Fluorescent molecules happened to collide with each other and resulted in quench of the fluorescence when the concentration increased over to 10^?5 M.     

Hydrogen bonding in different pyrimidine–methanol clusters probed by polarized Raman spectroscopy and DFT calculations

We report on the hydrogen bonding between pyrimidine (Pd) and methanol (M) as H‐donor in this study. Hydrogen bonds between pyrimidine and methanol molecules as well as those between different methanol molecules significantly influence the spectral features at high dilution. The ring‐breathing mode ν₁ of the reference system Pd was chosen as a marker band to probe the degree of hydrogen bonding. Polarized Raman spectra in the region 970–1020 cm⁻¹ for binary mixtures of (pyrimidine + methanol) at 28 different mole fractions were recorded. A Raman line shape analysis of the isotropic Raman line profiles at all concentrations revealed three distinct spectral components at mole fractions of Pd below 0.75. The three components are attributed to three distinct groups of species: ‘free Pd’ (pd), ‘Pd with low methanol content’ (pd1) and ‘Pd with high‐methanol content’ (pd2). The two latter species differ considerably in the pattern and the strengths of the hydrogen bonds. The results of density functional theory calculations on structures and vibrational spectra of neat Pd and eight Pd/M complexes with varying methanol content support our interpretations of the experimental results. A nice spectra–structure correlation for the different cluster subgroups was obtained, similar to earlier results obtained for Pd and water. Apart from N···H and O···H hydrogen bonds between pyrimidine and methanol, O···H hydrogen bonds formed among the methanol molecules in the cluster at high methanol content also play a crucial role in the interpretation of the experimental results. Copyright © 2010 John Wiley & Sons, Ltd.     

Fullerene–ferrocene dyad linked by rigid bilinkage: synthesis,photophysical properties and application as copper ion sensor

A novel fullerene–ferrocene based donor–bridge–acceptor dyad was synthesized and characterized by elemental analysis, FT‐IR, ¹H NMR, ¹³C NMR and FAB‐MS. The dyad with a bilinker comprising of azomethine and ester group was studied for its photo physical properties using absorption spectra and steady‐state fluorescence spectra as a function of dielectric constant of the medium. Fluorescence spectra of the dyad studied with excitation at 449 nm showed a weak emission at 742 nm, which got weaker on increasing the dielectric constant of the medium, indicating efficient electron transfer from ferrocene to fullerene. By designing a bilinked structure between the two redox moieties, we obtained a chelating structure which was found to coordinate copper ion efficiently and hence found application as a metal ion sensor. Copyright © 2008 John Wiley & Sons, Ltd.     

Structural Assignment of Isomeric S‐ and S,N‐1‐Alkoxycarbonylalkylated 6‐Amino‐2‐thiouracil Derivatives by Means of 1H and 13C NMR Spectroscopy

Abstract

The structures of new isomeric 2‐alkoxycarbonylalkylthio‐ and 2‐alkoxy‐ carbonylalkylthio‐1‐alkoxycarbonylalkyl‐6‐aminouracils (1–21) have been established on the basis of the ¹H NMR and ¹³C NMR spectroscopic data. The ¹H NMR and ¹³C NMR spectra of 1–21 have been fully assigned by a combination of two‐dimensional experiments [heteronuclear multiple quantum coherence (HMQC) and heteronuclear multiple bond correlation (HMBC)]. The ¹³C NMR spectra have been shown to be able to differentiate between isomers.     

Spectrophotometric and 27‐Al NMR Characterization of Aluminum(III) Complexes with l‐Histidine

Abstract

The complex formation between l‐histidine (HHis) and aluminum(III) ion in water solutions was studied by UV spectrophotometric and 27‐Al NMR measurements at 298 K. UV spectra were measured on solutions in which the total concentration of histidine was from 15.0 to 50.0 mmol/dm³ and the concentration ratio of histidine to aluminum was varied from 3∶1 to 10∶1 in the pH range between 4.2 and 6.0. The spectra were taken in the wavelength interval 240–340 nm. Nonlinear least‐squares treatment of the spectrophotometric data indicates the formation of the complexes Al(HHis)³⁺, Al(His)²⁺, Al(HHis)His²⁺, and Al₂(OH)His⁴⁺ with the overall formation constants β_p,q,r: log β_1,1,1=11.90±0.04, log β_1,1,0=7.25±0.08, log β_1,2,1=20.1±0.1, and log β_2,1,1=5.92±0.12 (p, q, r are stoichiometric indices for metal, ligand, and proton, respectively). ²⁷Al‐NMR spectra were taken on solutions with the concentration of aluminum 50 mmol/dm³ and that of histidine 250 mmol/dm³. In the pH interval 5.0–6.1, two resonances at 9.5 ppm and 12.0 ppm were assigned to Al(HHis)²⁺ and Al(HHis)(His)²⁺ (or Al(OH)(HHis)₂ ²⁺), respectively.     

