共查询到20条相似文献,搜索用时 15 毫秒
2.
A new morphinandienone alkaloid, fissistigmine A ( 1), together with three known alkaloids ( 2? 4), were isolated and identified from the stems of Fissistigma tungfangense. Among them, fissistigmine A ( 1) represents the first example of a novel naturally occurring morphinandienone alkaloid with a unique cleavage of the C-9?N-17 bond. All isolated compounds were evaluated for their anti-rheumatoid arthritis activities via examining their anti-proliferative effects on synoviocytes in vitro. Compound 1 exhibited inhibitory effect on the proliferation of synoviocytes with an IC 50 value of 114.6 ± 2.2 μM. 相似文献
3.
Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra-containing products. 相似文献
4.
An effective method utilising pressurised fluid extraction (PFE) to simultaneously extract polycyclic aromatic hydrocarbons (PAHs) and their polar oxidation products from atmospheric particulate matter (PM) is presented. The PFE method is advantageous over the traditional Soxhlet extraction due to its lower solvent consumption (9 mL compared to 90 mL) and shorter extraction time (15 min versus 18 h). Seventy compounds including PAHs and polar PAH oxidation products containing carbonyl (oxy-PAHs), hydroxyl (hydroxy-PAHs), and carboxylic acid (carboxy-PAHs) groups were targeted in the extraction of two different PM matrices: wood smoke (WS) and diesel exhaust (DE) PM. The PFE method was optimised and then compared to Soxhlet extraction for both PM matrices. The overall amounts of PAHs and their derivatives extracted from WS PM were slightly higher for the optimised PFE method (1849 ± 21 and 1863 ± 25 µg g ?1 with dichloromethane (DCM) and methanol (MeOH), respectively) than those obtained with Soxhlet extraction (1726 ± 33 and 1769 ± 22 µg g ?1 with DCM and MeOH, respectively). For DE PM (standard reference material (SRM) 2975) the overall amounts extracted by both methods were similar (average of 165 ± 6 µg g ?1), agreeing with previously published values. The detailed evaluation of extraction efficiencies for WS PM showed similar amounts for unfunctionalised PAHs (1100 µg g ?1) for both methods and solvents. For DE PM the mass yields for PAHs using PFE with DCM (62 ± 1 µg g ?1) were the highest and nearly 20% higher than those obtained with MeOH (53 ± 2 µg g ?1). The total mass yields of carboxy and hydroxy-PAHs from WS PM were also similar (412 ± 18 and 407 ± 11 µg g ?1) for PFE and Soxhlet with MeOH, and higher than when DCM was used (371 ± 5 and 379 ± 12 µg g ?1 for PFE and Soxhlet, respectively). For both matrices, the PFE yields for oxy-PAHs were higher than those obtained with Soxhlet. 相似文献
5.
The volatile components extracted from the headspace (HS) of Achillea ligustica All. samples and their separated organs using solid phase microextraction (SPME) were investigated by gas chromatography and gas chromatography-mass spectrometry. Fiftyseven compounds were identified, the main components were camphor (14.2–29.8%), artemisia ketone (0.3–26.7%), santolina alcohol (0.5–9.4%), camphene (3.0–9.0%) and trans-sabinyl acetate (1.6–5.5%). Moreover, the chemical composition of Corsican and Sardinian A. ligustica oils obtained from flowers and leafy stems harvested in four regions of both islands, were investigated. Two collective oils of A. ligustica were also investigated, comparison between both oils as well as from data literature were reported. A comparison of hydrodistillation and HS-SPME extraction of volatile components in term of isolation time, plant-consuming and chemical composition was discussed. HS-SPME technique was clearly fast in contrast to hydrodistillation (90 min/300 min). HS extraction was performed with a much smaller amount of plant than hydrodistillation. Although the aromatic profiles of HS-fractions and oils showed several quantitative differences HS-SPME can be applied to routine control analysis of aromatic and medicinal plants. 相似文献
6.
