Synthesis of Caged Nucleosides with Photoremovable Protecting Groups Linked to Intramolecular Antennae

Based on the [2‐(2‐nitrophenyl)propoxy]carbonyl (nppoc) group, six new photolabile protecting groups ( 2, 8, 9b, 16b, 25b , and 26 ), each covalently linked to a 9H‐thioxanthen‐9‐one (Tx) unit functioning as an intramolecular triplet sensitizer, were synthesized. Linkers were introduced between the Me group or the aromatic ring of nppoc and the 2‐position of Tx by means of classical organic synthesis combined with Pd catalyzed C? C coupling reactions. The new photolabile protecting groups to be used in light‐directed synthesis of DNA chips were attached to the 5′‐O‐atom of thymidine via a carbonate linkage, giving rise to the caged nucleosides 7, 11, 13, 19, 20 , and 30 .     

Synthesis of Photolabile 5′‐O‐Phosphoramidites for the Photolithographic Production of Microarrays of Inversely Oriented Oligonucleotides

The photolabile 3′‐O‐{[2‐(2‐nitrophenyl)propoxy]carbonyl}‐protected 5′‐phosphoramidites ( 16 – 18 ) were synthesized (see Scheme) for an alternative mode of light‐directed production of oligonucleotide arrays. Because of the characteristics of these monomeric building blocks, photolithographic in situ DNA synthesis occurred in 5′→3′ direction, in agreement with the orientation of enzymatic synthesis. Synthesis yields were as good as those of conventional reactions. The resulting oligonucleotides are attached to the surface via their 5′‐termini, while the 3′‐hydroxy groups are available as substrates for enzymatic reactions such as primer extension upon hybridization of a DNA template (see Fig. 2). The production of such oligonucleotide chips adds new procedural avenues to the growing number of applications of DNA microarrays.     

Triplet‐sensitized irradiation of a main‐chain liquid crystalline poly(aryl cinnamate) in three different phases

Visible light irradiation of thin films of a main‐chain liquid crystalline poly(aryl cinnamate) using ketocoumarins as triplet sensitizers leads to photochemical crosslinking and UV‐vis and FTIR spectroscopic changes associated with saturation of the cinnamate double bond, most likely by 2 + 2 photocycloaddition. The triplet sensitizers are themselves photolabile and are lost by photochemical reactions during the sensitization process. A new ketocoumarin sensitizer with decyloxy substituents and a reduced tendency to phase separate from the polymer is reported. A simple calculation of the sensitization stoichiometry shows that a single molecule of this ketocoumarin sensitizes the destruction of approximately 90 cinnamate chromophores in the “as cast” films below T_g and about 300 chromophores in the more‐ordered glassy nematic films and in “as cast” films of poly(vinyl cinnamate). Triplet sensitization of fluid nematic films leads, upon initial irradiation, to UV‐vis hyperchromism that is attributed to disruption of chromophore aggregation and, possibly, to disruption of the nematic mesophase as photoproducts begin to form. © 2000 John Wiley & Sons, Inc. J Polym Sci A: Polym Chem 39: 134–144, 2001     

Intramolecular sensitization of photocleavage of the photolabile 2-(2-nitrophenyl)propoxycarbonyl (NPPOC) protecting group: photoproducts and photokinetics of the release of nucleosides

Novel photolabile protecting groups based on the 2-(2-nitrophenyl)propoxycarbonyl (NPPOC) group with a covalently linked thioxanthone as an intramolecular triplet sensitizer exhibit significantly enhanced light sensitivity under continuous illumination. Herein we present a detailed study of the photokinetics and photoproducts of nucleosides caged with these new protecting groups. Relative to the parent NPPOC group, the light sensitivity of the new photolabile protecting groups is enhanced by up to a factor of 21 at 366 nm and is still quite high at 405 nm, the wavelength at which the sensitivity of the parent compound is practically zero. A new pathway for deprotection of the NPPOC group proceeding through a nitroso benzylalcohol intermediate has been discovered to complement the main mechanism, which involves beta elimination. Under standard conditions of lithographic DNA-chip synthesis, some of the new compounds, while maintaining the same chip quality, react ten times faster than the unmodified NPPOC-protected nucleosides.     

