Screening of threading bis-intercalators binding to duplex DNA by electrospray ionization tandem mass spectrometry

The DNA binding of novel threading bis-intercalators V1, trans-D1, and cis-C1, which contain two naphthalene diimide (NDI) intercalation units connected by a scaffold, was evaluated using electrospray ionization mass spectrometry (ESI-MS) and DNAse footprinting techniques. ESI-MS experiments confirmed that V1, the ligand containing the -Gly3-Lys- peptide scaffold, binds to a DNA duplex containing the 5'-GGTACC-3' specific binding site identified in previous NMR-based studies. The ligand formed complexes with a ligand/DNA binding stoichiometry of 1:1, even when there was excess ligand in solution. Trans-D1 and cis-C1 are new ligands containing a rigid spiro-tricyclic scaffold in the trans- and cis- orientations, respectively. Preliminary DNAse footprinting experiments identified possible specific binding sites of 5'-CAGTGA-5' for trans-D1 and 5'-GGTACC-3' for cis-C1. ESI-MS experiments revealed that both ligands bound to DNA duplexes containing the respective specific binding sequences, with cis-C1 exhibiting the most extensive binding based on a higher fraction of bound DNA value. Cis-C1 formed complexes with a dominant 1:1 binding stoichiometry, whereas trans-D1 was able to form 2:1 complexes at ligand/DNA molar ratios >or=1 which is suggestive of nonspecific binding. Collisional activated dissociation (CAD) experiments indicate that DNA complexes containing V1, trans-D1, and cis-C1 have a unique fragmentation pathway, which was also observed for complexes containing the commercially available bis-intercalator echinomycin, as a result of similar binding interactions, marked by intercalation in addition to hydrogen bonding by the scaffold with the DNA major or minor groove.     

Solution structure of a peptide nucleic acid duplex from NMR data: features and limitations

This paper describes the results of a 1D and 2D NMR spectroscopy study of a palindromic 8-base pair PNA duplex GGCATGCC in H2O and H2O-D2O solutions. The (1)H NMR peaks have been assigned for most of the protons of the six central base pairs, as well as for several amide protons of the backbone. The resulting 36 interbase and base-backbone distance restraints were used together with Watson-Crick restraints to generate the PNA duplex structure in the course of 10 independent simulated annealing runs followed by restrained molecular dynamics (MD) simulations in explicit water. The resulting PNA structures correspond to a P-type helix with helical parameters close to those observed in the crystal structures of PNA. Based on the current limited number of restraints obtained from NMR spectra, alternative structures obtained by MD from starting PNA models based on DNA cannot be ruled out and are also discussed.     

Discrimination of A/T sequences in the minor groove of DNA within a cyclic polyamide motif

Eight-ring cyclic polyamides containing pyrrole (Py), imidazole (Im), and hydroxypyrrole (Hp) aromatic amino acids recognize predetermined six base pair sites in the minor groove of DNA. Two four-ring polyamide subunits linked by (R)-2,4-diaminobutyric acid [(R)H2Ngamma] residue form hairpin polyamide structures with enhanced DNA binding properties. In hairpin polyamides, substitution of Hp/Py for Py/Py pairs enhances selectivity for T. A base pairs but compromises binding affinity for specific sequences. In an effort to enhance the binding properties of polyamides containing Hp/Py pairings, four eight ring cyclic polyamides were synthesized and analyzed on a DNA restriction fragment containing three 6-bp sites 5'-tAGNNCTt-3', where NN = AA, TA, or AT. Quantitative footprint titration experiments demonstrate that contiguous placement of Hp/Py pairs in cyclo-(gamma-ImPyPyPy-(R)H2Ngamma-ImHpHpPy-) (1) provides a 20-fold increase in affinity for the 5'-tAGAACTt-3' site (Ka = 7.5 x 10(7)M(-1)) relative to ImPyPyPy-(R)H2Ngamma-ImHpHpPy-C3-OH (2). A cyclic polyamide of sequence composition cyclo-(gamma-ImHpPyPy-(R)H2Ngamma-ImHpPyPy-) (3) binds a 5'-tAGTACTt-3' site with an equilibrium association constant KA= 3.2 x 10(9)M(-1), representing a fivefold increase relative to the hairpin analogue ImHpPyPy-(R)H2Ngamma-ImHpPyPy-C3-OH (4). Arrangement of Hp/Py pairs in a 3'-stagger regulates specificity of cyclo-(gamma-ImPyHpPy-(R)H2Ngamma-ImPyHpPy-) (5) for the 5'-tAGATCTt-3' site (Ka = 7.5 x 10(7)M(-1)) threefold increase in affinity relative to the hairpin analogue ImPyHpPy-(R)H2Ngamma-ImPyHpPy-C3-OH (6), respectively. This study identifies cyclic polyamides as a viable motif for restoring recognition properties of polyamides containing Hp/Py pairs.     

