The ETACS European Project for testing the comparability of sensors and analysers: Part II. Field tests

 The results of field tests performed within the European Testing and Assessment of Comparability of On-line Sensors/Analysers (ETACS) European Project are presented in this article. This work is complementary to the laboratory tests, already published in Part I in this Journal. The objective was to consider the complete measuring chain, including the sensor/analyser, sampling elements, pumping and conditioning devices needed for a particular application. These aspects were not included in the laboratory tests and, therefore, new facets were involved. Field tests are considered site specific in terms of the sample dynamic range and matrix composition, as well as event dependent with respect to environmental conditions. A protocol for checking the performance of sensors/analysers working in a field location is presented. The protocol is a general guide and, therefore, can be used independently of the nature of the sensor/analyser under evaluation.     

Environmental research for art conservation (ERA)

The basic concept of this project is to identify and then use the changes which occur in the chemical and physical properties of traditional paint media both to indicate and integrate the effects of environmental conditions on paintings. To achieve this aim, test paint films are being prepared in accordance with traditional artists' recipes. Changes in material properties are monitored using a combination of non-invasive spectroscopy (Bacci), microsensors, thermoanalytical techniques (Odlyha), and microscale analytical mass spectrometry for molecular structure analysis (Boon). The test strips are calibrated by exposure to controlled environments (light, temperature, relative humidity and noxious gases) and alterations in their properties are quantified. This provides information on the nature and rate of change at the molecular level and a data base for evaluating the molecular monitoring strips after their exposure in the field. Field sites have been selected and include various locations in the Tate Gallery (UK), Sandham Chapel (Burghclere, UK), the Uffizi Gallery (It) and the Rijksmuseum (NL). Environmental conditions of some of these locations are being evaluated at present using the glass sensors described in project EV5VCT92 0144. Small piezoelectric quartz crystal humidity sensors will be installed to determine localised variations in relative humidity and temperature on [1] Stanley Spencer paintings in Sandham Chapel and [2] Giotto's Madonna di Ognissanti in the Uffizi Gallery. In addition novel coatings using picture varnishes are being applied to similar piezoelectric quartz crystal sensors to evaluate the effects of environmental impact on the chemistry of varnishes on paintings. Data are also being collected on the nature of chemical and physical changes in varnishes and paint media in actual paintings at the molecular level.Paper presented at the European Commission Workshop in Würzburg (December, 1995) on the project EV5VCT94 0548.     

Modular 'click' sensors for zinc and their application in vivo

Although the central role that zinc plays in many biological processes and important disease states is now well-established, there remains a pressing need to develop an absolute understanding of the underlying biology of zinc trafficking in terms of its dynamic and quantitative processing in specific organelles. Here we describe the modular synthesis of zinc sensors using a 'click' approach and demonstrate the applicability of our new sensors in vivo using a zebrafish model.     

Towards advanced chemical and biological nanosensors-An overview

This paper reviews recent developments in the design and application of two types of optical nanosensor, those based on: (1) localized surface plasmon resonance (LSPR) spectroscopy and (2) surface-enhanced Raman scattering (SERS). The performance of these sensors is discussed in the context of biological and chemical sensing. The first section addresses the LSPR sensors. Arrays of nanotriangles were evaluated and characterized using realistic protein/ligand interactions. Isolated, single nanoparticles were used for chemosensing and performed comparably to the nanoparticle array sensors. In particular, we highlight the effect of nanoparticle morphology on sensing response. The second section details the use of SERS sensors using metal film over nanosphere (MFON) surfaces. The high SERS enhancements and long-term stability of MFONs were exploited in order to develop SERS-based sensors for two important target molecules: a Bacillus anthracis biomarker and glucose in a serum protein mixture.     

