Seafood Paramyosins as Sources of Anti-Angiotensin-Converting-Enzyme and Anti-Dipeptidyl-Peptidase Peptides after Gastrointestinal Digestion: A Cheminformatic Investigation

Paramyosins, muscle proteins occurring exclusively in invertebrates, are abundant in seafoods. The potential of seafood paramyosins (SP) as sources of anti-angiotensin-converting-enzyme (ACE) and anti-dipeptidyl-peptidase (DPP-IV) peptides is underexplored. This in silico study investigated the release of anti-ACE and anti-DPP-IV peptides from SP after gastrointestinal (GI) digestion. We focused on SP of the common octopus, Humboldt squid, Japanese abalone, Japanese scallop, Mediterranean mussel, Pacific oyster, sea cucumber, and Whiteleg shrimp. SP protein sequences were digested on BIOPEP-UWM, followed by identification of known anti-ACE and anti-DPP-IV peptides liberated. Upon screening for high-GI-absorption, non-allergenicity, and non-toxicity, shortlisted peptides were analyzed via molecular docking and dynamic to elucidate mechanisms of interactions with ACE and DPP-IV. Potential novel anti-ACE and anti-DPP-IV peptides were predicted by SwissTargetPrediction. Physicochemical and pharmacokinetics of peptides were predicted with SwissADME. GI digestion liberated 2853 fragments from SP. This comprised 26 known anti-ACE and 53 anti-DPP-IV peptides exhibiting high-GI-absorption, non-allergenicity, and non-toxicity. SwissTargetPrediction predicted three putative anti-ACE (GIL, DL, AK) and one putative anti-DPP-IV (IAL) peptides. Molecular docking found most of the anti-ACE peptides may be non-competitive inhibitors, whereas all anti-DPP-IV peptides likely competitive inhibitors. Twenty-five nanoseconds molecular dynamics simulation suggests the stability of these screened peptides, including the three predicted anti-ACE and one predicted anti-DPP-IV peptides. Seven dipeptides resembling approved oral-bioavailable peptide drugs in physicochemical and pharmacokinetic properties were revealed: AY, CF, EF, TF, TY, VF, and VY. In conclusion, our study presented in silico evidence for SP being a promising source of bioavailable and safe anti-ACE and anti-DPP-IV peptides following GI digestions.     

Cyclic Peptides for the Treatment of Cancers: A Review

Cyclic peptides have been widely reported to have therapeutic abilities in the treatment of cancer. This has been proven through in vitro and in vivo studies against breast, lung, liver, colon, and prostate cancers, among others. The multitude of data available in the literature supports the potential of cyclic peptides as anticancer agents. This review summarizes the findings from previously reported studies and discusses the different cyclic peptide compounds, the sources, and their modes of action as anticancer agents. The prospects and future of cyclic peptides will also be described to give an overview on the direction of cyclic peptide development for clinical applications.     

Novel Design of RNA Aptamers as Cancer Inhibitors and Diagnosis Targeting the Tyrosine Kinase Domain of the NT-3 Growth Factor Receptor Using a Computational Sequence-Based Approach

Aptamers, the nucleic acid analogs of antibodies, bind to their target molecules with remarkable specificity and sensitivity, making them promising diagnostic and therapeutic tools. The systematic evolution of ligands by exponential enrichment (SELEX) is time-consuming and expensive. However, regardless of those issues, it is the most used in vitro method for selecting aptamers. Therefore, recent studies have used computational approaches to reduce the time and cost associated with the synthesis and selection of aptamers. In an effort to present the potential of computational techniques in aptamer selection, a simple sequence-based method was used to design a 69-nucleotide long aptamer (mod_09) with a relatively stable structure (with a minimum free energy of −32.2 kcal/mol) and investigate its binding properties to the tyrosine kinase domain of the NT-3 growth factor receptor, for the first time, by employing computational modeling and docking tools.     

