Significance of Satellite DNA Revealed by Conservation of a Widespread Repeat DNA Sequence Among Angiosperms

The analysis of plant genome structure and evolution requires comprehensive characterization of repetitive sequences that make up the majority of plant nuclear DNA. In the present study, we analyzed the nature of pCtKpnI-I and pCtKpnI-II tandem repeated sequences, reported earlier in Carthamus tinctorius. Interestingly, homolog of pCtKpnI-I repeat sequence was also found to be present in widely divergent families of angiosperms. pCtKpnI-I showed high sequence similarity but low copy number among various taxa of different families of angiosperms analyzed. In comparison, pCtKpnI-II was specific to the genus Carthamus and was not present in any other taxa analyzed. The molecular structure of pCtKpnI-I was analyzed in various unrelated taxa of angiosperms to decipher the evolutionary conserved nature of the sequence and its possible functional role.     

Isolation of simple-sequence loci for use in polymerase chain reaction-based DNA fingerprinting

Simple sequences are short regions of tandem repetitions of mono-, di-, tri-, or tetranucleotide motifs and occur as repetitive elements in all eukaryotic genomes. These regions tend to be hypervariable in length and can therefore be exploited for DNA fingerprinting purposes, using the polymerase chain reaction with primers flanking such regions. We describe how suitable simple-sequence loci can be isolated from any given eukaryotic DNA. We show the DNA sequences for a number of variants of such loci and discuss the current results on their usefulness for DNA fingerprinting.     

From NGS assembly challenges to instability of fungal mitochondrial genomes: A case study in genome complexity

The presence of repetitive or non-unique DNA persisting over sizable regions of a eukaryotic genome can hinder the genome's successful de novo assembly from short reads: ambiguities in assigning genome locations to the non-unique subsequences can result in premature termination of contigs and thus overfragmented assemblies. Fungal mitochondrial (mtDNA) genomes are compact (typically less than 100 kb), yet often contain short non-unique sequences that can be shown to impede their successful de novo assembly in silico. Such repeats can also confuse processes in the cell in vivo. A well-studied example is ectopic (out-of-register, illegitimate) recombination associated with repeat pairs, which can lead to deletion of functionally important genes that are located between the repeats. Repeats that remain conserved over micro- or macroevolutionary timescales despite such risks may indicate functionally or structurally (e.g., for replication) important regions. This principle could form the basis of a mining strategy for accelerating discovery of function in genome sequences. We present here our screening of a sample of 11 fully sequenced fungal mitochondrial genomes by observing where exact k-mer repeats occurred several times; initial analyses motivated us to focus on 17-mers occurring more than three times. Based on the diverse repeats we observe, we propose that such screening may serve as an efficient expedient for gaining a rapid but representative first insight into the repeat landscapes of sparsely characterized mitochondrial chromosomes. Our matching of the flagged repeats to previously reported regions of interest supports the idea that systems of persisting, non-trivial repeats in genomes can often highlight features meriting further attention.     

A gel retardation assay system for studying protein binding to simple repetitive DNA sequences.

Simple repetitive DNA sequences have been regarded as mere "junk" present in all eukaryotic genomes. In fact, mixed simple repeat (gt)n(ga)m sequences are present in major histocompatibility complex MHC-DRB genes for long evolutionary times, including such distant animals as artiodactyla and man. We describe herein an unsophisticated method which reveals that at least certain simple repetitive (gt)n(ga)m sequences bind nuclear proteins and show characteristics of a specific DNA-protein interaction via gel retardation.     

Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of Ephedra-Containing Products

Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra-containing products.     

DNA loops and semicatenated DNA junctions

Background  

Alternative DNA conformations are of particular interest as potential signals to mark important sites on the genome. The structural variability of CA microsatellites is particularly pronounced; these are repetitive poly(CA) · poly(TG) DNA sequences spread in all eukaryotic genomes as tracts of up to 60 base pairs long. Many in vitro studies have shown that the structure of poly(CA) · poly(TG) can vary markedly from the classical right handed DNA double helix and adopt diverse alternative conformations. Here we have studied the mechanism of formation and the structure of an alternative DNA structure, named Form X, which was observed previously by polyacrylamide gel electrophoresis of DNA fragments containing a tract of the CA microsatellite poly(CA) · poly(TG) but had not yet been characterized.     

