A “plug and play” polymer through biocomplementary hydrogen bonding

This article describes a DNA‐like polymer that exhibits the ability to self‐assemble through hydrogen bonding. We synthesized poly[1‐(4‐vinylbenzyl)thymine] (PVBT) and 9‐hexadecyladenine (A‐C16) through an atom transfer radical polymerization (ATRP) and alkylation, respectively. Biocomplementary PVBT/A‐C16 hierarchical supramolecular complexes formed in dilute DMSO solution through nucleobase recognition, that is, hydrogen bonding interactions between the thymine (T) groups of PVBT and the adenine (A) group of A‐C16; evidence for this molecular recognition was also gained from dynamic light scattering studies. ¹H NMR titration studies in CDCl₃ showed that T–A complexes formed rapidly on the NMR time scale with high association constants (up to 534 M^?1). Moreover, FTIR spectroscopic, differential scanning calorimetry, wide‐angle X‐ray diffraction, and small‐angle X‐ray scattering analyses provided further details into the nature of the self‐assembly of these systems. In the bulk state, these complexes self‐assemble into well‐ordered lamellar structures; the changing d‐spacing distance (ranging from 4.98 to 2.32 nm) at different A‐C16 loadings reveals that the molecular structures of the PVBT/A‐C16 complexes are readily tailored. © 2008 Wiley Periodicals, Inc. J Polym Sci Part A: Polym Chem 46: 6416–6424, 2008     

Spacer‐length‐dependent association in polymers with multiple‐hydrogen‐bonded end groups

Herein, we investigate the influence of spacer length on the homoassociation and heteroassociation of end‐functionalized hydrogen‐bonding polymers based on poly(n‐butyl acrylate). Two monofunctional ureido‐pyrimidinone (UPy) end‐functionalized polymers were prepared by atom transfer radical polymerization using self‐complementary UPy‐functional initiators that differ in the spacer length between the multiple‐hydrogen‐bonding group and the chain initiation site. The self‐complementary binding strength (K_dim) of these end‐functionalized polymers was shown to depend critically on the spacer length as evident from ¹H NMR and diffusion‐ordered spectroscopy. In addition, the heteroassociation strength of the end‐functionalized UPy polymers with end‐functionalized polymers containing the complementary 2,7‐diamido‐1,8‐naphthyridine (NaPy) hydrogen‐bond motif is also affected when the aliphatic spacer length is too short. © 2011 Wiley Periodicals, Inc. J Polym Sci Part A: Polym Chem, 2011     

Solid‐State NMR investigations of anhydrous proton‐conducting acid–base poly(acrylic acid)– poly(4‐vinyl pyridine) polymer blend system: A study of hydrogen bonding and proton conduction

NMR studies of the structure and dynamics of a system composed of the acidic polymer poly(acrylic acid) (PAA) and the basic polymer poly(4‐vinyl pyridine) (P4VP) are presented. This system aims at the application of anhydrous proton‐conducting membranes that can be used at elevated temperatures at which the proton conduction of hydrated membranes breaks down. The ¹H NMR measurements have been preformed under fast magic angle spinning (MAS) conditions to achieve sufficient resolution and the applied ¹H NMR methods vary from simple ¹H MAS to double‐quantum filtered methods and two‐dimensional ¹H double‐quantum spectroscopy. The dynamic behavior of the systems has been investigated via variable temperature ¹H MAS NMR. ¹³C cross‐polarization MAS NMR provides additional aspects of dynamic and structural features to complete the picture. Different types of acidic protons have been identified in the studied PAA‐P4VP systems that are nonhydrogen‐bonded free acidic protons, hydrogen‐bonded dicarboxylic dimers, and protons forming hydrogen bonds between carboxylic protons and ring nitrogens. The conversion of dimer structures in dried PAA to free carboxylic acid groups is accomplished at temperatures above 380 K. However, the stability of hydrogen‐bonding strongly depends on the hydration level of the polymer systems. The effect of hydration becomes less apparent in the complexes. An inverse proportionality between hydrogen‐bonding strength and proton conduction in the PAA‐P4VP acid–base polymer blend systems was established. © 2008 Wiley Periodicals, Inc. J Polym Sci Part B: Polym Phys 47: 138–155, 2009     