Evaluation of alkaloids binding to the parallel quadruplex structure [d(TGGGGT)]4 by electrospray ionization mass spectrometry

In this study, electrospray ionization mass spectrometry (ESI‐MS) was used to investigate the binding interaction of six alkaloids with parallel intermolecular G‐quadruplex [d(TGGGGT)]₄, and five alkaloids including berberine, jatrorrhizine, palmatine, tetrandrine, and fangchinoline showed complexation with the target DNA. Relative binding affinities were estimated on the basis of mass spectrometric data. The slight differences in chemical structures of berberine, jatrorrhizine, and palmatine had little influence on their binding affinities to [d(TGGGGT)]₄. Tetrandrine and fangchinoline selectively bound to [d(TGGGGT)]₄ versus duplex DNA. Collision‐induced dissociation (CID) experiments showed that the complexes with berberine, jatrorrhizine, and palmatine dissociated via strand separation and ligand retaining in the strand while the complexes with tetrandrine and fangchinoline were dissociated via ligand elimination. A comparison of dissociation patterns in CID experiments of complexes with the alkaloids to those with the traditional G‐quadruplex DNA binders suggested an end‐stacking binding mode for tetrandrine and fangchinoline and an intercalation binding mode for berberine, jatrorrhizine, and palmatine to the target DNA. The current work not only provides deep insight into alkaloid/[d(TGGGGT)]₄ complexes and useful guidelines for design of efficient anticancer agents but also demonstrates the utility of ESI‐MS as a powerful tool for evaluating interaction between ligand and quadruplex DNA. Copyright © 2012 John Wiley & Sons, Ltd.     

Mixed ligand cobalt(II) picolinate complexes: synthesis, characterization, DNA binding and photocleavage

Complexes of the type [Co(pic)(2)(NN)], where pic = picolinate, NN = dipyrido[3,2-d:2',3'-f]quinoxaline (dpq) (4) and 4b,5,7,7a-tetrahydro-4b,7a-epiminomethanoimino-6H-imidazo[4,5-f][1,10]-phenanthroline-6,13-dione (bipyridyl-glycoluril) (bpg) (6) have been synthesized and characterized by elemental analysis, IR, UV-vis, NMR and ESI-MS spectroscopy and thermogravimetic analysis (TGA). Their physicochemical properties are compared with previously synthesized complexes, where NN = (H(2)O)(2) (1), 2,2'-bipyridine (bpy) (2), 1,10-phenanthroline (phen) (3) and dipyrido[3,2-a:2',3'-c]phenazine (dppz) (5). The crystal structures of the complexes 4-6 were solved by single-crystal X-ray diffraction. The complexes 4 and 5 crystallize from a mixture of chloroform and methanol in monoclinic and orthorhombic crystal systems, respectively, whereas complex 6 crystallizes from dimethyl sulfoxide (DMSO) in a tetragonal crystal system. The coordination sphere consists of two oxygen atoms and two nitrogen atoms from the two picolinates and two nitrogen atoms from the dpq, dppz or bpg ligand, respectively. Co(ii)/Co(iii) oxidation potentials have been determined by cyclic voltammetry. The DNA binding of complexes 1-5 has been investigated using thermal melting, fluorescence quenching and viscosity measurements, which indicate the partial intercalation of complex 5 with an apparent binding constant (k(app)) of 8.3 × 10(5) M(-1). DNA cleavage studies of complexes 1-5 have been investigated using gel electrophoresis in the presence of H(2)O(2) as an oxidizing agent and also by photoirradiation at 365 nm. The mechanistic investigations suggest that singlet oxygen ((1)O(2)) is the major species involved in the DNA cleavage by these complexes. The structures of complexes 2-6 were optimized with density functional theory (DFT) method (B3LYP/6-31G(d,p)). The low vertical ionization potential values indicate photoredox pathways for the DNA cleavage activity by complexes 4 and 5, which is corroborated by DNA cleavage experiments.     

The Binding Pocket at the Interface of Multimeric Telomere G-quadruplexes: Myth or Reality?

