Recent developments in novel blue/green/red/NIR small fluorescent probes for in cellulo tracking of RNA/DNA G-quadruplexes

The detection and stabilization of G-quadruplexes (G4s) in living systems is of enormous applicability in the fields of chemical biology and therapeutic materials. Whereas DNA serves as a genetic material, RNA functions in the regulation and expression of genetic materials. Even there is various report on fluorescent probes invitro G4s recognitions, in this review we highlighted briefly, in-cellulo identification of G4s along with conventional methods principles. Although there are varieties of G4-forming sequences in the genome, targeting a specific type (topology) in living cells is highly challenging because of the high instability of G4s in cellular/subcellular systems. In contrast, several reports describe the in vitro identification of G4s, along with in-cell demonstrations, using efficient fluorescent probes, through either intrinsic or extrinsic approaches. In the intrinsic mode, the sensing results from the use of highly selective synthetic fluorescent oligonucleotides or proteins (a labeling approach). In the extrinsic mode, quencher-free small molecular probes are used to recognize specific G4s under physiological conditions. Because of their robustness, simplicity, and ease of handling, this review describes recent trends in the use of blue/green, green, red, and near-infrared (NIR) fluorescent probes for the recognition of G4s in live cells-and, particularly, those approaches employing quencher-free probes. Also highlighted are a few labeled probes, and their in cellulo localizations, which were accomplished upon the formation of non-canonical G4s under specified conditions and supplemented by exogenous G4-forming components, without harnessing cellular physiological conditions.     

A Bis(methylpiperazinylstyryl)phenanthroline as a Fluorescent Ligand for G‐Quadruplexes

G‐quadruplex (G4)‐forming sequences are prevalent in the genome and are considered to play important roles in gene regulation, and hence have been viewed as potential therapeutic targets in oncology. However, the structures and functions of most G4s in the genome are poorly understood. Therefore, the development of fluorescent probes and ligands for G4s is important for G4 research and drug discovery. Herein, we report a new G4 ligand, 2,9‐bis[4‐(4‐methylpiperazin‐1‐yl)styryl]‐1,10‐phenanthroline (BMSP), which was synthesized by a simple process. BMSP exhibits almost no fluorescence in aqueous buffer. The interaction of BMSP with G4s greatly enhances its fluorescence with a large Stokes’ shift of 160 nm. Antiparallel human telomeric G4s exhibit the strongest binding affinity (K_d≈0.13 μm ) to BMSP and induce a fluorescence enhancement of up to 150‐fold. BMSP binds to G4s through π–π stacking on the terminal G‐quartets. BMSP can enter live cells, and it strongly inhibits the growth of cancer cells rather than causing cell death. Our results suggest that BMSP has the potential to serve both as a fluorescent probe for some G4s and as a chemotherapeutic agent for cancer treatment.     

The Hydrothermal Synthesis of Sulfate Cancrinite (SO4‐CAN): Relations between Si‐Al Sources and Crystal Quality

Sulfate cancrinite (SO₄‐CAN) Na₈[AlSiO₄]₆(SO₄)(H₂O)_n (2.6 < n < 3.2) was synthesized under hydrothermal conditions at 200 °C and 48 hours. Three different Si‐Al sources were inserted: (a) kaolinite (K), (b) a gel of sodium‐waterglass and sodium aluminate (G), and (c) an oxide mixture of cristobalite and corundum (CK). The products were characterized by X‐ray powder diffraction (XRD), ²⁹Si and ²⁷Al MAS NMR spectroscopy, scanning electron microscopy (SEM), energy dispersive X‐ray spectroscopy (EDXS) and BET surface area analysis as well as simultaneous thermoanalysis (TG‐DTA). Mostly nanocrystals of platelet habit and dimensions smaller than 100 nm (beside a very few larger crystals) were observed from K. In contrast the gel (G) yielded to cancrinites with typical rod‐like morphology and dimensions of 100 × 500 nm. Large prismatic cancrinites up to 5 μm width and 10 μm length were observed from the oxide mixture CK. Furthermore the transition kinetics of the cancrinites into nosean was investigated at a temperature of 1000 °C under open conditions. This process was already complete after 1 hour for the nanocrystals from K but needed 10 hours for the nanocrystals from G and the microcrystals from CK. The relations between the individual Si‐Al source and the crystal properties like size, habit, and thermal transition kinetics were discussed.     