The intact plant parts and genetically modified hairy root clone #TpA6 of Tagetes patula were extracted with supercritical fluid CO2 extraction (SFE) and a conventional solvent extraction. SFE optimization included the variation of fluid CO2 pressure, dynamic time, and the addition of methanol modifier co-solvent. The four characteristic thiophene metabolites, 5-(3-buten-1-ynyl)-2,2′-bithienyl (BBT), 2,2′:5′,2″-terthiophene (α-T), 5-(4-acetoxy-1-butynyl)-2,2′-bithienyl (BBTOAc), and 5-(3,4-diacetoxy-1-butynyl)-2,2′-bithienyl [BBT(OAc)2], were analysed by GC–MS. The proposed SFE method allowed the selective extraction of thiophenes in 60 min dynamic time with supercritical CO2 without modifier co-solvent, at 30 MPa and 40 °C. The SFE and the reference solvent extraction yielded similar results. The SFE of intact roots and flowers yielded 717 ± 31.3 and 480 ± 26.6 μg g−1 α-T, respectively, while the leaves did not contain considerable amounts of thiophenes. Remarkable amounts of BBT, BBTOAc, and BBT(OAc)2 were characteristic of the SFE of hairy root cultures. 相似文献
7.
A recently developed hydrodistillation–solvent microextraction (HD–SME) method coupled to gas chromatography–mass spectrometry (GC–MS) was applied to the analysis of volatile components of aerial parts of Echinophora cinerea (Boiss). By the use of a simplex optimization method, the effects of extraction time, sample weight and microdrop volume on the extraction efficiency of the method were optimized. In the optimized conditions, 3 µL of n-heptadecane was suspended in the headspace of 6 g of hydrodistillating sample, using a microsyringe. After 7 min, the solvent was retracted back into the syringe and directly injected into the GC–MS injection port. The HD–SME method was compared to a conventional hydrodistillation technique. In general, the extraction with HD–SME was relatively faster and required smaller amounts of sample. The microextraction method also showed some selectivity towards α-phellandrene and Z-β-ocimene monoterpenes. A precision better than 6.5% (expressed as relative standard deviation) was obtained for the method. 相似文献
8.
Elsholtzia densa Benth. is a traditional aromatic herb used in the pharmaceutical and flavouring industries. To analyse and compare the chemical composition, the oils and nonvolatile compounds in E. densa and Mosla chinensis Maxim. were extracted via hydrodistillation, solvent extraction or ultrasound-assisted extraction. Seventy-three volatile compounds in the volatile oil (0.35 ± 0.06%) obtained by E. densa via hydrodistillation were investigated by gas chromatography–mass spectrometer and compared based on different parameters. Also, the antioxidant activity and α-glucosidase inhibitory effects of the five sub-fractions of the methanolic extract were studied and the ethyl acetate sub-fraction (EC 50 = 7.9 μg/mL) and petroleum ether sub-fraction (EC 50 = 0.0955 mg/mL) showed the strongest activity, respectively. This study has provided a scientific basis for scientific collection, effective development, use of E. densa Benth., and suggested that it can be used as a potential source of antioxidants in food and a potential candidate for the management of type 2 diabetes mellitus. 相似文献
9.
Abstract Butylidenephthalide is one of the major active components isolated from Rhizoma Chuanxiong. This paper describes a simple, rapid, specific and sensitive method for the quantification of butylidenephthalide in rat plasma and tissue distribution using a liquid-liquid extraction procedure followed by capillary gas chromatography-selected ion monitoring mode-mass spectrometry (GC-SIM-MS) analysis. The calibration curves were linear over the concentration ranging from 0.02–10.0 µg/mL (r > 0.99) for plasma samples and 0.18–7.25 µg/g (r > 0.99) for the tissue samples. The limit of quantification (LOQ) was 1.0 ng/mL or 1.0 ng/g (ten times signal/noise ratio). Within- and between-day precisions expressed as the relative standard deviation (RSD) for the method were 2.39–2.98% and 2.97–4.26%, respectively. The methods of recovery for all samples were greater than 80% at the low, medium, and high concentrations. The method has been successfully applied to a pharmacokinetics study in rats after an oral administration of Butylidenephthalide with a dose of 20.0 mg/kg. The main pharmacokinetic parameters obtained were T max = (0.22 ± 0.06) h, C max = (3 ± 1) µg/mL, AUC = (32 ± 6) h?µg/mL, and K a = (8.5 ± 0.8)/h. The results showed that the butylidenephthalide was easily absorbed. The concentrations of butylidenephthalide in rat kidney, lung, heart, and cerebellum were higher than those in other organs. To determine free fraction in serum, samples were filtered using ultrafiltration membranes with a molecular weight cut-off of 10,000 Da and extracted using liquid-liquid extraction. The extracts were evaporated and analyzed by GC-MS. The protein binding in rat plasma, human plasma, and human serum albumin were 83 ± 4%, 94 ± 3%, and 89 ± 3%, respectively. 相似文献
10.