Human telomeric DNA with hundreds of repeats of the 5’-TTAGGG-3’ motif plays a crucial role in several biological processes. It folds into G-quadruplex (G4) structures and features a pocket at the interface of two contiguous G4 blocks. Up to now no structural NMR and crystallographic data are available for ligands interacting with contiguous G4s. Naphthalene diimide monomers and dyads were investigated as ligands of a dimeric G4 of human telomeric DNA comparing the results with those of the model monomeric G4. Time-resolved fluorescence, circular dichroism, isothermal titration calorimetry and molecular modeling were used to elucidate binding features. Ligand fluorescence lifetime and induced circular dichroism unveiled occupancy of the binding site at the interface. Thermodynamic parameters confirmed the hypothesis as they remarkably change for the dyad complexes of the monomeric and dimeric telomeric G4. The bi-functional ligand structure of the dyads is a fundamental requisite for binding at the G4 interface as only the dyads engage in complexes with 1 : 1 stoichiometry, lodging in the pocket at the interface and establishing multiple interactions with the DNA skeleton. In the absence of NMR and crystallographic data, our study affords important proofs of binding at the interface pocket and clues on the role played by the ligand structure.     

Analysis of hairpin polyamide complexes having DNA binding sites in close proximity

The binding of two hairpin polyamide ligands at adjacent sites on DNA has been studied using NMR spectroscopy. The ligands ImPyPy-gamma-PyPyPy-Gly-Dp and Ac-ImPyPy-gamma-PyPyPy-Gly-Dp were studied binding to oligomers containing one or two matched binding sites: 5'-XGTTA-3' and 5'-TAACXNGTTA-3', where X is G, C, or A and N = 0, 1 or 2. At these sites the C-terminal ring shows an equilibrium between normal and inverted conformations. Better binding was observed with the ligand running 5' to 3' along the contacted strand than in the opposite direction. Complexes of DNAs with two binding sites indicated that at least one spacing base pair was required, and that the identity of this base pair was not critical. Binding with 5' to 3' contact is again preferred. Demonstrated binding at adjacent sites indicates that it may be possible to engineer cooperative binding for enhanced specificity or affinity.     

Discrimination of hairpin polyamides with an alpha-substituted-gamma-aminobutyric acid as a 5'-TG-3' reader in DNA minor groove

Pyrrole-imidazole (Py-Im) polyamides containing stereospecifically alpha-amino- or alpha-hydroxyl-substituted gamma-aminobutyric acid as a 5'-TG-3' recognition element were synthesized by machine-assisted Fmoc solid-phase synthesis. Their binding properties to predetermined DNA sequences containing a core binding site of 5'-TGCNCA-3'/3'-ACGN'GT-5' (N.N' = A.T, T.A, G.C, and C.G) were then systematically studied by surface plasmon resonance (SPR). SPR results revealed that the pairing of stereospecifically alpha-amino-/alpha-hydroxyl-substituted gamma-aminobutyric acids, (R or S)-alpha,gamma-diaminobutyric acid (gammaRN or gammaSN) and (R or S)-alpha-hydroxyl-gamma-aminobutyric acid (gammaRO or gammaSO), side-by-side with beta-alanine (beta) in such polyamides significantly influenced the DNA binding affinity and recognition specificity of hairpin polyamides in the DNA minor groove compared with beta/beta, beta/gamma, and gamma/beta pairings. More importantly, the polyamide Ac-Im-gammaSO-ImPy-gamma-ImPybetaPy-beta-Dp (beta/gammaSO) favorably binds to a hairpin DNA containing a core binding site of 5'-TGCNCA-3'/3'-ACGN'GT-5' (N.N' = A.T) with dissociation equilibrium constant (K(D)) of 1.9 x 10(-)(7) M over N.N' = T.A with K(D) = 3.7 x 10(-)(6) M, with a 19-fold specificity. By contrast, Ac-Im-gammaSN-ImPy-gamma-ImPybetaPy-beta-Dp (beta/gammaSN) binds to the above sequence with N.N' = A.T with K(D) = 8.7 x 10(-)(7) M over N.N' = T.A with K(D) = 8.4 x 10(-)(6) M, with a 9.6-fold specificity. The results also show that the stereochemistry of the alpha-substituent, as well as the alpha-substituent itself may greatly alter binding affinity and recognition selectivity of hairpin polyamides to different DNA sequences. Further, we carried out molecular modeling studies on the binding by an energy minimization method, suggesting that alpha-hydroxyl is very close to N3 of the 3'-terminal G to induce the formation of hydrogen bonding between hydroxyl and N3 in the recognition event of the polyamide Ac-Im-gammaSO-ImPy-gamma-ImPybetaPy-beta-Dp (beta/gammaSO) to 5'-TGCNCA-3'/3'-ACGN'GT-5' (N.N' = A.T). Therefore, SPR assays and molecular modeling studies collectively suggest that the (S)-alpha-hydroxyl-gamma-aminobutyric acid (gammaSO) may act as a 5'-TG-3' recognition unit.     