A Non‐Invasive NMR Method Based on Histidine Imidazoles to Analyze the pH‐Modulation of Protein–Nucleic Acid Interfaces

A useful ²J(N?H) coupling‐based NMR spectroscopic approach is proposed to unveil, at the molecular level, the contribution of the imidazole groups of histidines from RNA/DNA‐binding proteins on the modulation of binding to nucleic acids by pH. Such protonation/deprotonation events have been monitored on the single His96 located at the second RNA/DNA recognition motif (RRM2) of T‐cell intracellular antigen‐1 (TIA‐1) protein. The pK_a values of the His96 ionizable groups were substantially higher in the complexes with short U‐rich RNA and T‐rich DNA oligonucleotides than those of the isolated TIA‐1 RRM2. Herein, the methodology applied to determine changes in pK_a of histidine side chains upon DNA/RNA binding, gives valuable information to understand the pH effect on multidomain DNA/RNA‐binding proteins that shuttle among different cellular compartments.     

Hydrogen bonds of RNA are stronger than those of DNA, but NMR monitors only presence of methyl substituent in uracil/thymine

Recently, Vakonakis and LiWang (J. Am. Chem. Soc. 2004, 126, 5688) reported experimental evidence for stronger hydrogen bonds in RNA A:U than in DNA A:T base pairs, which was based on differences in NMR shielding for adenine C2. We have analyzed the proposed correlation between NMR shielding and hydrogen-bond strength using density functional theory. Although we agree with the conclusion that A:U is more strongly bound, we find no correlation between the hydrogen-bond strength and the NMR shielding of C2. Our study shows that NMR merely probes the presence/absence of the methyl group in thymine/uracil, without any relation to the strength of the hydrogen bonds involved. In other words, one cannot infer the Watson-Crick hydrogen-bond strength from the NMR shielding constant of adenine C2.     

DFT plus PCM calculation for pairing specificity of Watson–Crick‐type bases in aqueous solutions

This study is aimed at explaining the preference for AT and CG pairings and the possible insertion of other tautomeric DNA base pairs such as G_enolT, that respect energetic and steric requirements including at least two hydrogen bonds and 11 ± 0.5Å distance between the 9‐CH₃ of purine and 5‐CH₃ of pyrimidine. The calculated free energy of formation ΔΔG at the DFT B3LYP/6‐31G*‐PCM/BEM level pointed out the CG and AT pairs as the most favored, followed closely by G_enolT, in good agreement with Michaelis–Menten first order kinetics (CG ≈ AT > G_enolT). Unusual DNA base pairs complexes such as AG (BEM) and CT (PCM) resulted to be stable, but it is very difficult to assume that they are likely to be included in the double strand DNA. The calculated enthalpy and dipole moments of isolated DNA bases agree well with experiment. The free energy of hydration, ΔG_hyd, was found to depend on the electrostatic term, while cavitation‐dispersion components are almost constant. The stability of DNA complexes in water resulted from PCM calculations is markedly influenced by the free energy of hydration. © 2009 Wiley Periodicals, Inc. Int J Quantum Chem, 2010     

Self‐assembly of H‐bonded side‐chain and cross‐linking copolymers containing diblock‐copolymeric donors and single/double H‐bonded light‐emitting acceptors