Structure-Based Designing,Solvent Less Synthesis of 1,2,3,4-Tetrahydropyrimidine-5-carboxylate Derivatives: A Combined In Vitro and In Silico Screening Approach

Objective: In this study, small molecules possessing tetrahydropyrimidine derivatives have been synthesized having halogenated benzyl derivatives and carboxylate linkage. As previously reported, FDA approved halogenated pyrimidine derivatives prompted us to synthesize novel compounds in order to evaluate their biological potential. Methodology: Eight pyrimidine derivatives have been synthesized from ethyl acetoacetate, secondary amine, aromatic benzaldehyde by adding catalytic amount of CuCl₂·2H₂O via solvent less Grindstone multicomponent reagent method. Molecular structure reactivity and virtual screening were performed to check their biological efficacy as an anti-oxidant, anti-cancer and anti-diabetic agent. These studies were supported by in vitro analysis and QSAR studies. Results: After combined experimental and virtual screening 5c, 5g and 5e could serve as lead compounds, having low IC₅₀ and high binding affinity.     

A Computational Approach Applied to the Study of Potential Allosteric Inhibitors Protease NS2B/NS3 from Dengue Virus

Dengue virus (DENV) is a danger to more than 400 million people in the world, and there is no specific treatment. Thus, there is an urgent need to develop an effective method to combat this pathology. NS2B/NS3 protease is an important biological target due it being necessary for viral replication and the fact that it promotes the spread of the infection. Thus, this study aimed to design DENV NS2B/NS3pro allosteric inhibitors from a matrix compound. The search was conducted using the Swiss Similarity tool. The compounds were subjected to molecular docking calculations, molecular dynamics simulations (MD) and free energy calculations. The molecular docking results showed that two compounds, ZINC000001680989 and ZINC000001679427, were promising and performed important hydrogen interactions with the Asn152, Leu149 and Ala164 residues, showing the same interactions obtained in the literature. In the MD, the results indicated that five residues, Lys74, Leu76, Asn152, Leu149 and Ala166, contribute to the stability of the ligand at the allosteric site for all of the simulated systems. Hydrophobic, electrostatic and van der Waals interactions had significant effects on binding affinity. Physicochemical properties, lipophilicity, water solubility, pharmacokinetics, druglikeness and medicinal chemistry were evaluated for four compounds that were more promising, showed negative indices for the potential penetration of the Blood Brain Barrier and expressed high human intestinal absorption, indicating a low risk of central nervous system depression or drowsiness as the the side effects. The compound ZINC000006694490 exhibited an alert with a plausible level of toxicity for the purine base chemical moiety, indicating hepatotoxicity and chromosome damage in vivo in mouse, rat and human organisms. All of the compounds selected in this study showed a synthetic accessibility (SA) score lower than 4, suggesting the ease of new syntheses. The results corroborate with other studies in the literature, and the computational approach used here can contribute to the discovery of new and potent anti-dengue agents.     

Mollusc-Derived Brominated Indoles for the Selective Inhibition of Cyclooxygenase: A Computational Expedition

Inflammation plays an important role in different chronic diseases. Brominated indoles derived from the Australian marine mollusk Dicathais orbita (D. orbita) are of interest for their anti-inflammatory properties. This study evaluates the binding mechanism and potentiality of several brominated indoles (tyrindoxyl sulfate, tyrindoleninone, 6-bromoisatin, and 6,6′-dibromoindirubin) against inflammatory mediators cyclooxygenases-1/2 (COX-1/2) using molecular docking, followed by molecular dynamics simulation, along with physicochemical, drug-likeness, pharmacokinetic (pk), and toxicokinetic (tk) properties. Molecular docking identified that these indole compounds are anchored, with the main amino acid residues, positioned in the binding pocket of the COX-1/2, required for selective inhibition. Moreover, the molecular dynamics simulation based on root mean square deviation (RMSD), radius of gyration (Rg), solvent accessible surface area (SASA), and root mean square fluctuation (RMSF) analyses showed that these natural brominated molecules transit rapidly to a progressive constant configuration during binding with COX-1/2 and seem to accomplish a consistent dynamic behavior by maintaining conformational stability and compactness. The results were comparable to the Food and Drug Administration (FDA)-approved selective COX inhibitor, aspirin. Furthermore, the free energy of binding for the compounds assessed by molecular mechanics–Poisson–Boltzmann surface area (MM–PBSA) confirmed the binding capacity of indoles towards COX-1/2, with suitable binding energy values except for the polar precursor tyrindoxyl sulfate (with COX-1). The physicochemical and drug-likeness analysis showed zero violations of Lipinski’s rule, and the compounds are predicted to have excellent pharmacokinetic profiles. These indoles are projected to be non-mutagenic and free from hepatotoxicity, with no inhibition of human ether-a-go–go gene (hERG) I inhibitors, and the oral acute toxicity LD₅₀ in rats is predicted to be similar or lower than aspirin. Overall, this work has identified a plausible mechanism for selective COX inhibition by natural marine indoles as potential therapeutic candidates for the mitigation of inflammation.     