New transition metal complexes of 9,10‐phenanthrenequinone p‐toluyl hydrazone Schiff base: Synthesis,spectroscopy, DNA and HSA interactions,antimicrobial, DFT and docking studies

The new complexes of Cu (II) and Ni (II) of a tridentate Schiff base ligand derived from 9,10‐phenanthrenequinone and p‐toluic hydrazide have been synthesized and characterized by elemental analysis, electrical conductometry, FT‐IR, Mass, NMR and UV–Vis. The DFT calculations were carried out at B3LYP/6‐31G*(d) level for the determination of the optimized structure of the ligand and its complexes. The as‐synthesized compounds were screened for their antimicrobial activity. Also, their binding behavior with fish salmon‐DNA (FS‐DNA) and human serum albumin (HSA) were studied by different kinds of spectroscopic and molecular modeling techniques. The fluorescence data at different temperatures were applied in order to estimate the thermodynamics parameters of interactions of ligand and its complexes with DNA and HSA. The results showed that the as‐made compounds could bind to FS‐DNA and HSA via the groove binding as the major binding mode. According to molecular docking calculation and competitive binding experiments, these compounds bind to the minor groove of DNA and hydrophobic residues located in the subdomain IB of HSA. In addition, the molecular docking results kept in good consistence with experimental data.     

DNA interaction,antimicrobial and molecular docking studies of biologically interesting Schiff base complexes incorporating 4‐formyl‐N,N‐dimethylaniline and propylenediamine

Four new transition metal complexes incorporating a Schiff base ligand derived from propylenediamine and 4‐formyl‐N ,N ‐dimethylaniline have been synthesized using transition metal salts. The characterization of the newly formed complexes was done from physicochemical parameters and using various techniques like ¹H NMR, ¹³C NMR, IR, UV, electron paramagnetic resonance and mass spectroscopies, powder X‐ray diffraction and magnetic susceptibility. All the complexes were found to be monomeric in nature with square planar geometry. X‐ray powder diffraction illustrates that the complexes have a crystalline nature. The interaction of metal complexes with calf thymus DNA was investigated using UV–visible absorption, viscosity measurements, cyclic voltammetry, emission spectroscopy and docking analysis. The results indicate that the Cu(II), Co(II), Ni(II) and Zn(II) complexes interact with DNA by intercalative binding mode with optimum intrinsic binding constants of 4.3 × 10⁴, 3.9 × 10⁴, 4.7 × 10⁴ and 3.7 × 10⁴ M⁻¹, respectively. These DNA binding results were rationalized using molecular docking in which the docked structures indicate that the metal complexes fit well into the A‐T rich region of target DNA through intercalation. The metal complexes exhibit an effective cleavage with pUC19 DNA by an oxidative cleavage mechanism. The synthesized ligand and the complexes were tested for their in vitro antimicrobial activity. The complexes show enhanced antifungal and antibacterial activities compared to the free ligand.     

Insight into G[bond]T mismatch recognition using molecular dynamics with time-averaged restraints derived from NMR spectroscopy

Molecular dynamics (MD) simulations were conducted for a G[bond]T mismatch-containing DNA decamer, d(CCATGCGTGG)(2), and its Watson-Crick parent sequence, d(CCACGCGTGG)(2). Dynamics in unrestrained MD trajectories were in poor agreement with prior (13)C NMR studies. However, the accuracy of the trajectories was improved by the use of time-averaged interatomic distance restraints derived from (1)H NMR. Postprocess smoothing of the trajectories further improved accuracy. Comparison of restrained and smoothed trajectories of the two DNA molecules revealed distinct differences in dynamics. The major groove width of the mismatched oligomer was more variable over the course of the simulation compared to its parent sequence. Greater variability in helical parameters stretch and opening for the mismatches indicated less kinetically stable base pairing. Interbase helical parameters rise, roll, and tilt were also more variable in certain base steps involving mismatched bases. These dynamic differences between normal and G[bond]T mismatched DNA reflect differences in local flexibility that may play a role in mismatch recognition by the MutS. A potential alternate G[bond]T mismatch binding mode for MutS is also proposed.     