Interlaboratory studies of the determination of selected chlorobiphenyl congeners with capillary gas chromatography using splitless- and on-column injection techniques

The Community Bureau of Reference has organized a collaborative interlaboratory project to improve the analytical protocol for some specific chlorobiphenyls (CBs) within the European Community (EC). A series of test procedures were prescribed to optimize the gas chromatographic conditions for splitless and on-column injection, which substantially improved the quality of data. Important parameters included the initial column and injector temperatures and the choice of the polarity of the stationary phase. In a study with cleaned eel-fat extracts, coefficients of variation for reproducibility CV(R) ranging from 11 to 24% at the 0.04–0.3 mg/kg level per CB congener were obtained. No significant difference could be found between splitless- and on-column injection.     

A high-precision ratiometric fluorosensor for pH: implementing time-dependent non-linear calibration protocols for drift compensation

We present a versatile time-dependent non-linear calibration protocol for optical sensors, implemented on the pH sensitive ratiometric fluorophore 8-hydroxypyrene-1,3,6-trisulfonic acid (HPTS) immobilized in ethyl-cellulose. The calibration protocol individually compensated for the progressive drift of calibration parameters, whereby sensor precision and accuracy, as well as applicable lifetime were improved. A severely reduced photoacidity was observed for the immobilized fluorophore, for which excited state dynamics was characterized and benefited from during measurements. Due to the significantly reduced photoacidity of HPTS immobilized in the ethyl-cellulose sensing membrane, a dual excitation/dual emission (F₁, ex/em: 405/440 nm and F₂, ex/em: 465/510 nm) ratiometric (RF₁,F₂ = F₁/F₂) sensing scheme could be used to amplify sensor response. The signal to noise (S/N) ratio was enhanced by ∼400% utilizing the dual excitation/dual emission ratiometric sensing scheme, rather than the more commonly used protocol of dual excitation/single emission for HPTS fluorescence. Apparent pK_a of the fluorophore ranged from 6.74 to 8.50, mainly determined by the immobilization procedure. The repeatability (IUPAC, pooled standard deviation) over three pH values (6.986, 7.702 and 7.828) was 0.0044 pH units for the optical sensor, compared to 0.0046 for the electrode used for standardization. Sensor analytical characteristics were thereby in principle limited by the performance of the standardization procedure.     

Experimental design for in-house validation of a screening immunoassay kit. The case of a multiplex dipstick for Fusarium mycotoxins in cereals

The benefits of using rapid qualitative methods to verify compliance of food and feed with legislation requirements include user-friendly format, the possibility of detection without expensive instrumentation, rapid response and affordable price. Prior to their use, however, the methods have to pass validation experiments, in order to assess their performance profile. An experimental protocol for in-house validation of a screening immunoassay has been designed and applied to evaluate performance characteristics of a multiplex dipstick kit for the determination of major Fusarium toxins, namely zearalenone, T-2 and HT-2 toxins, deoxynivalenol and fumonisins in wheat and maize. The test is intended for screening of cereals on the presence/absence of these mycotoxins at maximum permitted levels established by European legislation or target levels. The response of the measurement is determined with a reader device. Samples classified as negative are considered as compliant, whereas positive samples need to be re-analysed with confirmatory methods. The in-house validation design consisted of three steps, namely (1) estimating the precision of the method including "between day" effects and influences from different varieties of the matrices, (2) establishing robust cutoff values for the dipstick response at target mycotoxin levels assuming an acceptable rate of false negative results of 5 % and (3) assessment of the rate of false positive results of blank samples and samples containing the target analytes below the legal limits. The total precision expressed as relative standard deviation and determined individually for each analyte/concentration/matrix combination varied from 9 to 30 % and was considered as acceptable. In 17 out of 28 cases, the repeatability standard deviation was the most important factor. The predominance of the repeatability compared to the other factors (matrix, days) was an indicator for the ruggedness of the assay. The validation study demonstrated that the test was able to differentiate blank samples from samples contaminated at target mycotoxin levels with a false positive rate lower than 6 %. Considering realistic mycotoxin occurrence in European samples, significant economical benefits can be expected when using the test under real-world conditions.