Insights into the Ligand Binding to Bromodomain-Containing Protein 9 (BRD9): A Guide to the Selection of Potential Binders by Computational Methods

The estimation of the binding of a set of molecules against BRD9 protein was carried out through an in silico molecular dynamics-driven exhaustive analysis to guide the identification of potential novel ligands. Starting from eight crystal structures of this protein co-complexed with known binders and one apo form, we conducted an exhaustive molecular docking/molecular dynamics (MD) investigation. To balance accuracy and an affordable calculation time, the systems were simulated for 100 ns in explicit solvent. Moreover, one complex was simulated for 1 µs to assess the influence of simulation time on the results. A set of MD-derived parameters was computed and compared with molecular docking-derived and experimental data. MM-GBSA and the per-residue interaction energy emerged as the main indicators for the good interaction between the specific binder and the protein counterpart. To assess the performance of the proposed analysis workflow, we tested six molecules featuring different binding affinities for BRD9, obtaining promising outcomes. Further insights were reported to highlight the influence of the starting structure on the molecular dynamics simulations evolution. The data confirmed that a ranking of BRD9 binders using key parameters arising from molecular dynamics is advisable to discard poor ligands before moving on with the synthesis and the biological tests.     

Advances in Fungal Phenaloenones—Natural Metabolites with Great Promise: Biosynthesis,Bioactivities, and an In Silico Evaluation of Their Potential as Human Glucose Transporter 1 Inhibitors

Phenaloenones are structurally unique aromatic polyketides that have been reported in both microbial and plant sources. They possess a hydroxy perinaphthenone three-fused-ring system and exhibit diverse bioactivities, such as cytotoxic, antimicrobial, antioxidant, and anti-HIV properties, and tyrosinase, α-glucosidase, lipase, AchE (acetylcholinesterase), indoleamine 2,3-dioxygenase 1, angiotensin-I-converting enzyme, and tyrosine phosphatase inhibition. Moreover, they have a rich nucleophilic nucleus that has inspired many chemists and biologists to synthesize more of these related derivatives. The current review provides an overview of the reported phenalenones with a fungal origin, including their structures, sources, biosynthesis, and bioactivities. Moreover, more than 135 metabolites have been listed, and 71 references have been cited. SuperPred, an artificial intelligence (AI) webserver, was used to predict the potential targets for selected phenalenones. Among these targets, we chose human glucose transporter 1 (hGLUT1) for an extensive in silico study, as it shows high probability and model accuracy. Among them, aspergillussanones C (60) and G (60) possessed the highest negative docking scores of −15.082 and −14.829 kcal/mol, respectively, compared to the native inhibitor of 5RE (score: −11.206 kcal/mol). The MD (molecular dynamics) simulation revealed their stability in complexes with GLUT1 at 100 ns. The virtual screening study results open up a new therapeutic approach by using some phenalenones as hGLUT1 inhibitors, which might be a potential target for cancer therapy.     

Elucidating the Glucokinase Activating Potentials of Naturally Occurring Prenylated Flavonoids: An Explicit Computational Approach

Glucokinase activators are considered as new therapeutic arsenals that bind to the allosteric activator sites of glucokinase enzymes, thereby maximizing its catalytic rate and increasing its affinity to glucose. This study was designed to identify potent glucokinase activators from prenylated flavonoids isolated from medicinal plants using molecular docking, molecular dynamics simulation, density functional theory, and ADMET analysis. Virtual screening was carried out on glucokinase enzymes using 221 naturally occurring prenylated flavonoids, followed by molecular dynamics simulation (100 ns), density functional theory (B3LYP model), and ADMET (admeSar 2 online server) studies. The result obtained from the virtual screening with the glucokinase revealed arcommunol B (−10.1 kcal/mol), kuwanon S (−9.6 kcal/mol), manuifolin H (−9.5 kcal/mol), and kuwanon F (−9.4 kcal/mol) as the top-ranked molecules. Additionally, the molecular dynamics simulation and MM/GBSA calculations showed that the hit molecules were stable at the active site of the glucokinase enzyme. Furthermore, the DFT and ADMET studies revealed the hit molecules as potential glucokinase activators and drug-like candidates. Our findings suggested further evaluation of the top-ranked prenylated flavonoids for their in vitro and in vivo glucokinase activating potentials.     

