Analysis of G‐quadruplex conformations using Raman and polarized Raman spectroscopy

G‐quadruplexes (G4s) are four‐stranded DNA structures formed within nucleic acid sequences that are rich in guanines. G4 formation within DNA strands is believed to have significant biological relevance for the control of cell replication and gene expression. Therefore, the development and validation of experimental techniques that can easily and reliably characterize G4 structures under biologically relevant measurement conditions, like Raman spectroscopy, are desirable for G4‐targeted structure based drug design. Here we report Raman and polarized Raman studies of solutions of three oligonucleotides, thrombin binding aptamer (TBA) 5′‐GGTTGGTGTGGTTGG‐3′, human telomeric (HT) 5′‐(TTAGGG)₄‐3′, and a modified c‐Myc NHE‐III₁ sequence (MycL1) 5′‐TGAGGGTGGGTAGGGTGGGTAA‐3′, which were previously reported to form four distinct intramolecular G4 structures in the presence of Na⁺ or K⁺, as determined by NMR. Our results support the previously proposed antiparallel (TBA), antiparallel and hybrid (HT), and parallel with double‐chain reversal (DCR) loop (MycL1) structures. Large sample‐dependent variations in the intensity of bands associated with deoxyribose backbone modes in the 840–930 cm⁻¹ and 1420–1460 cm⁻¹ spectral regions were observed. Most notably, a highly polarized deoxyribose ring symmetric stretch (~930 cm⁻¹) appeared strongly in the solution spectra for HT and TBA, but was very weak or absent in the solution spectrum for MycL1 and the drop deposition (dried sample) spectra for all three oligonucleotides. It is hypothesized that the intensity of this band is likely controlled by furanose ring structure uniformity and/or solvent accessibility to certain nucleotide binding sites. Raman depolarization ratios measured for the G4s in solution were generally very similar to those previously reported for canonical B DNA, with the possible exception of base ring modes that consistently yielded slightly lower depolarization ratios for G4s compared to B DNA. The results further underscore the utility of Raman and polarized Raman spectroscopy for G4 structure elucidation under biologically relevant solution conditions. Copyright © 2015 John Wiley & Sons, Ltd.     

Understanding tip‐enhanced Raman spectra of biological molecules: a combined Raman,SERS and TERS study

Although conventional Raman, surface‐enhanced Raman (SERS) and tip‐enhanced Raman spectroscopy (TERS) have been known for a long time, a direct, thorough comparison of these three methods has never been carried out. In this paper, spectra that were obtained by conventional Raman, SERS (on gold and silver substrates) and TERS (in ‘gap mode’ with silver tips and gold substrates) are compared to learn from their differences and similarities. Because the investigation of biological samples by TERS has recently become a hot topic, this work focuses on biologically relevant substances. Starting from the TER spectra of bovine serum albumin as an example for a protein, the dipeptides Phe–Phe and Tyr–Tyr and the tripeptide Tyr–Tyr–Tyr were investigated. The major findings were as follows. (1) We show that the widely used assumption that spectral bands do not shift when comparing SER, TER and conventional Raman spectra (except due to binding to the metal surface in SERS or TERS) is valid. However, band intensity ratios can differ significantly between these three methods. (2) Marker bands can be assigned, which should allow one to identify and localize proteins in complex biological environments in future investigations. From our results, general guidelines for the interpretation of TER spectra are proposed. Copyright © 2012 John Wiley & Sons, Ltd.     

FT‐IR,FT‐Raman and SERS spectra of anilinium sulfate

The FT‐IR and FT‐Raman spectra of anilinium sulfate were recorded and analyzed. The surface‐enhanced Raman scattering (SERS) was recorded from a silver electrode. The vibrational wavenumbers of the compound have been computed using the Hartree‐Fock/6‐31G* basis and compared with the experimental values. The molecule is adsorbed on the silver surface with the benzene ring in a tilted orientation. The presence of amino and sulfate group vibrations in the SERS spectrum reveal the interaction between amino and sulfate groups with the silver surface. The direction of the charge transfer contribution to SERS has been discussed from the frontier orbital theory. Copyright © 2009 John Wiley & Sons, Ltd.     