An ultra-sensitive online SPE-LC-MS/MS method for the quantification of levonorgestrel released from intrauterine devices

A selective and sensitive liquid chromatography-tandem mass spectrometry method for the determination of very low levonorgestrel (d-(−)-norgestrel) serum levels such as those found in patients using levonorgestrel-releasing intrauterine devices (IUDs) was developed. To achieve the sub-nanomolar sensitivity needed to measure such serum levels, a diethyl ether extraction sample preparation protocol was applied prior to the online solid-phase extraction-liquid chromatography-tandem mass spectrometry (SPE-LC-MS/MS) assay. Analyte quantification from the selected reaction monitoring experiments relied on the use of sixfold deuterated norgestrel as internal standard. The final method was linear up to 1.50 ng/ml with a lower limit of quantification (LLOQ) of 0.05 ng/ml. It was found to be precise and accurate with imprecision <8% and bias <6% assessed at three control levels. Total analyte recovery measured in patient pools at three concentration levels was found to exceed 92%. Matrix interferences were excluded by post-column analyte infusion experiments. As a proof of concept, a set of IUD patient serum samples was screened for their levonorgestrel content. A total of 97.5% (n = 94) of the samples did show serum levels exceeding the LLOQ, proving the applicability of the assay in relevant clinical cohorts. This method must not be used for diagnostic or therapeutic purposes, since it did not undergo formal performance evaluation in the sense of the in vitro diagnostic directive (98/79/EG) of the European community.     

Piezoelectric Immunosensors for Environmental Monitoring

This article is a tutorial review of piezoelectric immunosensors and their application to environmental monitoring.

The basic theory and historical developments of piezoelectricity are introduced. The development of piezoelectric sensors and eventually immunosensors for the specific detection of analytes of environmental importance are mentioned. The various assay formats and their advantages as well as examples of the different approaches taken by different analysers are also mentioned. Current developments within this laboratory on the development of piezoelectric immunosensors for the detection of okadaic acid and microcystin-LR are briefly introduced. The major drawbacks of piezoelectric immunosensors and their potential future are also discussed.     

Validation of a Biacore method for screening eight sulfonamides in milk and porcine muscle tissues according to European decision 2002/657/EC

Sulfonamides are commonly used for prophylactic or therapeutic purposes in veterinary medicine. A maximum residue limit (MRL) for sulfonamides has been set at 100 microg/kg in milk and muscle. A multisulfonamide antibody was used for the development of 2 different Biacore protocols, one for the screening of milk samples, the other for muscle samples. Two different Biacore systems were used: Biacore X system (milk protocol), which is considered a research and development apparatus, and Biacore 3000 system (muscle protocol), which is a completely automated system used for high-throughput screening. This report describes the validation of semiquantitative immunological methods according to the European Decision 2002/657/EC "concerning the performance of analytical methods." The different performance characteristics (detection capability CCbeta, specificity/selectivity, precision, stability, and applicability) were determined in relation to the European Union MRL of 100 microg/kg for sulfonamides. The applicability of the method to porcine, bovine, and poultry muscle was studied. The detection capabilities CCbeta were calculated to be 40 microg/L in milk and 60 microg/kg in porcine, bovine, and poultry muscles. Eight different sulfonamides, of which 3 (sulfamethazine, sulfamerazine, and sulfadiazine) are authorized in France, were detected simultaneously, at or below the MRL level, with both Biacore systems.     

Optical sensing based on analyte recognition by enzymes,carriers and molecular interactions