Novel Fluoride‐Labile Nucleobase‐Protecting Groups for the Synthesis of 3′(2′)‐O‐Aminoacylated RNA Sequences

With the aim to develop a general approach to a total synthesis of aminoacylated t‐RNAs and analogues, we describe the synthesis of stabilized, aminoacylated RNA fragments, which, upon ligation, could lead to aminoacylated t‐RNA structures. Novel RNA phosphoramidites with fluoride‐labile 2′‐O‐[(triisopropylsilyl)oxy]methyl (=tom) sugar‐protecting and N‐{{2‐[(triisopropylsilyl)oxy]benzyl}oxy}carbonyl (=tboc) base‐protecting groups were prepared (Schemes 4 and 5), as well as a solid support containing an immobilized N⁶‐tboc‐protected adenosine with an orthogonal (photolabile) 2′‐O‐[(S)‐1‐(2‐nitrophenyl)ethoxy]methyl (=(S)‐npeom) group (Scheme 6). From these building blocks, a hexameric oligoribonucleotide was prepared by automated synthesis under standard conditions (Scheme 7). After the detachment from the solid support, the resulting fully protected sequence 34 was aminoacylated with L ‐phenylalanine derivatives carrying photolabile N‐protecting groups (→ 42 and 43 ; Scheme 9). Upon removal of the fluoride‐labile sugar‐ and nucleobase‐protecting groups, the still stabilized, partially with the photolabile group protected precursors 44 and 45 , respectively, of an aminoacylated RNA sequence were obtained (Scheme 9 and Fig. 3). Photolysis of 45 under mild conditions resulted in the efficient formation of the 3′(2′)‐O‐aminoacylated RNA sequence 46 (Fig. 4). Additionally, we carried out model investigations concerning the stability of ester bonds of aminoacylated ribonucleotide derivatives under acidic conditions (Table) and established conditions for the purification and handling of 3′(2′)‐O‐aminoacylated RNA sequences and their stabilized precursors.     

Modification of Guanine with Photolabile N‐Hydroxypyridine‐2(1H)‐thione: Monomer Synthesis,Oligonucleotide Elaboration,and Photochemical Studies

The photochemistry of N‐hydroxypyridine‐2(1H)‐thione (NHPT), inserted as a photolabile modifier at the 6‐position of 2′‐deoxyguanosine or guanosine, has been evaluated. In particular, 6‐[(1‐oxidopyridin‐2‐yl)sulfanyl]‐ ( 1a ) and 6‐[(pyridin‐2‐yl)sulfanyl]‐2′,6‐dideoxyguanosine ( 2a ), novel photolabile derivatives of the natural nucleosides, were synthesized and characterized. The observed photolysis products of 1a in organic solvents could only be rationalized by assuming a rapid equilibrium with the corresponding 6‐[(2‐thioxopyridin‐1(2H)‐yl)oxy] analogue 3a (Scheme 5). Transient spectroscopy of 1a indicated a strong triplet‐excited state suitable for triplet → triplet energy transfer or singlet‐oxygen generation. The NHPT function was stable enough for (slightly modified) automated solid‐phase oligonucleotide synthesis. The utility of the above compounds is discussed, as well as their potential use in photosensitization of reactive oxygen species in DNA.     

Enantioselective Visible‐Light‐Mediated Formation of 3‐Cyclopropylquinolones by Triplet‐Sensitized Deracemization

3‐Allyl‐substituted quinolones undergo a triplet‐sensitized di‐π‐methane rearrangement reaction to the corresponding 3‐cyclopropylquinolones upon irradiation with visible light (λ=420 nm). A chiral hydrogen‐bonding sensitizer (10 mol %) was shown to promote the reaction enantioselectively (88–96 % yield, 32–55 % ee). Surprisingly, it was found that the enantiodifferentiation does not occur at the state of initial product formation but that it is the result of a deracemization event. The individual parameters that control the distribution of enantiomers in the photostationary state have been identified.     