Surface‐enhanced Raman scattering and DFT calculations studies of 3,3′‐diethylthiatri‐ carbocyanine iodide

As an infrared Raman probe, the molecule 3,3′‐diethylthiatricarbocyanine iodide (DTTC) has received much attention in the past decades due to its potential applications in Raman imaging, single‐cell detection, cancer diagnosis, and surface‐enhanced Raman scattering (SERS). In this work, ordinary Raman, SERS, and theoretical Raman spectra were investigated to estimate the DTTC suspension. More specifically, the original gold nanospheres (60 nm diameter) and gold nanorods were encoded with DTTC and stabilized with a layer of thiol–polyethylene glycol as Raman reporter; SERS data were also obtained from the samples. Hartree–Fock theory and density functional theory (DFT) calculation were applied to calculate the optimized Raman spectra of DTTC in water on the B3LYP/6‐31G level. Subsequently, the obtained experimental spectra from DTTC were carefully compared with the theoretically calculated spectra, and good agreement was obtained between the theoretical and experimental results.The bands between 500 and 3100 cm⁻¹ in the ordinary Raman and SERS spectra were assigned as well. This work will facilitate the development of ultrasensitive SERS probes for advanced biomedical imaging applications. Copyright © 2011 John Wiley & Sons, Ltd.     

Raman and surface‐enhanced Raman spectra of flavone and several hydroxy derivatives

The Raman and surface‐enhanced Raman spectra (SERS) of flavone and three of its hydroxy derivatives, 3‐hydroxyflavone (3‐HF) and 5‐hydroxyflavone (5‐HF) and quercetin (3,5,7,3′,4′ pentahydroxyflavone) have been obtained. The normal Raman (NR) spectra were taken in the powder form. The SERS spectra were obtained both on Ag colloids and Ag electrode substrates. Assignments of the spectrally observed normal modes were aided by density functional theory (DFT) calculations using the B3LYP functional and the 6‐31 + G* basis, a split valence polarized basis set with diffuse functions. Excellent fits were obtained for the observed spectra with little or no scaling. The most intense lines of the NR spectra are those in the CO stretching region (near 1600 cm⁻¹). These lines are often weakened by proximity to the surface, while other lines at lower wavenumbers, due to in‐plane ring stretches, tend to be strongly enhanced. The SERS spectrum of flavone is weak both on the colloid and on the electrode, indicating weak attachment to the surface. In contrast, the SERS spectra of the hydroxy derivatives of flavone are intense, indicating the assistance of OH groups in attachment to the surface. The spectra of the various species are compared, and a case study of application to detection of a textile dye (Persian berries), which contains quercetin, is presented. Copyright © 2007 John Wiley & Sons, Ltd.     

IR,Raman and SERS spectra of ethyl salicylate

The IR and Raman spectra of ethyl salicylate were recorded and analyzed. The surface enhanced Raman scattering (SERS) spectrum was recorded in a silver colloid. The vibrational wavenumbers of the compound have been computed using the Hartree‐Fock/6‐31G* basis. The direction of charge transfer contribution to SERS has been discussed from the frontier orbital theory. The presence of methyl modes in the SERS spectrum indicates the nearness of the methyl group to the metal surface and the presence of ring vibrations and out‐of‐plane ring modes in the SERS spectrum suggests a flat orientation of the molecule on the silver surface. The first hyperpolarizability is calculated and the calculated molecular geometry has been compared with the reported similar structures. Copyright © 2009 John Wiley & Sons, Ltd.     

Vibrational spectroscopic studies and computational study of methyl(2‐methyl‐4,6–dinitrophenylsulfanyl)ethanoate

FT‐IR and FT‐Raman spectra of methyl(2‐methyl‐4,6–dinitrophenylsulfanyl)ethanoate (MDIE) were recorded and analyzed. Surface‐enhanced Raman scattering (SERS) spectra were recorded in silver colloid and silver electrode. The vibrational wavenumbers were computed using HF/6‐31G* and B3LYP/6‐31G* basis. The data obtained from vibrational wavenumber calculations are used to assign vibrational bands obtained in infrared and Raman spectroscopies as well as in SERS of the studied molecule. The first hyperpolarizability and infrared intensities are reported. The geometrical parameters of the title compound are in agreement with the reported similar derivatives. The presence of new bands at 1045 and 948 cm⁻¹ in the SERS spectrum in silver electrode is related to the change in orientation of the molecule with respect to the metal surface. In silver colloid SERS spectrum, the methyl group attached to the methoxy carbonyl group is close to the metal surface, whereas on silver electrode the methyl group attached to the phenyl ring is close to the metal surface. Copyright © 2009 John Wiley & Sons, Ltd.     