The frequency of poly(G) tracts in the human genome and their use as a sensor of DNA damage

Tandem repeats of short DNA sequences are commonly found in human DNA. These simple sequence repeats or microsatellites are highly polymorphic in the human genome. Since the anti-tumour agent cisplatin preferentially forms DNA adducts at runs of consecutive guanine nucleotides (poly(G)), the position and frequency of occurrence of poly(G) sequences in the updated human genome was investigated. There are more runs of consecutive guanines than would be expected by random chance. This especially true for poly(G) sequences longer than approximately n = 9. A plot of poly(G) length against log(observed/expected) frequency produced a straight line for n > 9. A similar observation was also found for poly(A) DNA sequence repeats. This data implied that the increase in observed/expected frequency is directly related to length of DNA repeat. It was proposed that long runs of consecutive guanine nucleotides could be a sensitive sensor of cellular DNA damage since a number of DNA damaging agents cause lesions at poly(G) sequences.     

Rapid method for detection of restriction endonuclease-producing strains in enteropathogenic bacteria

An improved rapid method is described for the detection of restriction endonucleases in enteropathogenic bacteria including Salmonella and Escherichia coli. With the improved method, at least six restriction endonucleases with different specificity were found in 415 strains tested. Five of them were shown to be isoschizomers of known restriction endonucleases, while one seemed to be novel. Among the isoschizomers, SthI endonuclease (isoschizomer of KpnI) in Salmonella thompson appears to be useful; unlike KpnI, SthI generates DNA fragments with a 5′-protruding end.     

LC/ESI-MS n and 1H HR-MAS NMR analytical methods as useful taxonomical tools within the genus Cystoseira C. Agardh (Fucales; Phaeophyceae)

Species of the genus Cystoseira are particularly hard to discriminate, due to the complexity of their morphology, which can be influenced by their phenological state and ecological parameters. Our study emphasized on the relevance of two kinds of analytical tools, (1) LC/ESI-MSⁿ and (2) ¹H HR-MAS NMR, also called in vivo NMR, to identify Cystoseira specimens at the specific level and discuss their taxonomy. For these analyses, samples were collected at several locations in Brittany (France), where Cystoseira baccata, C. foeniculacea, C. humilis, C. nodicaulis and C. tamariscifolia were previously reported. To validate our chemical procedure, the sequence of the ITS2 has been obtained for each species to investigate their phylogenetic relationships at a molecular level. Our study highlighted the consistency of the two physico-chemical methods, compared to “classical” molecular approach, in studying taxonomy within the genus Cystoseira. Especially, LC/ESI-MSⁿ and phylogenetic analyses converged into the discrimination of two taxonomical groups among the 5 species. The occurrence of some specific signals in the ¹H HR-MAS NMR spectra and/or some characteristic chemical compounds during LC/ESI-MSⁿ analysis could be regarded as discriminating factors. LC/ESI-MSⁿ and ¹H HR-MAS NMR turned out to be two relevant and innovative techniques to discriminate taxonomically this complex genus.     

On the stability of single-walled carbon nanotubes and their binding strengths

The series of rhenium (I) tricarbonyl mixed-ligand complexes ReCl(CO)₃(H_nbpydt) (n?=?2, 1; n?=?4, 2; bpy?=?bispyridine, dt?=?1,3-dithiole) and ReCl(CO)₃(H_nbpyTTF) (n?=?2, 3; n?=?3, 4; TTF?=?Tetrathiafulvalene) have been investigated theoretically to explore the effect of COOH functional group on their electronic structures, spectroscopic properties and their properties as dye in a solar cell. The calculated geometry structure and absorption spectrum of 1 and 3 are generally consistent with the experimental results. By attaching the COOH groups on both bpy and dt (TTF in 4) moiety in 2, the nature of LUMO is also contributed by both π*(bpy) and π*(dt) (π*(TTF) in 4), and the absorptions have an obvious red shift compared with 1 and 3. In addition, it can be found that the transition terminates at the orbital populated by the COOH-appended moieties, and the performance of 2 and 4 in the dye-sensitized solar cell can be enhanced as compared with 1 and 3.     