Nucleotides. Part LXXIX

Two series of new ribonucleoside 3′‐phosphoramidites (see 36 – 42 ) carrying the photolabile [2‐(2‐nitrophenyl)propoxy]carbonyl group at the 5′‐O‐position were synthesized and characterized as monomeric building blocks for photolithographic syntheses of RNA chips. Base protection was achieved in the well‐known manner by the 2‐(4‐nitrophenyl)ethyl (npe) and the [2‐(4‐nitrophenyl)ethoxy]carbonyl (npeoc) group. The carbohydrate moiety carried in addition the 2′‐O‐(tetrahydro‐4‐methoxy‐2H‐pyran‐4‐yl) group for blocking the 2′‐OH function.     

New Anthracene Derivatives as Triplet Acceptors for Efficient Green‐to‐Blue Low‐Power Upconversion

Three new anthracene derivatives [2‐chloro‐9,10‐dip‐tolylanthracene (DTACl), 9,10‐dip‐tolylanthracene‐2‐carbonitrile (DTACN), and 9,10‐di(naphthalen‐1‐yl)anthracene‐2‐carbonitrile (DNACN)] were synthesized as triplet acceptors for low‐power upconversion. Their linear absorption, single‐photon‐excited fluorescence, and upconversion fluorescence properties were studied. The acceptors exhibit high fluorescence yields in DMF. Selective excitation of the sensitizer Pd^IIoctaethylporphyrin (PdOEP) in solution containing DTACl, DTACN, or DNA‐CN at 532 nm with an ultralow excitation power density of 0.5 W cm^?2 results in anti‐Stokes blue emission. The maximum upconversion quantum yield (Φ_UC=17.4 %) was obtained for the couple PdOEP/DTACl. In addition, the efficiency of the triplet–triplet energy transfer process was quantitatively studied by quenching experiments. Experimental results revealed that a highly effective acceptor for upconversion should combine high fluorescence quantum yields with efficient quenching of the sensitizer triplet.     

Photosensitization mechanisms in photopolymer coating film containing photoinitiators sensitized by aminochalcone‐type dye for computer‐to‐photopolymer plate

Photosensitization mechanisms in photopolymer coating film containing an aminochalcone‐type dye sensitizer and a radical generating reagent, sensitizer dyes, (E)‐3‐(9‐julolidinyl)‐1‐phenyl‐2‐propen‐1‐one (A), (E)‐2‐(9‐julolidinyl)‐methylene‐1‐indanone (B), 9‐benzoyl‐2,3,6,7‐tetrahydro‐1H,5H‐benzo[i,j]‐furano‐[3,2‐g]quinolizine (C), 4‐(dimethylamino) chalcone (D) and a radical‐generating reagent, 2,4,6‐tris (trichloromethyl)‐1,3,5‐triazine (TCT), were investigated by laser flash photolysis using a total reflection cell. Weak fluorescence and strong broad triplet absorption were detected. The fluorescence was statically quenched by TCT at quenching distances (R_f) of 15, 14, 20 and 14 Å for A, B, C and D as well as the triplet initial absorption, at quenching distances (R_t) of 16, 16, 16 and 14 for A, B, C and D, similar to the fluorescence quenching distances. The triplet decay time of the dyes was inefficiently quenched by TCT with the rate constants (k _q) of 1.9, 3.1, 0.7 and 1.0×10⁵ mol⁻¹/dm³/s for A, B, C and D. The sensitivity of photopolymers containing a sensitizer dye and a TCT was obtained at an excitation of 488 nm corresponding to the emission peaks of argon ion laser of 1.1, 0.2, 0.54 and 9.1 mJ cm² for A, B, C and D. The results indicated that the static sensitization process from the fluorescent singlet excited state of the dyes to the ground state of TCT was predominant, and the high sensitivity for A and B was caused by the high absorbance at 488 nm and that for C by the high fluorescent quenching distance. Copyright © 1999 John Wiley & Sons, Ltd.     