pH‐sensing nanostar probe using surface‐enhanced Raman scattering (SERS): theoretical and experimental studies

Local pH environment has been considered to be a potential biomarker for tumor diagnosis because solid tumors contain highly acidic environments. A pH‐sensing nanoprobe based on surface‐enhanced Raman scattering (SERS) using nanostars under near‐infrared excitation has been developed for potential biomedical applications. To theoretically investigate the effect of protonation state on SERS spectra of p‐mercaptobenzoic acid (pMBA), we used the density functional theory (DFT) with the B3LYP functional to calculate Raman vibrational spectra of pMBA‐Au/Ag complex in both protonated and deprotonated states. Vibrational spectral bands were assigned with DFT calculation and used to investigate SERS spectral changes observed from experiment when varying pH value between five and nine. The SERS peak position of pMBA at ~1580 cm⁻¹ was identified to be a novel pH‐sensing index, which has small but noticeable downshift with pH increase. This phenomenon is confirmed and well‐explained with theoretical simulation. The study demonstrates that SERS is a sensitive tool to monitor minor structural changes due to local pH environment, and DFT calculations can be used to investigate Raman spectra changes associated with minor differences in molecular structure. Copyright © 2013 John Wiley & Sons, Ltd.     

FT‐IR,FT‐Raman,SERS spectra and computational calculations of 4‐ethyl‐N‐(2′‐hydroxy‐5′‐nitrophenyl)benzamide

Fourier transform infrared (FT‐IR) and FT‐Raman spectra of 4‐ethyl‐N‐(2′‐hydroxy‐5′‐nitrophenyl)benzamide were recorded and analyzed. A surface‐enhanced Raman scattering (SERS) spectrum was recorded in silver colloid. The vibrational wavenumbers and corresponding vibrational assignments were examined theoretically using the Gaussian03 set of quantum chemistry codes. The red shift of the NH stretching wavenumber in the infrared spectrum from the computational wavenumber indicates the weakening of the NH bond resulting in proton transfer to the neighboring oxygen atom. The simultaneous IR and Raman activation of the CO stretching mode gives the charge transfer interaction through a π‐conjugated path. The presence of methyl modes in the SERS spectrum indicates the nearness of the methyl group to the metal surface, which affects the orientation and metal molecule interaction. The first hyperpolarizability and predicted infrared intensities are reported. The calculated first hyperpolarizability is comparable with the reported values of similar derivatives and is an attractive subject for future studies of nonlinear optics. Optimized geometrical parameters of the title compound are in agreement with reported structures. Copyright © 2009 John Wiley & Sons, Ltd.     

IR,Raman and SERS spectra of 3,5‐dinitrosalicylic acid

IR, Raman and surface enhanced Raman scattering (SERS) spectra of 3,5‐dinitrosalicylic acid (DNSA) were recorded and analysed. The vibrational wavenumbers were computed by the ab initio method using RHF/6–21G* basis and they were found to be in good agreement with the experimental values. The effect of the concentration dependence on the SERS intensity of the molecule was studied. The molecular plane assumes a tilted orientation with respect to the silver surface. Copyright © 2006 John Wiley & Sons, Ltd.     

Surface‐enhanced Raman spectra of dimethoate and omethoate

Surface‐enhanced Raman scattering (SERS) spectra are presented and analyzed for two important organophosphate pesticides, dimethoate (DMT) and omethoate (OMT). Very detailed SERS spectra were obtained by aggregated Ag hydrosols, both in aqueous suspension and dried on a glass substrate. The SERS and ordinary Raman spectra of DMT do not resemble each other, suggesting that a chemical reaction immediately occurs when DMT is adsorbed onto the metal surface. We propose that the reaction product is OMT, which is the oxygen analog of DMT, on the basis of the Raman and SERS spectra of OMT. Further support is derived from the calculated Raman spectra of DMT and OMT. Minor wavenumber and intensity differences that are observed between the SERS spectra of DMT reaction product and those of OMT could be related to different metal/adsorbate interaction modes. The results can be useful in the development of new analytical methods for the determination of pesticide residues in food. Copyright © 2010 John Wiley & Sons, Ltd.     