Despite the tremendous variety of methods suitable for sensing applications, we face the fact that chemical sensors displaying sensitivity, selectivity and reversibility are still scarce and are mostly confined to low-molecular-weight species. Obviously, it is not the lack of optical (or other) transduction methods that limit the performance of present day sensor desingns, but rather the insufficient selectivity of the recognition process, particularly in the field of sensors for organic and bioorganic species. The use of enzymes, ion carriers and natural or synthetic receptor/carriers which can under go specific interactions with the species to be recognized (such as through hydrogen bonding or charge-transfer interaction) can result in specific recognition and, consequently, sensing. Examples for optical sensing schemes for clinically or biologically important species including enzyme substrates, metabolites, drugs, alkali and ammonium ions and other will be given. In enzyme-based sensors various options exist: depending on which species is immobilized, assays for substrates (such as glucose, ethanol, lactate or creatine), enzymes (such as esterases) or inhibitors (such as organophosphates) can be designed. In addition, the intrinsic optical properties of certain enzymes, coenzymes or metabolites can be utilized for sensing purposes, a fact that presents an interesting alternative to enzyme sensors with chemical transducers.Notwithstanding the selectivity of biocatalytic sensors, their stability and sensitivity is moderate. Bioorganic synthetic molecules which can recognize and reversibly bind other species offer an attractive alternative, particularly in terms of stability. However, quite a different situation is found in such cases because receptors, in contrast to enzymes, do not “digest” their substrates. Hence, while the steady-state response in enzyme-based sensors is a result of kinetic equilibration, substrate binding in non-metabolizing receptors results in thermodynamic equilibration. However, most existing receptors (except antibodies) lack the unique specificity of enzymes. On the other side, new bioorganic molecules and stable receptor/carriers along with polymer materials of proper permeation selectivity can help to overcome current limitations of protein-based systems. Neutral ion carriers, which may be considered as ion receptors, are a useful example of sometimes highly specific recognition/carrier molecules with excellent stability. Unfortunately, no receptor /carrier molecules of similar specificity do exist yet for most other organic and clinical parameters of interest. There is an obvious need for new and stable molecules suitable for specific recognition of low-molecular weight organic species.We will report on the use of such new receptor/carrier molecules, the respective sensor materials, and how the process of recognition can be coupled to optical transduction. Such receptors/carriers also allow other kinds of discriminations: if, for instance, it is enantio-selective (i.e. preferably binds one species out of a pair of optical isomers), a fairly specific recognition of enantiomers of biogenic amines (such as some drugs and biogenic amines) will become possible. Specific examples will also be given of new types of sensors based on recognition by charge-transfer interaction, through-space interaction and hydrogen bonding, with fair specificity for thiamine, penicilline, nitrate, salicylate and cholic acids. Finally, current problems and the significant challenges for sensors research in the 1990s will be discussed.     

Stability of a NDIR analyser for CO2 at atmospheric concentration

Carbon dioxide monitoring is significant in the environmental field since this gas plays an important role in the greenhouse effect. In order to determine CO2 concentration and to develop simulation models, it is necessary to carry out measurements which are accurate and comparable in time and space, i.e. SI-traceable. Non-dispersive infrared (NDIR) analysers are employed for CO2 measurements, as they are precise and stable. In order to achieve traceability, such instruments have to be characterized and calibrated. At the Istituto di Metrologia "G. Colonnetti"--CNR, a procedure for calibrating NDIR analysers for CO2 at atmospheric level was developed, which enables to calculate a correction for the analyser output. In addition, a complete uncertainty analysis was carried out and a correct traceability chain was established. The goal of the present work is the study of the stability of a NDIR analyser by repeating calibrations during three years and comparing the correction curves obtained to identify a proper re-calibration interval for such analysers. The investigated instrument has good repeatability and reproducibility, hence satisfactory stability during time, as shown by the short-term and long-term compatibility of calibration curves.     

Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of Ephedra-Containing Products

Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra-containing products.     