N‐Methylbenzoazacrown ethers with the nitrogen atom conjugated with the benzene ring: the improved synthesis and the reasons for the high stability of complexes with metal and ammonium cations

An improved method for the synthesis of formyl derivatives of N‐methylbenzoazacrown ethers is proposed. They are prepared in up to 68% yields over fewer steps and with a much shorter time required for the last step. The stability constants of complexes formed by N‐methylbenzoazacrown ethers and their structural analogs with alkali metal, alkaline‐earth metal and ammonium cations were determined by ¹H NMR titration in CD₃CN. High stability of complexes of N‐methyl derivatives of benzoazacrown ethers is demonstrated, comparable with or even exceeding the stability of benzocrown‐ether complexes and markedly exceeding the stability of complexes of phenylazacrown ethers with the same macrocycle size. The structures of azacrown ethers and their complexes with Ba(ClO₄)₂ were studied by X‐ray diffraction. A high degree of pre‐organization of N‐methylbenzoazacrown ethers toward the formation of complexes with metal and ammonium cations was noted, which is due to the clear‐cut pyramidal geometry of the nitrogen atom and the orientation of the lone electron pairs (LEPs) of most heteroatoms towards the centre of the macroheterocycle. Copyright © 2009 John Wiley & Sons, Ltd.     

Influence of dietary fibre on gluten proteins structure – a study on model flour with application of FT‐Raman spectroscopy

Dietary fibres are regarded as the source of polysaccharides and antioxidants such as polyphenols. However, addition of dietary fibre to bread causes significant reduction in its quality. The bread quality is connected with the structure of gluten proteins. For this reason, Fourier transform Raman spectroscopy was applied to determine changes in structure of gluten proteins modified by seven dietary fibres. The fibres were added to model flour reconstituted with wheat gluten and wheat starch. The model flour was used to provide gluten proteins of definite structure. The obtained results showed that six out of seven fibres caused similar changes in β‐turn structures. The appearance of the band at 1642 cm⁻¹ and the shift toward lower wavenumbers of the band at 1670 cm⁻¹ in the difference spectra indicated hydrogen bonding of carbonyl groups in β‐turns leading to protein folding/aggregation. Addition of fibre preparations caused also changes in conformation of disulfide bridges (S–S), corresponding to transformation to trans‐gauche‐gauche and trans‐gauche‐trans conformations at the expense of the stable gauche‐gauche‐gauche conformation. The S–S bonds in less stable conformations were formed inside the protein complex as well as between protein complexes in the form of β‐structures. Generally, the observed changes in gluten proteins after addition of dietary fibres were results of interactions between fibre polysaccharides and gluten proteins rather than between polyphenols and gluten proteins. Copyright © 2015 John Wiley & Sons, Ltd.     

Effect of irradiation on ethyl 2‐amino‐4,5,6,7‐tetrahydrobenzo[b]thiophene‐3‐carboxylate: an ESR study

Ethyl 2‐amino‐4,5,6,7‐tetrahydrobenzo[b]thiophene‐3‐carboxylate [C₁₁H₁₅NO₂S] was synthesized by the Gewald method. Its single crystals were grown from an alcohol/ethyl acetate solution at 15 °C and characterized using IR and ¹H‐NMR. These single crystals were irradiated for 72 h at 298 K by a ⁶⁰Co gamma source with a dose speed of 0.864 kGy/h. After irradiation, electron spin resonance (ESR) measurements were carried out to study radiation‐induced radicals in the temperature range from 120 to 450 K. Additionally, for the single crystal, ESR angular dependencies were measured in the xy, xz and yz planes of the substance. This irradiated single crystal was analyzed based on the ESR spectra. Analysis of the spectra revealed that the radical was formed by a C–H bond fission at the carbon end of the substance. It was also observed that the color of the sample changed after irradiation. The hyperfine and g parameters were determined from the experimental spectra. It was inferred from these results that the hyperfine parameters and g value exhibited anisotropic behavior. The average values of these parameters were calculated as follows: g = 2.0088, A_H1=H2 = 20.70 G, A_H3=H4 = 10.80 G, A_Ha = 4.59 G, A_Hb = 3.24 G and, A_N = 6.10 G. Copyright © 2011 John Wiley & Sons, Ltd.     

High‐pressure Raman spectroscopic and other structural studies of hydrotalcites containing intercalated dicarboxylic acid anions

The results of pressure‐tuning Raman spectroscopic, X‐ray powder diffraction and solid‐state ¹³C‐NMR studies of selected dicarboxylate anions intercalated in a Mg–Al layered double hydroxide lattice are reported. The pressure dependences of the vibrational modes are linear for pressures up to 4.6 GPa, indicating that no phase transitions occur. The interlayer spacings show that the oxalate, malonate and succinate dianions are oriented perpendicular to the layers, but the glutarate and adipate are tilted. The solid‐state ¹³C‐NMR spectra of these materials show full chemical shift anisotropy and, therefore, the anions are not mobile at room temperature. Copyright © 2011 John Wiley & Sons, Ltd.