Structure determination of a key intermediate of the enantioselective Pd complex catalyzed allylic substitution reaction

The structure of a catalytic intermediate with important implications for the interpretation of the stereochemical outcome of the palladium complex catalyzed allylic substitution with phosphino-oxazoline (PHOX) ligands is determined by liquid state NMR. The complex displays a novel structure that is highly distorted compared with other palladium eta2-olefin complexes known so far. The structure has been determined from nuclear overhauser data (NOE), scalar coupling constants, and long range projection angle restraints derived from dipole dipole cross-correlated relaxation of multiple quantum coherence. The latter restraints have been implemented into a distance geometry protocol. The projection angle restraints yield a higher precision in the determination of the relative orientation of the two molecular moieties and are essential to provide an exact structural definition of the olefinic part of the catalytic intermediate with respect to the ligand.     

Induced-fit recognition of DNA by small circular oligonucleotides

We have investigated the molecular interaction between cyclic and linear oligonucleotides. We have found that short cyclic oligonucleotides can induce hairpinlike structures in linear DNA fragments. By using NMR and CD spectroscopy we have studied the interaction of the cyclic oligonucleotide d with d, as well as with its two linear analogs d(GTCCCTCA) and d(CTCAGTCC). Here we report the NMR structural study of these complexes. Recognition between these oligonucleotides occurs through formation of four intermolecular Watson-Crick base pairs. The three-dimensional structure is stabilized by two tetrads, formed by facing the minor-groove side of the Watson-Crick base pairs. Overall, the structure is similar to those observed previously in other quadruplexes formed by minor-groove alignment of Watson-Crick base pairs. However, in this case the complexes are heterodimeric and are formed by two different tetrads (G:C:A:T and G:C:G:C). These complexes represent a new model of DNA recognition by small cyclic oligonucleotides, increasing the number of potential applications of these interesting molecules.     

Coordination chemistry of a terpyridine-tris(pyrazolyl) ditopic ligand

A new ditopic ligand, 4'-(4-(2,2,2-tris(1H-pyrazol-1-ido)ethoxymethyl)phenyl)-2,2':6',2'-terpyridine (pzt), has been prepared and its coordination chemistry studied. Metal ions with a preference for octahedral geometry form ML(2) complexes that are readily isolated and characterised, with the metal ion being bound to the terpyridine sites of both ligands. Other metal ions bind to the terpyridine site of just one ligand. In the case of silver(i), a dinuclear M(2)L(2) complex has been isolated in which each silver ion is coordinated to the terpyridine site of one ligand and to a single pyrazolyl donor group from the second ligand. Evidence for binding of metal ions to the tris(pyrazolyl) binding site was obtained by electrospray mass spectrometry and NMR techniques. The free ligand and three metal complexes, including the disilver complex, have been characterised by X-ray crystallographic techniques.     

DNA cleavage by new oxovanadium(IV) complexes of N-salicylidene alpha-amino acids and phenanthroline bases in the photodynamic therapy window

Oxovanadium(IV) complexes [VO(salmet)(B)] (1-3) and [VO(saltrp)(B)] (4-6), where salmet and saltrp are N-salicylidene-l-methionate and N-salicylidene-l-tryptophanate, respectively, and B is a N,N-donor heterocyclic base (viz. 1,10-phenanthroline (phen, 1, 4), dipyrido[3,2-d:2',3'-f]quinoxaline (dpq, 2, 5), and dipyrido[3,2-a:2',3'-c]phenazine (dppz, 3, 6)) are prepared and characterized and their DNA binding and photoinduced DNA cleavage activity studied. Complexes 1, 2, and 4 are structurally characterized by single-crystal X-ray crystallography. The molecular structure shows the presence of a vanadyl group in the VO3N3 coordination geometry. The dianionic alpha-amino acid Schiff base acts as a tridentate O,N,O-donor ligand in a meridional binding mode. The N,N-donor heterocyclic base displays a chelating mode of bonding with a N-donor site trans to the oxo group. The complexes show a d-d band in the range of 680-710 nm in DMF with a shoulder near 840 nm. They exhibit an irreversible oxidative cyclic voltammetric response near 0.8 V assignable to the V(V)/V(IV) couple and a quasi-reversible V(IV)/V(III) redox couple near -1.1 V vs SCE in DMF-0.1 M TBAP. The complexes show good binding propensity to calf thymus DNA giving binding constant values in the range from 5.2 x 10(4) to 7.2 x 10(5) M(-1). The binding site size, thermal melting, and viscosity data suggest DNA surface and/or groove binding nature of the complexes. The complexes show poor "chemical nuclease" activity in the dark in the presence of 3-mercaptopropionic acid or hydrogen peroxide. The dpq and dppz complexes show efficient DNA cleavage activity on irradiation with UV-A light of 365 nm via a mechanistic pathway involving formation of singlet oxygen as the reactive species. They also show significant DNA cleavage activity on photoexcitation in red light (>750 nm) by (1)O2 species. Observation of red-light-induced cleavage of DNA is unprecedented in the vanadium chemistry. The DNA cleavage activity is metal promoted as the ligands or vanadyl sulfate alone are cleavage inactive on photoirradiation at these wavelengths.     