Silicon nanowires as field-effect transducers for biosensor development: A review

The unique electronic properties and miniaturized dimensions of silicon nanowires (SiNWs) are attractive for label-free, real-time and sensitive detection of biomolecules. Sensors based on SiNWs operate as field effect transistors (FETs) and can be fabricated either by top–down or bottom–up approaches. Advances in fabrication methods have allowed for the control of physicochemical and electronic properties of SiNWs, providing opportunity for interfacing of SiNW-FET probes with intracellular environments. The Debye screening length is an important consideration that determines the performance and detection limits of SiNW-FET sensors, especially at physiologically relevant conditions of ionic strength (>100 mM). In this review, we discuss the construction and application of SiNW-FET sensors for detection of ions, nucleic acids and protein markers. Advantages and disadvantages of the top–down and bottom–up approaches for synthesis of SiNWs are discussed. An overview of various methods for surface functionalization of SiNWs for immobilization of selective chemistry is provided in the context of impact on the analytical performance of SiNW-FET sensors. In addition to in vitro examples, an overview of the progress of use of SiNW-FET sensors for ex vivo studies is also presented. This review concludes with a discussion of the future prospects of SiNW-FET sensors.     

Hapten immobilization for antibody sensing using a dynamic modification protocol

Optical fiber (OF) sensors are often limited by the immobilization technique used to associate a specific sensing ligand with the OF surface. This is particularly true when the ligand is biologically active as, for example, in the case of immobilized haptens or antibodies. The dynamic modification protocol is a regenerable and experimentally simple way to immobilize a variety of sensing molecules on an OF surface. Furthermore, the protocol is immune to hydrolysis and not limited by diffusion through a membrane or sol–gel. In this publication the approach is extended by immobilizing the hydrophobic hapten (octadecyl 6-(2,4 dinitrophenyl)aminohexanoic acid) as a means to prepare an OF sensor for antibodies specific for 2,4 dinitrophenyl (DNP). The LOD for anti-DNP is 0.5 nanomolar and the K_apparent is 1.0±0.2×10⁶. Nonspecific antibody adsorption is problematic in this sensing approach and was found to limit the quantitative capabilities of the sensor. However, time discrimination can be used to allow the nonspecific antibody to desorb prior to measurement thus minimizing the influence of nonspecific binding on sensor performance.     

Portable multi-amplified temperature sensing for tumor exosomes based on MnO2/IR780 nanozyme with high photothermal effect and oxidase-like activity

Efficient determination of tumor exosomes using portable devices is crucial for the establishment of facile and convenient early cancer diagnostic methods. However, it is still challenging to effectively amplify the detection signal to achieve tumor exosomes detection with high sensitivity by portable devices. To address this issue, we developed a portable multi-amplified temperature sensing strategy for highly sensitive detecting tumor exosomes based on multifunctional manganese dioxide/IR780 nanosheets (MnO₂/IR780 NSs) nanozyme with high oxidase-like activity and enhanced photothermal performance. Inspiringly, MnO₂/IR780 NSs were synthesized via a facile one-step method with mild experimental conditions, which not only exhibited a stronger photothermal effect than that of MnO₂ but also showed excellent oxidase-like activity that can catalyze the oxidation of 3,3′,5,5′-tetramethylbenzidine (TMB) to generate TMB oxide (oxTMB) with a robust photothermal property, thus conjoining with MnO₂/IR780 NSs to further enhance the temperature signal. The present assay enables highly sensitive determination of tumor exosomes with the detection limit down to 5.1 × 10³ particles/mL, which was comparable or superior to those of the most previously reported sensors. Furthermore, detection of tumor exosomes spiked in biological samples was successfully realized. More importantly, our method showed the recommendable portability, robust applicability, and easy manipulation. By taking advantages of these features, this high-performance photothermal sensor offered a promising alternative means for nondestructive early cancer diagnosis and treatment efficacy evaluation.     

Non-stochastic sampling error in quantal analyses for Campylobacter species on poultry products