Monitoring casein kinase II at subcellular level via bio-bar-code-based electrochemiluminescence biosensing method

A highly sensitive electrochemiluminescence (ECL) biosensing method was developed for monitoring casein kinase II (CK2) at subcellular level via bio-bar-code assay. A bio-bar-code probe (h-DNA/AuNPs/p-DNA) prepared by conjugating phosphorylated DNA (p-DNA) and hairpin DNA (h-DNA) onto gold nanoparticles (AuNPs) was used as a carrier for ECL signal reagent (Ru(phen)₃²⁺) while a specific peptide was used as a recognition substance. A gold ultramicroelectrode with a diameter of 400 nm was fabricated and then modified with the specific peptide via self-assembly technique to obtain peptide modified gold ultramicroelectrode. The peptide on gold ultramicroelectrode was phosphorylated in the presence of CK2 and adenosine 5′-triphosphate, and then the phosphorylated peptide was integrated with the h-DNA/AuNPs/p-DNA through a process mediated by zirconium cations (Zr⁴⁺), and finally Ru(phen)₃²⁺ was intercalated into h-DNA. A “signal on” ECL method was developed for the detection of CK2 in the range of 0.005–0.2 U/mL with a detection limit of 0.001 U/mL. Additionally, combined efficient subcellular phosphorylation in vivo with bio-bar-code-based ECL biosensing method, the ECL method was further applied to monitor CK2 at subcellular level without tedious subcellular fractionation. It was found that the concentration of CK2 by inserting the peptide modified gold ultramicroelectrode into the nucleus was higher than that into cytoplasm of HeLa cells. A distinct heterogeneity among CK2 concentrations in single cells was observed for cellular heterogeneity assessment.     

Determination of Flavonoids Compounds of Three Species and Different Harvesting Periods in Crataegi folium Based on LC-MS/MS

Crataegi folium have been used as medicinal and food materials worldwide due to its pharmacological activities. Although the leaves of Crataegus songorica (CS), Crataegus altaica (CA) and Crataegus kansuensis (CK) have rich resources in Xinjiang, China, they can not provide insights into edible and medicinal aspects. Few reports are available on the qualitative and quantitative analysis of flavonoids compounds of their leaves. Therefore, it is necessary to develop efficient methods to determine qualitative and quantitative flavonoids compounds in leaves of CS, CA and CK. In the study, 28 unique compounds were identified in CS versus CK by qualitative analysis. The validated quantitative method was employed to determine the content of eight flavonoids of the leaves of CS, CA and CK within 6 min. The total content of eight flavonoids was 7.8–15.1 mg/g, 0.1–9.1 mg/g and 4.8–10.7 mg/g in the leaves of CS, CA and CK respectively. Besides, the best harvesting periods of the three species were from 17th to 26th September for CS, from 30th September to 15th October for CA and CK. The validated and time-saving method was successfully implemented for the analysis of the content of eight flavonoids compounds in CS, CA and CK for the first time.     

Folding and Unfolding of Exogenous G-Rich Oligonucleotides in Live Cells by Fluorescence Lifetime Imaging Microscopy of o-BMVC Fluorescent Probe

Guanine-rich oligonucleotides (GROs) can self-associate to form G-quadruplex (G4) structures that have been extensively studied in vitro. To translate the G4 study from in vitro to in live cells, here fluorescence lifetime imaging microscopy (FLIM) of an o-BMVC fluorescent probe is applied to detect G4 structures and to study G4 dynamics in CL1-0 live cells. FLIM images of exogenous GROs show that the exogenous parallel G4 structures that are characterized by the o-BMVC decay times (≥2.4 ns) are detected in the lysosomes of live cells in large quantities, but the exogenous nonparallel G4 structures are hardly detected in the cytoplasm of live cells. In addition, similar results are also observed for the incubation of their single-stranded GROs. In the study of G4 formation by ssHT23 and hairpin WT22, the analyzed binary image can be used to detect very small increases in the number of o-BMVC foci (decay time ≥ 2.4 ns) in the cytoplasm of live cells. However, exogenous ssCMA can form parallel G4 structures that are able to be detected in the lysosomes of live CL1-0 cells in large quantities. Moreover, the photon counts of the o-BMVC signals (decay time ≥ 2.4 ns) that are measured in the FLIM images are used to reveal the transition of the G4 formation of ssCMA and to estimate the unfolding rate of CMA G4s with the addition of anti-CMA into live cells for the first time. Hence, FLIM images of o-BMVC fluorescence hold great promise for the study of G4 dynamics in live cells.     