Comparison of an HPTLC method with the Reflectoquant assay for rapid determination of 5-hydroxymethylfurfural in honey

5-Hydroxymethylfurfural (HMF) was analyzed in 17 botanical varieties of honey from 12 countries. A recently developed high-performance thin-layer chromatographic (HPTLC) method was limited because of increased matrix effects at higher honey sample loading. Therefore, the method was modified to achieve higher sensitivity and eliminate matrix interference by use of rectangular application combined with a focusing step. The HPTLC results were compared with results from the new spectrophotometric Reflectoquant hydroxymethylfurfural assay. Both methods had quantification limits of 4 mg kg^?1 and were suitable for rapid quantification of HMF in honey at the strictest regulated level of 15 mg kg^?1. Comparable results were obtained for the 17 honey samples, with a mean deviation of 2.9 mg kg^?1 (15 %). The optimized HPTLC method was proved to be highly matrix-robust and was validated for the 17 different honey matrices (correlation coefficients ≥0.9994 (n?=?6), mean intra-day precision 3.2 % (n?=?3 within a plate; n?=?2 repeated within a day), mean inter-day precision 3.7 % (n?=?3), mean reproducibility over the whole procedure including sample preparation 4.1 % (n?=?2), and mean recovery 106.9 % (n?=?5 different concentrations; n?=?4 different honey matrices). Recovery for a range of different application volumes, and thus for different honey matrix loading, differed by only ≤4.2 %. HMF results when calculated by use of external calibration and by use of the standard addition method varied by 8.8 %. Both revealed that any matrix effect was minor and that the original matrix interference problem was successfully solved.

The sphericity of the diverse 10-vertex polyhedra found in bare post-transition metal clusters: germanium clusters with interstitial magnesium atoms as model systems

Theoretical studies show that pendant dimethylamino groups can play a significant role in the chemistry of unsaturated binuclear dimethylaminoborole iron carbonyls. For [C₄H₄BN(CH₃)₂]₂Fe₂(CO)₅, the lowest energy structures have single CO bridges and Fe?CFe single bonds of lengths ~2.8 ?. The lowest energy [C₄H₄BN(CH₃)₂]₂Fe₂(CO) _n (n?=?4, 3) structures have two bridging CO groups with Fe=Fe double bonds of lengths ~2.5 ? for n?=?4 and three bridging CO groups with Fe??Fe triple bonds of lengths ~2.2 ? for n?=?3. These structures are similar to structures previously found for the corresponding methylborole derivatives (C₄H₄BCH₃)Fe₂(CO) _n . However, slightly higher energy [C₄H₄BN(CH₃)₂]₂Fe₂(CO) _n (n?=?4, 3) structures are found in which dimethylaminoborole is a six-electron donor bridging ligand using electron pairs from the nitrogen atom as well as from the two C=C double bonds. For the more highly unsaturated [C₄H₄BN(CH₃)₂]₂Fe₂(CO) _n (n?=?2, 1), low energy singlet (n?=?2) and triplet (n?=?1) perpendicular structures are also found with similar bridging six-electron donor dimethylaminoborole ligands. In addition, highly unsaturated [C₄H₄BN(CH₃)₂]₂Fe₂(CO) _n (n?=?3, 2, 1) structures are found with agostic hydrogen atoms bridging an iron?Ccarbon bond.     