Using primers and fluorescent probes specific for the most common food-borne Campylobacter species (Campylobacter jejuni and Campylobacter coli), we developed a multiplex, most probable number (MPN) assay using quantitative PCR (qPCR) as the determinant for binomial detection: i.e., number of p positive pathogen growth responses out of n?=?6 observations each of 4 mL (V) per dilution. Working with media washes of thrice frozen-thawed chicken pieces which had been spiked with known levels of C. jejuni and C. coli, we found that about 20 % of the experiments had a significant amount of error in the form of either greater than 25 % MPN calculation error (Δε) and/or a low apparent recovery rate (R less than 1?=?MPN observed ÷ CFU spiked). Assuming such errors were exacerbated by an excessively small n, we examined computer-generated MPN enumeration data from the standpoint of stochastic sampling error (Δ) and found that such binomial-based assays behaved identically to Poisson-based methods (e.g., counting data) except that fewer technical replicates (n) appeared to be required for the same number of cells per test volume (μ). This result implies that the qPCR detection-based MPN protocol discussed herein should accurately enumerate a test population with a μ?≥?1 using n?=?6 observations per dilution. For our protocol, this equates to ≥?8 cells per 400–500 g of sampled product. Based on this analysis, the error rate we saw in spiked experiments (where μ >?>?1) implied a non-stochastic source. In other experiments we present evidence that this source was, at least in part, related to the cell concentration step (i.e., centrifugation). We also demonstrate that the error rate lessened (from ～38 % to ～13 %) at lower Campylobacter levels (μ?≤?40) as would most likely exist in nature. Using this protocol, we were able to quantify 14 to 1,226 MPN per 450 g of naturally contaminated chicken for skinless pieces and 11 to 244 MPN per 450 g for wings, breasts, legs, and thighs (skin on) whereupon about 50 % of the 29 samples tested negative for both species. Four of these chicken wash samples did have substantially lower Campylobacter levels (1 to 6 MPN per 450 g) which might be better enumerated using a larger n. However, we established that the limit of quantification of this protocol diminishes for n?>?6 because one is ever more diluting the sample, or lessening V, to achieve the requisite n.     

Matching reference materials with AOAC International methods of analysis

Proper implementation and use of validated analytical methodology with use of appropriate reference materials (RM) is a preferred means of helping to ensure equivalent analytical method performance in diverse laboratories. Choice of an appropriate RM that not only matches the analyte and matrix of the required determination, but also has been demonstrated to be within the applicability of a specific analytical method, are key factors. In response to numerous requests since its founding in 1993, the Technical Division on Reference Materials (TDRM), AOAC International is implementing a program for recognizing the matching of specific reference materials to specific AOAC methods of analysis. This recognition is accomplished by means of a thorough peer-reviewed selection system, under the auspices of the AOAC official methods board and the executive committee of the TDRM. Potential RM/method matching (RM/MM) proposals will be submitted to an RM/MM committee. After technical review of the suitability of the proposed RM by the RM/MM committee, acceptable matches are recommended for review by the current AOAC process responsible for review and recognition of new methods and modifications to existing AOAC methods of analysis. Several trial matches have been used to develop and test this system. The end product of this effort will ultimately be made available as either a stand-alone document, a section of the AOAC Official Methods of Analysis, or a site within the AOAC web site listing recognized matches.     

Ag@Au core/shell triangular nanoplates with dual enzyme-like properties for the colorimetric sensing of glucose

Due to the serious harm of diabetes to human health, development of sensitive assays for glucose level is of high significance for early prevention and treatment of diabetes. Currently, most conventional enzyme-based glucose sensors suffer from high cost and low stability due to the inherent defects of natural enzymes. Herein, we develop a pure nanozyme-based glucose detection method using Ag@Au core/shell triangular nanoplates (TNPs), which combines glucose oxidase (GOD)- and horseradish peroxidase (HRP)-like activities of the Au shell and inherent plasmonic properties of Ag TNPs. The sensing mechanism is based on the fact that the Au shell possessed GOD-like activity, enabling the oxidation of glucose to produce H₂O₂, which can further etch the silver core, leading to the decrease of absorbance at 800 nm and the color change from blue to colorless. Compared with the previous nanozymes-based glucose sensors, our method avoids the use of enzymes and organic chromogenic agent. Moreover, the stability of the Ag@Au core/shell TNPs is much better than that of Ag TNPs due to the protection by the coating of the Au shell. This method was successfully applied to the detection of urine samples from patients with diabetes, indicating its practical applicability for real sample analysis.