A series of diblock‐copolymers were synthesized through anionic polymerization of styrene and tert‐butyl methacrylate (tBuA) with different monomer ratios, and analogous block‐copolymeric derivatives (PS‐b‐PAA)s with monofunctional carboxylic acid groups were obtained by further hydrolyzation as hydrogen‐bonded (H‐bonded) proton donors. Via H‐bonded interaction, these diblock‐coplymeric donors (PS‐b‐PAA)s were incorporated with luminescent mono‐pyridyl/bis‐pyridyl acceptors to form single/double H‐bonded supramolecules, that is, H‐bonded side‐chain/cross‐linking copolymers, respectively. The supramolecular architectures formed by donor polymers and light‐emitting acceptors were influenced by the ratio of acid blocks in the diblock copolymeric donors and the type of single/double H‐bonded light‐emitting acceptors. Their thermal and luminescent properties can be adjusted by H‐bonds, and more than 100 nm of red‐shifted photoluminescence (PL) emissions were observed, which depend on the degrees of the H‐bonding interactions. Self‐assembled phenomena of amphiphilic dibolck copolymers and their H‐bonded complexes were confirmed by TEM micrographs, and supramolecular microphase separation of spherical micelle‐like morphology was demonstrated to affect the photophysical properties. Polymer light‐emitting diode (PLED) devices containing H‐bonded complexes showed electroluminescence (EL) emissions of 503–560 nm under turn‐on voltages of 7.5–9.0 V, maximum power efficiencies of 0.23–0.37 cd/A (at 100 mA/cm²), and maximum luminances of 318–519 cd/m² (around 25 V). © 2009 Wiley Periodicals, Inc. J Polym Sci Part A: Polym Chem 47: 4685–4702, 2009     

Synthesis and characterization of UV‐curable ladder‐like polysilsesquioxane

Various ladder‐like structured poly(phenyl‐co‐methacryl silsesquioxane)s (LPMSQ)s with high molecular weight (M_w = 10,000 ～ 40,000) were synthesized by direct hydrolysis and polymerization in the presence of base catalyst at 25 °C. Synthesized LPMSQs mainly showed ladder‐like structure and photo‐cure reaction by 100 mW/cm² (360 nm) for 10 s without any photo‐cure initiators. Chemical composition and structural analysis of the obtained LPMSQs were characterized using ¹H NMR, ²⁹Si NMR, Fourier transform infrared spectroscopy (FTIR), gel permeation chromatography (GPC), and X‐ray diffraction (XRD). Physical properties of LPMSQs before and after photcuring were analyzed by Nanoindentation. Surface modulus increased to 8GPa and hardness of thin films increased from 100 to 400 MPa. © 2011 Wiley Periodicals, Inc. J Polym Sci Part A: Polym Chem, 2011     

High‐Resolution Crystal Structure of a Silver(I)–RNA Hybrid Duplex Containing Watson–Crick‐like CSilver(I)C Metallo‐Base Pairs

Metallo‐base pairs have been extensively studied for applications in nucleic acid‐based nanodevices and genetic code expansion. Metallo‐base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo‐base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T? Hg^II? T base pairs. Herein, we have determined a high‐resolution crystal structure of the second natural metallo‐base pair between pyrimidine bases C? Ag^I? C formed in an RNA duplex. One Ag^I occupies the center between two cytosines and forms a C? Ag^I? C base pair through N3? Ag^I? N3 linear coordination. The C? Ag^I? C base pair formation does not disturb the standard A‐form conformation of RNA. Since the C? Ag^I? C base pair is structurally similar to the canonical Watson–Crick base pairs, it can be a useful building block for structure‐based design and fabrication of nucleic acid‐based nanodevices.     

Highly Stable Double‐Stranded DNA Containing Sequential Silver(I)‐Mediated 7‐Deazaadenine/Thymine Watson–Crick Base Pairs

The oligonucleotide d(TX)₉, which consists of an octadecamer sequence with alternating non‐canonical 7‐deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double‐stranded DNA through the formation of hydrogen‐bonded Watson–Crick base pairs. dsDNA with metal‐mediated base pairs was then obtained by selectively replacing W‐C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag⁺ ions, and its stability is significantly enhanced in the presence of Ag⁺ ions while its double‐helix structure is retained. Temperature‐dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)‐mediated base pairs. This strategy could become useful for preparing stable metallo‐DNA‐based nanostructures.     