Surface‐enhanced Raman scattering of molecules adsorbed on Co‐doped ZnO nanoparticles

Transition‐metal‐doped semiconductor nanoparticles (NPs) have been well studied for their optical and catalytic properties but seldom studied by surface‐enhanced Raman scattering (SERS). In this paper, transition‐metal‐doped semiconductor NPs are investigated for their SERS property. Four groups of Co‐doped (0.5, 1, 3, and 5%) ZnO (Co ZnO) NPs and pure ZnO NPs were synthesized and studied. When 4‐mercaptobenzoic acid was used as probing molecule, significant SERS signals were obtained on all the five samples. Moreover, it is very interesting to observe a relationship between the Co‐doping concentration and enhancement of the SERS signals. SERS intensities first increase with doping concentration (up to 1%), and then decrease with further increase in doping concentration (up to 5%). Charge transfer (CT) is considered to be the main contribution to this phenomenon. Different CT ratios from substrates to molecules seem to induce different intensities of the SERS signals. In our experiments, the crystalline defects of Co ZnO NPs caused by the Co dopant affect the CT ratios. A possible mechanism of CT from the valance band of Co ZnO NPs to the lower unoccupied molecular orbital of the molecules via energy of the surface states is suggested. X‐ray photoelectron spectra, UV vis spectra, and Raman spectra were used to characterize the structure and defects in Co ZnO NPs. Copyright © 2011 John Wiley & Sons, Ltd.     

Surface‐enhanced Raman scattering of protoberberine alkaloids

Quaternary protoberberine alkaloids are a class of natural dyes characterized by bright colors ranging from yellow to orange. As they present a strong fluorescence emission, their analysis by Raman spectroscopy is limited to specific techniques such as Fourier transform (FT)‐Raman and spectral shift Raman techniques such as shifted subtracted Raman difference spectroscopy (SSRDS) and shifted excitation Raman difference spectroscopy (SERDS). In a previous article, we successfully used surface‐enhanced Raman scattering (SERS) in the analysis of the alkaloid dye berberine in an ancient textile. The examination of the Raman and SERS spectra of berberine in combination with density functional theory (DFT) calculations indicated a flat adsorption geometry of the molecule on the Ag surface. In this article we extend that work to the study of related protoberberine alkaloids, palmatine, jatrorrhizine, and coptisine. The same adsorption geometry as in berberine was deduced. We found that the four alkaloids, although minimally different in their chemical structures, could be differentiated by the position of marker bands. Those bands are the most enhanced ones in the SERS spectra, which appear in the 700–800 cm⁻¹ region. Copyright © 2008 John Wiley & Sons, Ltd.     

Raman,infrared, SERS and theoretical study of 3‐(1‐phenylpropan‐2‐ylamino) propanenitrile,fenproporex

Infrared, Raman and surface‐enhanced Raman scattering (SERS) spectra of 3‐(1‐phenylpropan‐2‐ylamino)propanenitrile (fenproporex) have been recorded. Density functional theory (DFT) with the B3LYP functional was used for optimizations of ground state geometries and simulation of Raman and SERS vibrational spectra of this molecule. Bands of the vibrational spectra were assigned in detail. The comparison of SERS spectra obtained by using colloidal silver and gold nanoparticles with the corresponding Raman spectrum reveals enhancement and shifts in bands, suggesting a possible partial charge‐transfer mechanism in the SERS effect. Information about the orientation of fenproporex on the nanometer‐sized metal structures is also obtained. Copyright © 2011 John Wiley & Sons, Ltd.     

Biocompatible gold/silver nanostars for surface‐enhanced Raman scattering

Raman‐enhancing properties of chitosan (CS)‐coated gold/silver nanostars (Au/AgNSs) were demonstrated by using them as a surface‐enhanced Raman scattering (SERS) probe. Based on the energy‐dispersive X‐ray spectroscopy element distribution maps and highly enhanced SERS spectra, we suggest that the incorporation of silver into the NS tips leads to a stronger SERS behavior. The SERS spectra of the proteins adsorbed on the NS surface greatly differ from their respective Raman spectra in both the band positions and relative intensities, indicating that the protein molecules penetrate through the CS coating layer and interact closely with the NS surface. Raman and SERS spectra of Chlamydia trachomatis protease/proteasomelike activity factor are reported for the first time, demonstrating the potential of these NSs for the development of a diagnosis method for Chlamydia based on SERS. The results showed a good SERS performance of the Au/AgNSs and their potential for SERS detection of biomolecules. Copyright © 2016 John Wiley & Sons, Ltd.     