Computational Methods for Understanding the Selectivity and Signal Transduction Mechanism of Aminomethyl Tetrahydronaphthalene to Opioid Receptors

Opioid receptors are members of the group of G protein-couple receptors, which have been proven to be effective targets for treating severe pain. The interactions between the opioid receptors and corresponding ligands and the receptor’s activation by different agonists have been among the most important fields in opioid research. In this study, with compound M1, an active metabolite of tramadol, as the clue compound, several aminomethyl tetrahydronaphthalenes were designed, synthesized and assayed upon opioid receptors. With the resultant compounds FW-AII-OH-1 (Ki = 141.2 nM for the κ opioid receptor), FW-AII-OH-2 (Ki = 4.64 nM for the δ opioid receptor), FW-DI-OH-2 (Ki = 8.65 nM for the δ opioid receptor) and FW-DIII-OH-2 (Ki = 228.45 nM for the δ opioid receptor) as probe molecules, the structural determinants responsible for the subtype selectivity and activation mechanisms were further investigated by molecular modeling and molecular dynamics simulations. It was shown that Y^7.43 was a key residue in determining the selectivity of the three opioid receptors, and W^6.58 was essential for the selectivity of the δ opioid receptor. A detailed stepwise discovered agonist-induced signal transduction mechanism of three opioid receptors by aminomethyl tetrahydronaphthalene compounds was proposed: the 3–7 lock between TM3 and TM7, the DRG lock between TM3 and TM6 and rearrangement of I^3.40, P^5.50 and F^6.44, which resulted in the cooperative movement in 7 TMs. Then, the structural relaxation left room for the binding of the G protein at the intracellular site, and finally the opioid receptors were activated.     

Self-Assembled Peptidyl Aggregates for the Fluorogenic Recognition of Mitochondrial DNA G-Quadruplexes

The selective monitoring of G-quadruplex (G4) structures in living cells is important to elucidate their functions and reveal their value as diagnostic or therapeutic targets. Here we report a fluorogenic probe ( CV2 ) able to selectively light-up parallel G4 DNA over antiparallel topologies. CV2 was constructed by conjugating the excimer-forming CV dye with a peptide sequence (l -Arg-l -Gly-glutaric acid) that specifically recognizes G4s. CV2 forms self-assembled, red excimer-emitting nanoaggregates in aqueous media, but specific binding to G4s triggers its disassembly into rigidified monomeric dyes, leading to a dramatic fluorescence enhancement. Moreover, selective permeation of CV2 stains G4s in mitochondria over the nucleus. CV2 was employed for tracking the folding and unfolding of G4s in living cells, and for monitoring mitochondrial DNA (mtDNA) damage. These properties make CV2 appealing to investigate the possible roles of mtDNA G4s in diseases that involve mitochondrial dysfunction.     

Identification of C21 Steroidal Glycosides from Gymnema sylvestre (Retz.) and Evaluation of Their Glucose Uptake Activities

Gymnema sylvestre (Retz.) Schult is a multi-purpose traditional medicine that has long been used for the treatment of various diseases. To discover the potential bioactive composition of G. sylvestre, a chemical investigation was thus performed. In this research, four new C₂₁ steroidal glycosides sylvepregosides A-D (1–4) were isolated along with four known compounds, gymnepregoside H (5), deacetylkidjoladinin (6), gymnepregoside G (7) and gymnepregoside I (8), from the ethyl acetate fraction of G. sylvestre. The structures of the new compounds were established by extensive 1D and 2D nuclear magnetic resonance (NMR) spectra with mass spectroscopy data. Compounds 1–6 promoted glucose uptake by the range of 1.10- to 2.37-fold, respectively. Compound 1 showed the most potent glucose uptake, with 1.37-fold enhancement. Further study showed that compounds 1 and 5 could promote GLUT-4 fusion with the plasma membrane in L6 cells. The result attained in this study indicated that the separation and characterization of these compounds play an important role in the research and development of new anti-diabetic drugs and pharmaceutical industry.     

Enantioselective Diels–Alder reactions with left-handed G-quadruplex DNA-based catalysts

Since the discovery of left-handed G-quadruplex (L-G4) structure formed by natural DNA, there has been a growing interest in its potential functions. This study utilised it to catalyse enantioselective Diels-Alder reactions, considering its different optical rotation compared to an ordinary G4. It was determined that when L-G4 was used with a combination of copper(II) ions, there was a good enantioselectivity (?52% ee) without further addition of ligands. When further consideration was given by adding G4 ligands, G4 was further stabilised, even obtaining a better enantioselectivity (up to ?80% ee). Moreover, when using ligands that have regulatory effects on G4, the ee value can be adjusted. In this work, a minimal left-handed G4 was reported. A follow-up study was also conducted, which recovers that the minimal left-handed G4 remains its catalytic effect and enantioselectivity, but is not so effective as the former case. This indicates that a complete G4 structure is relatively conducive to chiral catalysis.     