The emergence and prevalence of
multi-drug-resistant bacterial strains increase the potential for outbreaks of incurable infections. The discovery of novel antibiotics and pharmacological preparations requires the identification of novel bioactive small molecules. A specific, sensitive, and reliable quantification method using high-performance liquid chromatography (HPLC) with UV detection was developed for the determination of total persipeptides (A and B), which are cyclic pentapeptides found in the fermentation broth of Streptomyces zagrosensis UTMC 1154 that exhibit bioactivity against methicillin-resistant Staphylococcus aureus (MRSA). A simple liquid–liquid extraction (LLE) method using butanol was employed to extract persipeptides from the fermentation broth prior to HPLC analysis. The chromatographic separation of persipeptides and the internal standard, virginiamycin, was achieved with a gradient of acetonitrile and water on a C18 reversed-phase analytical column in a 25-min analytical run utilizing a flow rate of 0.8 mL min−1 and detection at 210 nm. The whole assay was validated, and the method presented a linear response range with a regression coefficient of determination R
2 of 0.9996 for the quantification of persipeptides in the concentration range of 3.9–250.0 µg mL−1, as well as extraction recoveries ranging from 54.78 ± 9.83 % to 56.45 ± 16.33 %. The bias and the precision of the proposed method were <10 %. The detection and quantification limits for the persipeptides were 27 and 83 µg L−1, respectively. 相似文献
11.
In this work, a novel method based on ultrasonic-assisted nebulization extraction coupled with solid phase extraction (UANE-SPE) and determined by high performance liquid chromatography was developed for the determination of triterpenoids in root of Euphorbia pekinensis Rupr. The experimental conditions for the UANE-SPE, such as type of extraction solvent, sample amount, type and amount of sorbent, extraction time and volume of the elution solvent, were examined and optimized. The method was successfully applied to determine euphol and tirucallol in the dried root of E. pekinensis Rupr. The recoveries of the analytes were in the range of 89.1–102.0 %. The limits of detection were 12 μg g−1 for tirucallol and 10 μg g−1 for euphol. The extraction yields obtained by the proposed method are higher than those obtained by the conventional extraction methods, such as reflux and ultrasonic-assisted extraction. Compared with the traditional methods, the proposed method can reduce the consumption of the labor, shorten the sample preparation time and increase the efficiencies in the extraction of active constituents from plant materials. 相似文献
12.
The aim of this research was to determine the chemical composition, antioxidant and antibacterial properties of the essential oils from Cynanchum chinense and Ligustrum compactum and isolation of antioxidant and antibacterial constituents from the essential oils. Thirty-eight components were identified in essential oils. Based on bioactivity-guided fractionation, guaiacol, linalool and 2-phenylethanol were isolated and identified as active constituents. Both L. compactum flower oil and 2-phenylethanol showed high antibacterial performance, with inhibition zone from 22.8 ± 0.8 to 11.9 ± 2.0 mm at highest concentration, and minimum inhibitory concentration values ranging from 0.25% to 1%. In both DPPH and ABTS assay, the active constituent guaiacol (IC 50 = 4.15 ± 0.72 and 9.12 ± 0.98 μg mL ? 1, respectively) exhibited high antioxidant activity, and the oils showed moderate antioxidant activity. These results indicate potential efficacy of active constituents and essential oils of L. compactum and C. chinense to control food-borne pathogenic and spoilage bacteria. 相似文献
13.