AFM‐Correlated CSM‐Coupled Raman/Fluorescence Studies on Selective Interactions of Water Soluble Porphyrins with DNA

The Raman and fluorescence spectroscopic properties of water‐soluble oxo‐titanium(IV) mesotetrakis (1‐methyl pyridium‐4‐yl) porphyrin (O=Ti(TMPyP)⁴⁺) bound with calf thymus DNA and artificial DNAs such as double stranded poly[d(A‐T)₂] and poly[d(G‐C)₂] have been investigated on the single DNA molecule basis by AFM‐correlated confocal scanning microscope (CSM)‐coupled Raman and fluorescence spectroscopic techniques as well as the ensemble‐averaged spectroscopy. The ensemble‐averaged spectroscopic studies imply that the porphyrin interacts with DNA in different groove binding patterns depending on the base pairs. AFM‐images of the different DNAs bound with O=Ti(TMPyP)⁴⁺ were measured, and their morphologies are found to depend on kind of base pairs interacting with O=Ti(TMPyP)⁴⁺. Being correlated with the AFM images, the CSM‐coupled Raman and fluorescence spectral properties of the three different single O=Ti(TMPyP)⁴⁺‐DNA complexes were observed to be highly resolved and sensitive to base pair‐dependent axial ligation of Ti‐O bond as compared to the corresponding ensemble‐averaged spectral properties, which affect the groove binding and its strength of the O=Ti(TMPyP)⁴⁺ with DNA. The axial ligation was found to be accompanied by vibration structural change of the porphyrin ring, leading to keep the shape of double stranded poly[d(A‐T)₂] rigid while poly‐[d(G‐C)₂] and calf thymus DNA flexible after binding with the oxo‐titanyl porphyrin. The base pair dependence of the fluorescence decay times of the DNA‐bound porphyrins was also observed, implying that an excited‐state charge transfer takes place in the G‐C rich major groove in calf thymus DNA. These results suggest that binding of O=Ti(TMPyP)⁴⁺ is more preferential with the G‐C rich major groove than with the A‐T rich minor groove in calf thymus DNA so that the morphology of DNA is changed.     

Understanding hydrogenation of the adenine‐thymine base pairs and their anions: A density functional study

The B3LYP/DZP++ approach has been used to investigate the properties of hydrogenated radicals and anions of adenine‐thymine (A‐T) base pairs. Our calculations show that the hydrogenated radicals and anions have relatively high stabilities compared with the single adenine and thymine base. The conformations and hydrogen‐bond interactions of A‐T base pairs have obviously changed once the hydrogen atoms attached to the A‐T base pairs and their anion. As for the hydrogenated A‐T radicals, all of them exhibit relatively high electron affinities and different hydrogenation properties with respect to their components. The process of the bond formations of (C6)‐H (adenine) and (C6)‐H (thymine) are the most favorable in energetics. The two hydrogenation channels have the reaction Gibbs free energies (ΔG°) of ?51.8 and ?54.2 kcal mol^?1, respectively. Also, the calculations on the basis of CPCM model imply that the solvent effect plays an important role in the electron attachment and hydrogenation reactions, and can stabilize the hydrogenated A‐T anions. © 2011 Wiley Periodicals, Inc. Int J Quantum Chem, 2012     

Interaction between RNA segment (adenine‐uracil) and model of protein unit (formamide): A density‐functional theory study

Various possible structures of adenine‐uracil‐formamide hydrogen‐bond complexes were optimized at 6‐311++G(d,p) level, and the binding energies of these complexes were also calculated at DFT B3LYP/6‐311++G(d,p) level. Eight stable cyclic structures being involved in the interaction are found on the potential energy surface. By analyzing the structure, NPA charge and interaction energy of complexes, we obtain the most stable geometry structure. The results show that the interactions between formamide and adenine‐uracil (A‐U) base pair affect the stabilities of the base pairs. © 2009 Wiley Periodicals, Inc. Int J Quantum Chem, 2010     

A Pyrimidopyrimidine Janus‐AT Nucleoside with Improved Base‐Pairing Properties to both A and T within a DNA Duplex: The Stabilizing Effect of a Second Endocyclic Ring Nitrogen

Janus bases are heterocyclic nucleic acid base analogs that present two different faces able to simultaneously hydrogen bond to nucleosides that form Watson–Crick base pairs. The synthesis of a Janus‐AT nucleotide analogue, ^N J_AT , that has an additional endocyclic ring nitrogen and is thus more capable of efficiently discriminating T/A over G/C bases when base‐pairing in a standard duplex‐DNA context is described. Conversion to a phosphoramidite ultimately afforded incorporation into an oligonucleotide. In contrast to the first generation of carbocyclic Janus heterocycles, it remains in its unprotonated state at physiological pH and, therefore, forms very stable Watson–Crick base pairs with either A or T bases. Biophysical and computational methods indicate that ^N J_AT is an improved candidate for sequence‐specific genome targeting.     