Synthesis of conjugates of β-cyclodextrin with polyamidoamine dendrimers and their molecular inclusion interaction with levofloxacin lactate

Polyamidoamine (PAMAM) dendrimers of different generations (G2 and G4) conjugated with β-cyclodextrin (β-CD), PAMAM (G2, G4)-CD, were synthesized using substitution reaction from mono-6-iodine-β-cyclodextrin and PAMAM dendrimers. The resulting molecular structures were characterized by NMR, IR. The molecular interaction between various dendrimers and levofloxacin lactate (LFL) were investigated by monitoring the fluorescence of LFL in the presence of dendrimers in buffer solution (pH 7.4) at 25?°C. It was found that the PAMAM (G2, G4)-CD possesses higher sensitizing ability than that of the corresponding parent dendrimers and natural β-CD, and increases concomitantly with the increases of generation and content of β-CD, suggesting that the PAMAM (G2, G4)-CD possesses stronger inclusion ability with LFL. The possible interaction mechanism between PAMAM-CD and LFL was proposed by ¹H NMR analysis and theoretical calculation. The results show that the LFL molecule is located at the amine end of dendrimer molecule and along the side of cyclodextrin cavities to form supramolecular complexes. Furthermore, results indicate that the main driving force of the complex could be attributed to the electrostatic interactions and hydrogen bonding between LFL and PAMAM-CD, as well as the synergistic effect of intermolecular forces.     

Selective Binding and Redox-Activity on Parallel G-Quadruplexes by Pegylated Naphthalene Diimide-Copper Complexes

G-quadruplexes (G4s) are higher-order supramolecular structures, biologically important in the regulation of many key processes. Among all, the recent discoveries relating to RNA-G4s, including their potential involvement as antiviral targets against COVID-19, have triggered the ever-increasing need to develop selective molecules able to interact with parallel G4s. Naphthalene diimides (NDIs) are widely exploited as G4 ligands, being able to induce and strongly stabilize these structures. Sometimes, a reversible NDI-G4 interaction is also associated with an irreversible one, due to the cleavage and/or modification of G4s by functional-NDIs. This is the case of NDI-Cu-DETA, a copper(II) complex able to cleave G4s in the closest proximity to the target binding site. Herein, we present two original Cu(II)-NDI complexes, inspired by NDI-Cu-DETA, differently functionalized with 2-(2-aminoethoxy)ethanol side-chains, to selectively drive redox-catalyzed activity towards parallel G4s. The selective interaction toward parallel G4 topology, controlled by the presence of 2-(2-aminoethoxy)ethanol side chains, was already firmly demonstrated by us using core-extended NDIs. In the present study, the presence of protonable moieties and the copper(II) cavity, increases the binding affinity and specificity of these two NDIs for a telomeric RNA-G4. Once defined the copper coordination relationship and binding constants by competition titrations, ability in G4 stabilization, and ROS-induced cleavage were analyzed. The propensity in the stabilization of parallel topology was highlighted for both of the new compounds HP2Cu and PE2Cu. The results obtained are particularly promising, paving the way for the development of new selective functional ligands for binding and destructuring parallel G4s.     

Neutral and Negatively Charged Phosphate Modifications Altering Thermal Stability,Kinetics of Formation and Monovalent Ion Dependence of DNA G‐Quadruplexes

The effect of phosphate group modifications on formation and properties of G‐quadruplexes (G4s) has not been investigated in detail. Here, we evaluated the structural, thermodynamic and kinetic properties of the parallel G‐quadruplexes formed by oligodeoxynucleotides d(G₄T), d(TG₄T) and d(TG₅T), in which all phosphates were replaced with N‐methanesulfonyl (mesyl) phosphoramidate or phosphoryl guanidine groups resulting in either negatively charged or neutral DNA sequences, respectively. We established that all modified sequences were able to form G‐quadruplexes of parallel topology; however, the presence of modifications led to a decrease in thermal stability relative to unmodified G4s. In contrast to negatively charged G4s, assembly of neutral G4 DNA species was faster in the presence of sodium ions than potassium ions, and was independent of the salt concentration used. Formation of mixed G4s composed of both native and neutral G‐rich strands has been detected using native gel electrophoresis, size‐exclusion chromatography and ESI‐MS. In summary, our results indicate that the phosphate modifications studied are compatible with G‐quadruplex formation, which could be used for the design of biologically active compounds.     