Non-covalent DNA binding and cytotoxicity of certain mixed-ligand ruthenium(II) complexes of 2,2'-dipyridylamine and diimines

A series of mixed ligand ruthenium(II) complexes [Ru(Hdpa)2(diimine)](ClO4)2, 1-5 where Hdpa is 2,2'-dipyridylamine and diimine is 1,10-phenanthroline (phen) and a modified/extended 1,10-phenanthroline such as, 5,6-dimethyl-1,10-phenanthroline (5,6-dmp), dipyrido[3,2-d:2',3'-f]quinoxaline (dpq), 5-methyldipyrido[3,2-d:2',3'-f]quinoxaline (mdpq) and dipyrido[3,2-a:2',3'-c]phenazine (dppz) have been isolated and characterized by analytical and spectral methods. The complex [Ru(Hdpa)2(phen)](PF6)2 1 has been structurally characterized and the coordination geometry around Ru(II) in it is described as distorted octahedral. 1H NMR spectral data reveal that 1-5 should have a C2 symmetry lying on the diimine plane due to the rapid flapping of the coordinated Hdpa ligands. The interaction of the complexes with calf thymus (CT) DNA has been explored by using absorption and emission spectral and viscometry and electrochemical techniques and the mode of DNA binding of the complexes has been proposed. The DNA binding affinity of the complexes decreases with decrease in number of planar aromatic rings in the co-ligand supporting the intercalation of the diimine co-ligands in between the DNA base pairs. Circular dichroic spectral studies reveal that the complexes 3-5 exhibit induced circular dichroism upon binding to CT DNA. Interestingly, upon interaction with CT DNA all the complexes show an increase in anodic current in the cyclic voltammograms suggesting that they are involved in electrocatalytic guanine oxidation. Interestingly, of all the complexes, only 5 alters the DNA superhelicity upon binding with supercoiled pBR322 DNA, which is consistent with its higher DNA binding affinity. Further, the cytotoxicities of the complexes against human cervical epidermoid carcinoma cell line (ME180) have been examined. Interestingly, 5 exhibits a cytotoxicity against ME180 higher than other complexes with potency approximately 8 times more than cisplatin for 24 h incubation but 4 times lower than cisplatin for 48 h incubation.     

Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) tethering a Hoechst 33258 analogue: triplex and duplex stabilization by simultaneous minor groove binding

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.     

Biological contour,molecular docking and antiproliferative studies of DNA targeted histidine based transition metal(II) complexes: Invention and its depiction

A novel series of histidine derived transition metal complexes were synthesized and characterized by multispectral techniques such as UV‐Vis., FT IR, EPR, NMR, ESI‐mass analysis and other physico‐chemical methods like elemental analysis, molar conductivity, magnetic susceptibility. The synthesized compounds were attempted for their biological prospective. The biological studies involved are DNA interaction (binding and damage), antimicrobial, antioxidant, antiproliferative and molecular docking. DNA interaction studies were carried out with the help of UV‐Vis absorption titration, viscosity measurement and cyclic voltammetric techniques which revealed that the synthesized compounds could interact with CT‐DNA through intercalative binding mode. A gel electrophoresis assay demonstrated the ability of complexes to cleave the supercoiled pUC18 DNA. The antioxidant property shows that the metal complexes have preferable ability to scavenge hydroxyl radical than the ligand. Moreover, the antimicrobial assay indicates that these complexes are good antimicrobial agents against various pathogens. Furthermore, the in vitro antiproliferative activities of the complexes were examined on HeLa, Hep G2 and NIH 3 T3 cell lines using an MTT assay. The morphological changes were investigated using Hoechst 33258 staining apoptosis assay. In addition, molecular docking studies were executed to considerate the nature of binding of the synthesized complexes with protein and DNA.