P4VP and oligo(phenylenevinylene)‐perylenebisimide mixed donor‐acceptor supramolecular comb polymer complexes with improved charge carrier mobility

Random donor‐acceptor (D‐A) supramolecular comb polymers were formed when hydroxyl functionalized donor and acceptor small molecules based on Oligo(phenylenevinylene) (named OPVCN‐OH ) and Perylenebisimide (named UPBI‐PDP ), respectively, were complexed with Poly(4‐vinyl pyridine) (P4VP). A series of random D‐A supramolecular comb polymers were formed by varying the ratios of UPBI‐PDP and OPVCN‐OH with P4VP. A 100% P4VP‐donor polymer complex [ P4VP(OPV_1.00 )] and a 100% P4VP‐acceptor polymer complex [ P4VP(UPBI_1.00 )] were also synthesized and characterized. Complex formation was confirmed by FT‐IR and ¹H NMR spectroscopy. Solid state structural studies carried out using small angle X‐ray scattering and wide angle X‐ray diffraction experiments revealed altered packing of the D and A molecules in the complexes. Transmission electron microscopy images showed lamellar structures in the < 10 nm scale for the P4VP(OPV_1.00 ), P4VP(UPBI_1.00 ), and mixed P4VP (D‐A) complexes. The effect of the nanoscopic D‐A self‐assembly on the bulk mobility of the materials was probed using SCLC measurements. The mixed D‐A random complexes exhibited ambipolar charge transport characteristics with higher values for the average bulk hole mobility estimate. P4VP(OPV_0.25 + UPBI_0.75) exhibited an average hole mobility in the order of 10^?2cm² V^?1 s^?1 and electron mobility 10^?5cm² V^?1 s^?1. © 2016 Wiley Periodicals, Inc. J. Polym. Sci., Part A: Polym. Chem. 2016 , 54, 2403–2412     

Janus‐Like Squaramide‐Based Hosts: Dual Mode of Binding and Conformational Transitions Driven by Ion‐Pair Recognition

New tripodal squaramide‐based hosts have been synthesised and structurally characterised by spectroscopic methods. In 2.5 % (v/v) [D₆]DMSO in CDCl₃, compound 4 formed dimeric assemblies [log K_dim=3.68(8)] as demonstrated by ¹H NMR spectroscopy and UV dilution experiments. AFM and SEM analyses revealed the formation of a network of bundled fibres, which indicates a preferential mechanism for aggregation. These C₃‐symmetric tripodal hosts exhibited two different and mutually exclusive modes of binding, each one easily accessible by simultaneous reorientation of the squaramide groups. In the first, a convergent disposition of the NH squaramide protons allowed the formation of an array of N? H???X^? hydrogen bonds with anions. In the second mode, reorientation of carbonyl squaramide groups allowed multiple C?O???H interactions with ammonium cations. The titration of 4 with different tetraalkylammonium iodides persistently showed the formation of 1:1 complexes, as well as 1:2 and 1:3 complexes. The corresponding stoichiometries and binding affinities of the complexes were evaluated by multi‐regression analysis. The formation of high‐order complexes, supported by ROESY, NOESY and mass spectrometry experiments, has been attributed to the insertion of NR₄I ion pairs between the carbonyl and NH protons of the squaramide groups located in adjacent arms of 4 . The observed effects reflect the induction of significant conformational changes in the hosts, mainly in relation to the relative orientation of the squaramide groups adapting their geometries to incoming ion‐pair complementary substrates. The results presented herein identify and fully describe two different modes of ion‐pair recognition aimed at directing conformational transitions in the host, therefore establishing a base for controlling more elaborate movements of molecular devices through ion‐pair recognition.     