G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly

Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.     

Activity Enhancement of G‐Quadruplex/Hemin DNAzyme by Flanking d(CCC)

G‐quadruplex (G4)/hemin DNAzymes have been extensively applied in bioanalysis and molecular devices. However, their catalytic activity is still much lower than that of proteinous enzymes. The G4/hemin DNAzyme activity is correlated with the G4 conformations and the solution conditions. However, little is known about the effect of the flanking sequences on the activity, though they are important parts of G4s. Here, we report sequences containing d(CCC), flanked on both ends of the G4‐core sequences remarkably enhance their DNAzyme activity. By using circular dichroism and UV‐visible spectroscopy, the d(CCC) flanking sequences were demonstrated to improve the hemin binding affinity to G4s instead of increasing the parallel G4 formation, which might explain the enhanced DNAzyme activity. Meanwhile, the increased hemin binding ability promoted the degradation of hemin within the DNAzyme by H₂O₂. Furthermore, the DNAzyme with d(CCC) flanking sequences showed strong tolerance to pH value changes, which makes it more suitable for applications requiring wide pH conditions. The results highlight the influence of the flanking sequences on the DNAzyme activity and provide insightful information for the design of highly active DNAzymes.     

Enhanced sampling molecular dynamics simulations correctly predict the diverse activities of a series of stiff-stilbene G-quadruplex DNA ligands

Ligands with the capability to bind G-quadruplexes (G4s) specifically, and to control G4 structure and behaviour, offer great potential in the development of novel therapies, technologies and functional materials. Most known ligands bind to a pre-formed topology, but G4s are highly dynamic and a small number of ligands have been discovered that influence these folding equilibria. Such ligands may be useful as probes to understand the dynamic nature of G4 in vivo, or to exploit the polymorphism of G4 in the development of molecular devices. To date, these fascinating molecules have been discovered serendipitously. There is a need for tools to predict such effects to drive ligand design and development, and for molecular-level understanding of ligand binding mechanisms and associated topological perturbation of G4 structures. Here we study the G4 binding mechanisms of a family of stiff-stilbene G4 ligands to human telomeric DNA using molecular dynamics (MD) and enhanced sampling (metadynamics) MD simulations. The simulations predict a variety of binding mechanisms and effects on G4 structure for the different ligands in the series. In parallel, we characterize the binding of the ligands to the G4 target experimentally using NMR and CD spectroscopy. The results show good agreement between the simulated and experimentally observed binding modes, binding affinities and ligand-induced perturbation of the G4 structure. The simulations correctly predict ligands that perturb G4 topology. Metadynamics simulations are shown to be a powerful tool to aid development of molecules to influence G4 structure, both in interpreting experiments and to help in the design of these chemotypes.

Enhanced sampling molecular dynamics simulations and solution-phase experiments come together to demonstrate the diverse effects of G4-interactive small molecules.     

Influence of Europium speciation on its accumulation in Brassica napus and over-expressing BnTR1 lines

This study aimed at influence of europium speciation on its accumulation in Brassica napus (CK) and over-expressing BnTR1 lines (OE), and the kinetics of Eu uptake were investigated. These results indicated that the uptake in the roots of OE was higher than that of CK at high concentrations of europium and even the enrichment in the roots of OE was as high as 20,000 mg/kg at 328.9 μΜ Eu, this suggested that OE might have better resistance to uranium than CK. The time kinetics in plants showed that there had the similar trend between CK and OE. The formation of Eu³⁺at pH 5 in deionized water was beneficial to plants enrichment Eu and carbonate could reduce the adsorption of Eu in two group and phosphate almost completely impress the adsorption of Eu in two group, but citric acid could enhance europium root-to-shoot translocation in two group. These results would help understanding the mechanism of Eu uptake in Brassica napus (CK) and over-expressing BnTR1 lines (OE), therefore properly developing efficient europium/americium phytoremediation.     

Selection of a quantum-chemical method and basis set for optimization of the complex ion Cu(H2O)+

Calculations of the open-shell van der Waals complex Cu(H₂O)⁺ were carried out at 15 theoretical levels basing on the DFT theory in its variants B3LYP and BLYP. Five types of basis function were used (3-21G*, 3-21G**, 6-31G(d,p), 6-311G(d,p) and CEP-4G) each combined with one (+) or two (++) diffuse functions. The aim of the research was to find out the most accurate combination of method and basis set which predicts structural, energetic and vibration parameters closest to the experimentally found ones. Several experimental parameters were used as reference values.