Abstract An accelerated solvent extraction (ASE) method has been developed for the determination of polycyclic aromatic hydrocarbons (PAHs) present in both atmospheric particulate and gaseous phases in this study. Extraction parameters such as the combination of solvents, extraction temperature, and static extraction time were investigated and optimized. Effective extraction was achieved using a 3:1 mixture of n-hexane and acetone as extraction solvents at 100°C in 30 min for all the compounds studied. The optimized extraction method was compared with conventional extraction methods and validated using National Institute of Standards and Technology (NIST)–certified standard reference material (SRM) 1649a. The recoveries obtained for certified 12 PAHs were in the range of 82–126% with relative standard deviation (RSD) between 6 and 28%. The validated ASE technique was used followed by gas chromatography–mass spectrometry (GC-MS) for the determination of PAHs distributed between gaseous and particulate phases in the atmosphere of Singapore. Total average concentrations of PAHs in air samples were 33.54 ± 19.32 ng m ?3, with 4.72 ± 2.80 ng m ?3 in particulate phase and 28.82 ± 16.92 ng m ?3 in gaseous phase, respectively. The results obtained from this study are compared to those reported from other areas of the world. 相似文献
14.
The ultrasonic extraction (UE) method of anthocyanin from Clitoria ternatea flowers using response surface methodology (RSM) was performed in this study. By using RSM, the objective is to optimise the extraction yield of anthocyanin from C. ternatea which is influenced by various factors, including the extraction temperature, time, ratio of solvent to solid and ultrasonic power. The empirical model was investigated by performing first-level optimisation in a two-level factorial design with Design Expert 7 software. In comparison with the conventional solvent extraction, UE showed a 246.48% better extraction yield and produced an anthocyanin extract with a radical scavenging activity of 68.48% at the optimised factors of 50°C, 150 min, 15 mL/g and 240 W. 相似文献
15.
A molecularly imprinted polymer (MIP) was synthesized and evaluated to selectively extract ephedrine from human plasma. The MIP synthesis was performed in chloroform with methacrylic acid as a functional monomer and the target alkaloid as a template molecule. The resulting MIP was applied to the selective extraction of ephedrine from a pure aqueous medium. A recovery about 74% was obtained using the MIP with only 7% on the nonimprinted polymer (NIP). A very straightforward selective SPE procedure was then successfully applied to the direct extraction of ephedrine from spiked human plasma with a high extraction recovery (68%) on the MIP with no recovery on the NIP. Moreover, the MIP was used for the selective extraction of catecholamine neurotransmitters, i.e. adrenaline and noradrenaline. 相似文献
16.
Aiming detection of circadian variation in the chemical composition of volatiles from Piper regnellii, the leaves were collected during four different periods (8, 12, 16 and 20 h) in the same day. After extraction by hydrodistillation and GC/MS analysis, no significant variation was observed for the main compounds: germacrene D (45.6 ± 1.5–51.4 ± 3.1%), α–chamigrene (8.9 ± 1.3–11.3 ± 2.7%) and β–caryophyllene (8.2 ± 0.9–9.5 ± 0.3%). Evaluation of in vitro cytotoxicity against several cancer and non-tumourigenic cells indicated promising activity, especially to HeLa (human cervical carcinoma) with IC 50 ranging from 11 ± 3 to 17 ± 3 μg/mL. The obtained volatile oils were pooled and subjected to fractionation to afford pure β-caryophyllene, α-chamigrene and germacrene D, being this last compound the more active against HeLa cells with IC 50 of 7 ± 1 μg/mL (34 ± 5 μM). Therefore, the predominance of germacrene D in all analysed oils could justify, at least in part, the activity observed for the volatile compounds from P. regnellii leaves. 相似文献
17.
Rapid, inexpensive, and efficient sample-preparation by dispersive liquid–liquid microextraction (DLLME) then gas chromatography with flame ionization detection (GC–FID) have been used for extraction and analysis of BTEX compounds (benzene, toluene, ethylbenzene, and xylenes) in water samples. In this extraction method, a mixture of 25.0 μL carbon disulfide (extraction solvent) and 1.00 mL acetonitrile (disperser solvent) is rapidly injected, by means of a syringe, into a 5.00-mL water sample in a conical test tube. A cloudy solution is formed by dispersion of fine droplets of carbon disulfide in the sample solution. During subsequent centrifugation (5,000 rpm for 2.0 min) the fine droplets of carbon disulfide settle at the bottom of the tube. The effect of several conditions (type and volume of disperser solvent, type of extraction solvent, extraction time, etc.) on the performance of the sample-preparation step was carefully evaluated. Under the optimum conditions the enrichment factors and extraction recoveries were high, and ranged from 122–311 to 24.5–66.7%, respectively. A good linear range (0.2–100 μg L−1, i.e., three orders of magnitude; r
2 = 0.9991–0.9999) and good limits of detection (0.1–0.2 μg L−1) were obtained for most of the analytes. Relative standard deviations (RSD, %) for analysis of 5.0 μg L−1 BTEX compounds in water were in the range 0.9–6.4% (n = 5). Relative recovery from well and wastewater at spiked levels of 5.0 μg L−1 was 89–101% and 76–98%, respectively. Finally, the method was successfully used for preconcentration and analysis of BTEX compounds in different real water samples. 相似文献
18.