Characterization of 6‐propylthiouracil and its interaction with human serum albumin on Au surface by surface‐enhanced Raman scattering

In this study, surface‐enhanced Raman scattering (SERS) spectra of 6‐propylthiouracil (6‐PTU) on Au surface and the interaction between 6‐PTU and human serum albumin (HSA) were studied. The Raman bands were assigned by the density functional theory calculations at the B3LYP/6‐311++g(d,p) level. Furthermore, the effects of concentration on the SERS spectra of 6‐PTU were analyzed. It shows that with the changes of the concentrations of 6‐PTU, the SERS spectra of 6‐PTU present significant changes, and it can be concluded that with the changing of concentrations, the orientation of 6‐PTU on Au surface also changes. In addition, the SERS spectra of the interaction between 6‐PTU and HSA show that the binding sites of 6‐PTU to HSA are the functional groups N3H and CO. The information will not only be references to the study of the mechanism of the interaction between drugs and blood plasma or serum albumin but also a guidance to understand the metabolism of drugs in human body. Copyright © 2015 John Wiley & Sons, Ltd.     

Single‐molecule surface‐enhanced Raman scattering of fullerene C60

We achieved single‐molecule surface‐enhanced Raman scattering (SM‐SERS) spectra from ultralow concentrations (10⁻¹⁵ M) of fullerene C₆₀ on uniformly assembled Au nanoparticles. It was found that resonant excitation at 785 nm is a powerful tool to probe SM‐SERS in this system. The appearance of additional bands and splitting of some vibrational modes were observed because of the symmetry reduction of the adsorbed molecule and a relaxation in the surface selection rules. Time‐evolved spectral fluctuation and ‘hot spot’ dependence in the SM‐SERS spectra were demonstrated to result from the single‐molecule Raman behavior of the spherical C₆₀ on Au nanoparticles. Copyright © 2010 John Wiley & Sons, Ltd.     

Tip‐enhanced Raman spectroscopy – an interlaboratory reproducibility and comparison study

Since its first experimental realization, tip‐enhanced Raman spectroscopy (TERS) has emerged as a potentially powerful nanochemical analysis tool. However, questions about the comparability and reproducibility of TERS data have emerged. This interlaboratory comparison study addresses these issues by bringing together different TERS groups to perform TERS measurements on nominally identical samples. Based on the spectra obtained, the absolute and relative peak positions, number of bands, peak intensity ratios, and comparability to reference Raman and surface‐enhanced Raman spectroscopy (SERS) data are discussed. Our general findings are that all research groups obtained similar spectral patterns, irrespective of the setup or tip that was used. The TERS (and SERS) spectra consistently showed fewer bands than the conventional Raman spectrum. When comparing these three methods, the spectral pattern match and substance identification is readily possible. Absolute and relative peak positions of the three major signals of thiophenol scattered by 19 and 9 cm⁻¹, respectively, which can probably be attributed to different spectrometer calibrations. However, within the same group (but between different tips), the signals only scattered by 3 cm⁻¹ on average. This study demonstrated the suitability of TERS as an analytical tool and brings TERS a big step forward to becoming a routine technique. Copyright © 2014 John Wiley & Sons, Ltd.     

pH‐dependent surface‐enhanced Raman scattering observation of sulfanilamide on the silver surface

Monolayers of sulfanilamide on metallic surface can serve as an ideal model for understanding the interaction mechanism between the metal and the sulfanilamide molecule. In the present paper, the surface‐enhanced Raman scattering (SERS) technique was employed to obtain the SERS spectra of sulfanilamide monolayers formed on the silver surface under different pH values. Assignments of the spectra were carried out with the aid of density functional theory (DFT) calculations (BLYP/6‐311G). It can be found that the adsorption function of sulfanilamide on the silver surface was influenced by the pH value. The fully protonated sulfanilamide molecule adsorbed on the silver surface through N¹³H₂ group and the benzene ring anchored in a relatively perpendicular manner leading to N⁷H₂ and S¹⁰O₂ groups near the surface, while the completely deprotonated sulfanilamide molecule attached on the silver surface via N⁷H₂ and the benzene ring was perpendicular to, and the N¹³H₂ and S¹⁰O₂ groups were far from the silver surface. Copyright © 2009 John Wiley & Sons, Ltd.