New Types of Very Efficient Photolabile Protecting Groups Based upon the [2‐(2‐Nitrophenyl)propoxy]carbonyl (NPPOC) Moiety

Based upon the photolabile [2‐(2‐nitrophenyl)propoxy]carbonyl group (NPPOC), a large number of modified 2‐(2‐nitrophenyl)propanol derivatives substituted at the phenyl ring (see 23 – 34 and 57 – 76 ) as well as at the side‐chain (see 85 – 92 and 95 – 98 ) were synthesized to improve the photoreactivity of this new type of photolabile entity. The phenyl moiety was also exchanged by the naphthalenyl group (see 102, 103, 105, 108, 110, 113 , and 114 ), the thienyl substituent (see 115, 117, 118 , and 120 ), and the benzothienyl substituent (see 121 ). The 2‐(2‐nitroaryl‐ and heteroaryl)propanols were converted with diphosgene into the corresponding carbonochloridates, which reacted subsequently with thymidine to the thymidine 5′‐(protected carbonates) 123 – 178 as the main reaction products. In several cases, the corresponding 3′‐carbonates and 3′,5′‐dicarbonates 179 – 212 were also isolated and characterized. Photolysis studies under standardized conditions (see Table) indicated that the rate of photocleavage varies in a broad range depending on the substituents. So far, the thymidine 5′‐[2‐(5‐halo‐2‐nitrophenyl)propyl carbonates] 127 – 129 , 5′‐[2‐(nitro[1,1′‐biphenyl]3‐yl)propyl carbonates] 136 – 139 , 5′‐{2‐[2‐nitro‐5‐(thianthren‐1‐yl)phenyl]propyl carbonate} ( 140 ), 5′‐[2‐(5‐naphthalenyl‐2‐nitrophenyl)propyl carbonates] 141 and 142 , and 5′‐[2‐(2‐nitro‐5‐thienylphenyl)propyl carbonates] 143 and 144 showed the best properties regarding fast and uniform deprotection. Since the nucleobases of 213 – 215 do not influence the photocleavage features, in general, the new type of photolabile building blocks allows in form of their 3′‐phosphoramidites the photolithographic formation of high‐quality biochips.     

Synthesis of Oligonucleotides Carrying Anchoring Groups and Their Use in the Preparation of Oligonucleotide–Gold Conjugates

Oligodeoxynucleotide conjugates 1 – 15 carrying anchoring groups such as amino, thiol, pyrrole, and carboxy groups were prepared. A post‐synthetic modification protocol was developed. In this method 2′‐deoxy‐O⁴‐(p‐nitrophenyl)uridine‐3‐phosphoramidite was prepared and incorporated in oligonucleotides. After assembly, the modified nucleoside was made to react with different amines carrying the anchoring groups. At the same time, protecting groups were removed to yield the desired oligonucleotide conjugates. In a second approach, amino, thiol, and carboxylic groups were introduced into the 3′‐end of the oligonucleotides by preparing solid supports loaded with the appropriate amino acids. Oligonucleotide gold conjugates were prepared and their binding properties were examined.     

Olefin Isomerization via Radical‐Ion Pairs in Triplet States Studied by Chemically Induced Dynamic Nuclear Polarization (CIDNP)