Synthesis of polypyrrole–polycaprolactone composites by emulsion polymerization and the electrorheological behavior of their suspensions

Polypyrrole–polycaprolactone (PPy-PCL) composites were synthesized by emulsion polymerization to improve their mechanical and electrical properties by forming conducting polymer composites and hence enhance the electrorheological (ER) response. Various PPy-PCL composite particles were synthesized by controlling the amount of PCL. The ER response increased with increasing electric field strength and particle volume fraction. A power-law dependence, τ?=?Kφ ^m E ⁿ , showed a good fit to the yield stresses when m?=?2 and n?=?1.5. The dependence of E ^1.5 is consistent with the conduction model and the dependence of φ ² appears to be related to structural changes with the electric field, which leads to many-body interactions between the particles. The ER response also increased with increasing amount of PCL, but the dielectric properties and dc conductivities of the PPy-PCL composite particles and the dielectric properties of the PPy-PCL composite suspensions were not consistent with the ER behavior. However, the particle diameter increased with the increasing amount of PCL, which is consistent with the ER behavior. The ER behavior of various amounts of PCL fits τ?=?85.12d ⁴ E ^3/2 quite well. The proportionality of d ⁴ appears to be due to the many-body interactions between the particles.     

Peptide nucleic acid molecular beacons for the detection of PCR amplicons in droplet-based microfluidic devices

The use of droplet-based microfluidics and peptide nucleic acid molecular beacons for the detection of polymerase chain reaction (PCR)-amplified DNA sequences within nanoliter-sized droplets is described in this work. The nanomolar–attomolar detection capabilities of the method were preliminarily tested by targeting two different single-stranded DNA sequences from the genetically modified Roundup Ready soybean and the Olea europaea genomes and detecting the fluorescence generated by peptide nucleic acid molecular beacons with fluorescence microscopy. Furthermore, the detection of 10 nM solutions of PCR amplicon of DNA extracted from leaves of O. europaea L. encapsulated in nanoliter-sized droplets was performed to demonstrate that peptide nucleic acid molecular beacons can discriminate O. europaea L. cultivar species carrying different single-nucleotide polymorphisms.

Chromosomal organization of simple repeated DNA sequences used for DNA fingerprinting

Stretches of short, simple DNA sequences are widespread in all eukaryote genomes studied so far. Simple sequences are thought to undergo frequent expansion and deletion due to intrinsic genomic mechanisms. Some of the simple sequences were used successfully to detect hypervariable loci in various genomes. Hybridization experiments using synthetic probes not only revealed the informative simple repeats suitable for DNA fingerprinting in a particular species, but also reflected the wide range of distribution of the simple sequences among eukaryotes. The organization of these simple repetitive sequences at the chromosomal loci was investigated using in situ hybridization with chemically synthesized, pure oligonucleotide probes. Both biotin- and digoxigenin-attached probes detected specific chromosomal sites that are enriched in the respective simple-repeat blocks. Depending on the organism and probe used, accumulation of simple DNA sequences at individual or multiple sites on the chromosomes of different vertebrates could be demonstrated. The simple repetitive DNA sequences are located in different chromosomal regions (e.g., heterochromatin on the sex chromosomes, nucleolus organizer regions, and R-band sites), which are constrained considerably during evolution.     

Interactions of two homologues of cationic surface active ionic liquids with sodium carboxymethylcellulose in aqueous solution

In the preceding paper of this series, we studied the interactions of copolymers with the ionic liquids, 1-alkyl-3-methylimidazolium bromide (C _n mimBr, n?=?8, 10, 12, 14, 16) and N-alkyl-N-methylpyrrolidinium bromide (C _n MPB, n?=?12, 14, 16). An obvious difference was detected between the interaction mechanism and the alkyl chain length of the surfactant. In the present study, we performed a systematic study on the interaction of sodium carboxymethylcellulose (NaCMC) with ionic liquids in aqueous solution by isothermal titration microcalorimetry (ITC), conductivity, turbidity, and dynamic light scattering (DLS) measurements. The existence of electrostatic attraction between NaCMC and ILs could increase the complexity of these systems. The results show that the monomers of C₈mimBr can bind to the NaCMC chains and form free surfactant micelles in the solution, while no micelle-like C₈mimBr/NaCMC cluster is detected. For other surfactants, the formation of surfactant/NaCMC clusters in the solution is driven by electrostatic and hydrophobic interactions, which could be divided into two types. One type is the polymer-induced surfactant/NaCMC complexes that form in the solution for the surfactant of C _n mimBr (n?=?10, 12, 14) or C _n MPB (n?=?12, 14). The other type is that the surfactant-induced surfactant/NaCMC complexes come into being for the surfactant of C₁₆mimBr or C₁₆MPB. Finally, the different modes of complex formation proposed have a good interpretation of the experiment results, unraveling the details of the effect of surfactant alkyl chain length and headgroup on the surfactant–NaCMC interactions.     