The chemical composition of the essential oil from the aerial parts of Anacyclus monanthos subsp. cyrtolepidioides (Pomel) Humphries (Asteraceae) growing in a semi-arid region of Algeria was investigated for the first time. The essential oil was obtained by hydrodistillation and fully characterized by gas chromatography-mass spectrometry (GC-MS). A total of 97 compounds were identified. The essential oil was found to be rich in trans-chrysanthenyl acetate (9.8 ± 2.0%), ( E)-β-farnesene (7.4 ± 1.5%), germacrene D (6.9 ± 1.3%) and myristicin (4.8 ± 0.8%). 相似文献
19.
The concentrations of 2,3,5,4′-tetrahydroxystilbene-2- O-β-d-glucoside, quercetin, catechin, emodin, and polygoacetophenoside in roots, stems and leaves of Polygonum multiflorum, a traditional Chinese medicinal herb, were simultaneously determined by ultra-performance liquid chromatography equipped with electrospray ionization and quadrupole-time-of-flight mass spectrometry (UPLC/ESI-Q-TOF-MS). The established quantitative analysis method has good precision (<2.94%), accuracy (97.21–101.37%), linear correlation coefficient (<0.990), and high sensitivity (0.46?ng/mL). The concentrations of 2,3,5,4′-tetrahydroxystilbene-2- O-β-d-glucoside and emodin were 34.86?±?10.58 and 31.09?±?8.26?mg/g, respectively, in the roots, much higher than that in the stems and leaves, while the concentration of catechin (29.62?±?7.76) was the highest in stems. However, polygoacetophenoside and quercetin are the main components in the leaves: 50.54?±?12.24 and 28.35?±?1.88?mg/g, respectively. The results show that these concentration differences in roots, stems and leaves of P. multiflorum may be associated with the therapeutic effects of this traditional Chinese medicinal herb. This method may be used for the quality evaluation of the different components of P. multiflorum. 相似文献
20.
To reinforce the extraction efficiency of the liquid- and solid-phase microextraction methods, different cooling-assisted setups have been employed, most of which are complicated, expensive, tedious, and do not show good performances due to indirect transfer of cold to the extraction phase. In this research, a simple, low-cost and effective cooling-assisted headspace hollow fiber-based liquid-phase microextraction (CA-HS-HF-LPME) device was fabricated and evaluated, which is able to directly cool down the extraction phase in different modes of LPME. It was coupled to GC-FID and utilized for the direct determination of PAHs in contaminated soil samples using volatile organic solvents. Different effective experimental variables including type and volume of extraction solvent, extraction time and temperature, and temperature of the cooled organic solvent were evaluated and optimized. Under the optimized experimental conditions (e.g., organic extracting solvent: 3 µL of acetone; extraction time: 20 min; extraction temperature: 90 °C; and temperature of cooled organic drop: −25 °C), good linearity of calibration curves (R
2 > 0.99) was obtained in a concentration range of 1–10,000 ng g−1. The limits of detection (LODs) were obtained over the range of 0.01–0.1 ng g−1. The relative standard deviations (RSD%, n = 6) of 0.1 µg g−1 PAHs were found to be 4.7–10.1 %. The CA-HS-HF-LPME-GC-FID method was successfully used for the direct determination of PAHs in contaminated soil and plant samples, with no sample manipulation. The results were in agreement with those obtained by a validated ultrasound-assisted solvent extraction (UA-SE) method. 相似文献
|