Geometric isomerizations of olefins following photoinduced electron transfer (PET) are classified according to the relative energetic positions of the radical‐ion pairs and the reactant triplets. Each class exhibits characteristic CIDNP (chemically induced dynamic nuclear polarization) effects, for which typical examples are presented. Time‐resolved CIDNP experiments on the system triphenylamine/fumarodinitrile (= (2E)‐but‐2‐enedinitrile), where formation of the olefin triplet is impossible, show that there is also no isomerization of the olefin radical anion. With triisopropylamine or fumarodinitrile as the reaction partner for 4,4′‐dimethoxystilbene (= 1,1′‐[(1E)‐ethane‐1,2‐diyl]bis[4‐methoxybenzene]), both oxidative and reductive quenching give almost mirror‐image CIDNP spectra because of the pairing theorem; reverse electron transfer of the triplet radical‐ion pairs populates the stilbene triplet only, which then isomerizes. With anethole (= 1‐methoxy‐4‐(prop‐1‐enyl)benzene; M), the competition between electron return of triplet pairs to give either M + ³X or ³M + X was studied by using a second isomerizable olefin (diethyl fumarate (= diethyl (2E)‐but‐2‐enedioate) or cinnamonitrile (= (2E)‐3‐phenylprop‐2‐enenitrile)) as the reaction partner X. Classes can be changed by employing PET sensitization. With ACN (anthracene‐9‐carbonitrile) as the sensitizer, anethole does not produce any directly observable polarizations, but a substitution of ACN^.? by the radical anion of 1,4‐benzoquinone (= cyclohexa‐2,5‐diene‐1,4‐dione) or fumarodinitrile within the lifetime of the spin‐correlated radical‐ion pairs leads to very strong CIDNP signals that reflect the effects of both pairs.     

CHLOROPHYLL-SENSITIZED REDUCTION OF SAFRANINE

Abstract— The kinetics of the direct photoreduction, and the chlorophyll-sensitized reduction, of safranine by ascorbic acid in aqueous pyridine was studied. In darkness following illumination, safranine was reformed from the colorless reduced derivative by a first order reaction. In light, however, the photostationary concentration of reduced safranine was proportional to the square root of the absorbed illumination, indicating a second order back reaction. The spectrum of reduced safranine, the inhibition of chlorophyll photoreduction by safranine, and the quenching of chlorophyll fluorescence by safranine were also measured. While other mechanisms of sensitization are conceivable, the simplest explanation of the results seems to be one involving the formation of the triplet state of safranine at the expense of the triplet state of chlorophyll.     

The Photochemistry of 2-Cyclopentenyl Methyl Ketones

2-Cyclopentenyl and 3-phenyl-2-cyclopentenyl methyl ketones (15–18, 30, 31) undergo a 1,3-acetyl shift on direct irradiation, and the oxa-di-π-methane rearrangement to photochemically non-interconverting endo and exo bicyclo-[2.1.0]pentyl methyl ketones on triplet sensitization. Exceptions include the 2-methyl-3-phenyl-2-cyclopentenyl methyl ketone 32 and the 1-phenyl-2-cyclo-pentenyl methyl ketone 44 which are unreactive on direct irradiation and on triplet sensitization, respectively, and the 2-phenyl-2-cyclopentenyl methyl ketones 42 and 43 which do not react under either condition. The reactive triplet of the 3-phenyl-2-cyclopentenyl methyl ketone 30 has been identified as the localized styrene π,π*-state of E_T=59 kcal/mol by comparison of its phosphorescence at 77K in rigid glasses with that of 1-phenyl-cyclopentene, and by the independence of the quantum yield on sensitizer energy in the range of 61–74 kcal/mol.     

A new design of cleavable acetal‐containing amphiphilic block copolymers triggered by light

We report a new design of photolabile acetal‐containing amphiphilic block copolymers. Acetals as protecting groups for carbonyls or diols can be hydrolyzed under acidic condition but very stable with respect to hydrolysis at pH > 7. When combining light‐capturing chromophores with acetals, the hydrolysis of acetals can be activated by light to design dual responsive acetal‐containing polymers. Using acetalization reaction of 2,3‐dihydroxypropyl methacrylate with benzaldehyde derivatives, two new acetal‐containing photolyzable monomers have been designed. Comparable to commonly used photolabile monomers containing nitrobenzyl esters, the two acetal‐containing monomers are easy to polymerize using atom transfer radical polymerization with excellent molecular weight and dispersity control. We studied the cleavage kinetics and mechanism of acetal groups in both monomers and polyethylene oxide (PEO)‐containing amphiphilic block copolymers using ¹H NMR and UV–vis spectroscopy. o‐Nitrobenzaldehyde acetal showed a Norrish Type II rearrangement to form benzoic ester; while, 2,5‐dimethoxy benzaldehyde acetal was photolabile to completely release 2,3‐dihydroxypropyl methacrylate. The photocleavage of acetals is a zero‐order reaction in regardless of molecular states of acetals; while, the acid‐cleavage of acetals proves to be a first‐order kinetics and the cleavage becomes much slower for polymers. The self‐assembly of acetal‐containing amphiphilic block copolymers and the acid‐/light‐controlled dissociation of their vesicles have been investigated. We demonstrate that those acetal‐containing polymers are potentially useful as smart drug delivery systems where the release kinetics of payloads is tunable using light and pH as triggers. © 2018 Wiley Periodicals, Inc. J. Polym. Sci., Part A: Polym. Chem. 2018 , 56, 1815–1824     