Peroxidase activity-structure relationship of the intermolecular four-stranded G-quadruplex-hemin complexes and their application in Hg ion detection

The peroxidase activities of the complexes of hemin and intermolecular four-stranded G-quadruplexes formed by short-stranded X_nG_mX_p sequences (X = A, T or C), especially T_nG_mT_p sequences, were compared. The results, combining with those of circular dichroism (CD) spectra and acid-base transition study for DNA-hemin complexes, provide some important information about DNAzymes based on G-quadruplex-hemin complexes, such as the formation of a G-quadruplex structure is an important factor for determining whether a DNA sequence can enhance the catalytic activity of hemin; both intramolecular parallel G-quadruplexes and intermolecular four-stranded parallel G-quadruplexes can enhance the catalytic activity of hemin; the addition of T nucleotides to the 5′-end of a G-tract confers corresponding G-quadruplex greatly enhanced catalytic activity, whereas the addition of T nucleotides to the 3′-end of the G-tract has little effect; the high catalytic activity of hemin in the presence of some short-stranded G-rich sequences may be a result of the reduction of the acidity of the bound hemin cofactor. These studies provide more information for the DNA-hemin peroxidase model system, may help to elucidate the structure-function relationship of peroxidase enzymes and to develop novel, highly efficient peroxidase-liking DNAzymes. As a sequence of such an investigation, a new Hg²⁺ detection method was developed.     

Genome Mining of Pseudomonas Species: Diversity and Evolution of Metabolic and Biosynthetic Potential

Microbial genome sequencing has uncovered a myriad of natural products (NPs) that have yet to be explored. Bacteria in the genus Pseudomonas serve as pathogens, plant growth promoters, and therapeutically, industrially, and environmentally important microorganisms. Though most species of Pseudomonas have a large number of NP biosynthetic gene clusters (BGCs) in their genomes, it is difficult to link many of these BGCs with products under current laboratory conditions. In order to gain new insights into the diversity, distribution, and evolution of these BGCs in Pseudomonas for the discovery of unexplored NPs, we applied several bioinformatic programming approaches to characterize BGCs from Pseudomonas reference genome sequences available in public databases along with phylogenetic and genomic comparison. Our research revealed that most BGCs in the genomes of Pseudomonas species have a high diversity for NPs at the species and subspecies levels and built the correlation of species with BGC taxonomic ranges. These data will pave the way for the algorithmic detection of species- and subspecies-specific pathways for NP development.     

Comparative and evolutionary studies of mammalian arylsulfatase and sterylsulfatase genes and proteins encoded on the X-chromosome

At least 19 sulfatase genes have been reported on the human genome, including four arylsulfatase (ARS) genes (ARSD; ARSE; ARSF; ARSH) and a sterylsulfatase (STS) gene located together on the X-chromosome. Bioinformatic analyses of mammalian genomes were undertaken using known human STS and ARS amino acid sequences to study the evolution of these genes and proteins encoded on eutherian and marsupial genomes. Several domain regions and key residues were conserved including signal peptides, active site residues, metal (Ca²⁺) and substrate binding sequences, transmembranes and N-glycosylation sites. Phylogenetic analyses describe the relationships and potential origins of these genes during mammalian evolution. Primate ARSH enzymes lacked signal peptide sequences which may influence their biological functions. CpG117 and CpG92 were detected within the 5′ region of the human STS and ARSD genes, respectively, and miR-205 within the 3′-UTR for the human STS gene, using bioinformatic methods A proposal is described for a primordial invertebrate STS-like gene serving as an ancestor for unequal cross over events generating the gene complex on the eutherian mammalian X-chromosome.