Temperature dependence of internucleotide nitrogen–nitrogen scalar couplings in RNA

The temperature dependence of internucleotide nitrogen–nitrogen scalar couplings ^2hJ(N,N) across hydrogen bonds in adenine–uracil (A–U) and guanine–cytosine (G–C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 K. The value of ^2hJ(N,N) was observed to decrease monotonically for all four base pairs with increasing temperature. The temperature dependence of ^2hJ(N,N) was found to be more pronounced for the A–U base pair than for G–C base pairs. An earlier study of cross‐correlation effects at 296 K appeared to indicate a reduced mobility of the A–U base pair, as evidenced by small contributions of chemical shift modulation to relaxation rates. Copyright © 2002 John Wiley & Sons, Ltd.     

Control of thermoresponsive property of urea end‐functionalized poly(N‐isopropylacrylamide) based on the hydrogen bond‐assisted self‐assembly in water

The precise synthesis and variation in the thermoresponsive property based on the supramolecular assembly of a novel urea end‐functionalized poly(N‐isopropylacrylamide) (PNIPAM) were studied. A series of PNIPAMs with different diphenylurea groups at the chain end (X? Ph? NH? CO? NH? Ph? trz? PNIPAM: X = H, OCH₃, CH₃, NO₂, Cl, and CF₃) were synthesized by using a combination of the atom transfer radical polymerization and the copper(I)‐catalyzed azide‐alkyne cycloaddition. The cloud point of the obtained polymers depended on the hydrogen‐bonding ability of the introduced urea group. The ¹H NMR measurement suggested that the obtained PNIPAM assembled in water via the intermolecular hydrogen bonding by the terminal urea group. From the dynamic light scattering and transmission electron microscopy measurements, the aggregated nanoparticles of the resulting polymer were directly observed in water at a temperature below its cloud point. The hydrogen‐bonding property of the chain end urea group was concluded to be involved in the aggregation of the PNIPAM in water, leading to the variation in its cloud point. © 2009 Wiley Periodicals, Inc. J Polym Sci Part A: Polym Chem 47: 6259–6268, 2009     

Imino‐indolate half‐titanocene chlorides: Synthesis and their ethylene (co‐)polymerization

A series of imino‐indolate half‐titanocene chlorides, Cp′Ti(L)Cl₂ ( C1 – C7 : Cp′ = C₅H₅, MeC₅H₄, C₅Me₅, L = imino‐indolate ligand), were synthesized by the reaction of Cp′TiCl₃ with sodium imino‐indolates. All complexes were characterized by elemental analysis, ¹H and ¹³C NMR spectroscopy. Moreover, the molecular structures of two representative complexes C4 and C6 were confirmed by single crystal X‐ray diffraction analysis. On activation with methylaluminoxane (MAO), these complexes showed good catalytic activities for ethylene polymerization (up to 7.68 × 10⁶ g/mol(Ti)·h) and ethylene/1‐hexene copolymerization (up to 8.32 × 10⁶ g/mol(Ti)·h), producing polyolefins with high molecular weights (for polyethylene up to 1808 kg/mol, and for poly(ethylen‐co‐1‐hexene) up to 3290 kg/mol). Half‐titanocenes containing ligands with alkyl substituents showed higher catalytic activities, whereas the half‐titanocenes bearing methyl substituents on the cyclopentadienyl groups showed lower productivities, but produced polymers with higher molecular weights. Moreover, the copolymerization of ethylene and methyl 10‐undecenoate was demonstrated using the C1 /MAO catalytic system. The functionalized polyolefins obtained contained about 1 mol % of methyl 10‐undecenoate units and were fully characterized by several techniques such as FT‐IR, ¹H NMR, ¹³C NMR, DSC, TGA and GPC analyses. © 2008 Wiley Periodicals, Inc. J Polym Sci Part A: Polym Chem 47: 357–372, 2009