Hydroxypyridinechromene and Pyridinechalcone: Two Coupled Photochromic Systems

Substitution of the phenyl group in 2‐hydroxychalcones by a 4‐pyridine unit dramatically changes the network of chemical reactions of this compound: trans‐chalcone‐type ( Ct ), cis‐chalcone‐type ( Cc ), and a hemiketal (hydroxy‐4‐pyridinechromene) ( B ) and their protonated forms are formed, but the presence of a flavylium‐type cation could not be detected even at very acidic pH values. Moreover, whereas in 2‐phenyl‐2‐benzopyrylium compounds B and Cc are generally elusive species whose kinetic processes in aqueous solutions occur on the sub‐second timescale, in the present compound these species equilibrate on a timescale four orders of magnitude lower. Complete characterization of the equilibrium and kinetics of the reaction network could thus be achieved by ¹H NMR spectroscopy and UV/Vis spectrophotometry. The network of chemical reactions exhibits cis–trans photoisomerization, as well as photochromism between the hemiketal and the chalcone‐type species. The irradiation of Ct in MeOH/H₂O (1:1) at 365 nm produces B almost quantitatively through two consecutive photochemical reactions: Ct → Cc photoisomerization followed by Cc → B photo ring closure with a global quantum yield of 0.02. On the other hand, irradiation of B at 254 nm leads to a photostationary state composed by 80 % Ct and 20 % B , with a quantum yield of 0.21.     

Photophysical Investigations on Photoinitiators with Covalently Linked Thioxanthone Sensitizer Moieties

The photophysical properties of three photoinitiators with a covalently linked thioxanthone sensitizer unit absorbing up to 410 nm were investigated by laser‐flash photolysis and CIDNP spectroscopy. These complementary techniques revealed two competing reaction pathways of the molecular dyads 1 – 3 : i) triplet‐energy transfer from the sensitizer to the morpholine moiety followed by α‐cleavage to yield a radical pair, which initiates radical polymerization, and ii) bimolecular electron transfer from the morpholine to the thioxanthone subunit followed by proton transfer. The relative efficiency of these routes is determined by the triplet energy of the photoinitiator moiety relative to that of the sensitizer.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Dual Upconverted and Downconverted Circularly Polarized Luminescence in Donor–Acceptor Assemblies

Through mimicking both the chiral and energy transfer in an artificial self‐assembled system, not only was chiral transfer realized but also a dual upconverted and downconverted energy transfer system was created that emit circularly polarized luminescence. The individual chiral π‐gelator can self‐assemble into a nanofiber exhibiting supramolecular chirality and circularly polarized luminescence (CPL). In the presence of an achiral sensitizer Pd^II octaethylporphyrin derivative, both chirality transfer from chiral gelator to achiral sensitizer and triplet‐triplet energy transfer from excited sensitizer to chiral gelator could be realized. Upconverted CPL could be observed through a triplet–triplet annihilation photon upconversion (TTA‐UC), while downconverted CPL could be obtained from chirality‐transfer‐induced emission of the achiral sensitizer. The interplay between chiral energy acceptor and achiral sensitizer promoted the communication of chiral and excited energy information.