Ligand and Structure-Based Virtual Screening in Combination,to Evaluate Small Organic Molecules as Inhibitors for the XIAP Anti-Apoptotic Protein: The Xanthohumol Hypothesis

Herein, we propose two chalcone molecules, (E)-1-(4-methoxyphenyl)-3-(p-tolyl) prop-2-en-1-one and (E)-3-(4-hydroxyphenyl)-1-(2,4,6-trihydroxyphenyl) prop-2-en-1-one, based on the anticancer bioactive molecule Xanthohumol, which are suitable for further in vitro and in vivo studies. Their ability to create stable complexes with the antiapoptotic X-linked IAP (XIAP) protein makes them promising anticancer agents. The calculations were based on ligand-based and structure-based virtual screening combined with the pharmacophore build. Additionally, the structures passed Lipinski’s rule for drug use, and their reactivity was confirmed using density functional theory studies. ADMET studies were also performed to reveal the pharmacokinetic potential of the compounds. The candidates were chosen from 10,639,400 compounds, and the docking protocols were evaluated using molecular dynamics simulations.     

Fruit Bromelain-Derived Peptide Potentially Restrains the Attachment of SARS-CoV-2 Variants to hACE2: A Pharmacoinformatics Approach

Before entering the cell, the SARS-CoV-2 spike glycoprotein receptor-binding domain (RBD) binds to the human angiotensin-converting enzyme 2 (hACE2) receptor. Hence, this RBD is a critical target for the development of antiviral agents. Recent studies have discovered that SARS-CoV-2 variants with mutations in the RBD have spread globally. The purpose of this in silico study was to determine the potential of a fruit bromelain-derived peptide. DYGAVNEVK. to inhibit the entry of various SARS-CoV-2 variants into human cells by targeting the hACE binding site within the RBD. Molecular docking analysis revealed that DYGAVNEVK interacts with several critical RBD binding residues responsible for the adhesion of the RBD to hACE2. Moreover, 100 ns MD simulations revealed stable interactions between DYGAVNEVK and RBD variants derived from the trajectory of root-mean-square deviation (RMSD), radius of gyration (Rg), and root-mean-square fluctuation (RMSF) analysis, as well as free binding energy calculations. Overall, our computational results indicate that DYGAVNEVK warrants further investigation as a candidate for preventing SARS-CoV-2 due to its interaction with the RBD of SARS-CoV-2 variants.     

In Silico Identification of Potential Sites for a Plastic-Degrading Enzyme by a Reverse Screening through the Protein Sequence Space and Molecular Dynamics Simulations

The accumulation of polyethylene terephthalate (PET) seriously harms the environment because of its high resistance to degradation. The recent discovery of the bacteria-secreted biodegradation enzyme, PETase, sheds light on PET recycling; however, the degradation efficiency is far from practical use. Here, in silico alanine scanning mutagenesis (ASM) and site-saturation mutagenesis (SSM) were employed to construct the protein sequence space from binding energy of the PETase–PET interaction to identify the number and position of mutation sites and their appropriate side-chain properties that could improve the PETase–PET interaction. The binding mechanisms of the potential PETase variant were investigated through atomistic molecular dynamics simulations. The results show that up to two mutation sites of PETase are preferable for use in protein engineering to enhance the PETase activity, and the proper side chain property depends on the mutation sites. The predicted variants agree well with prior experimental studies. Particularly, the PETase variants with S238C or Q119F could be a potential candidate for improving PETase. Our combination of in silico ASM and SSM could serve as an alternative protocol for protein engineering because of its simplicity and reliability. In addition, our findings could lead to PETase improvement, offering an important contribution towards a sustainable future.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

In Silico Analysis and In Vitro Characterization of the Bioactive Profile of Three Novel Peptides Identified from 19 kDa α-Zein Sequences of Maize

In this study, we characterized three novel peptides derived from the 19 kDa α-zein, and determined their bioactive profile in vitro and developed a structural model in silico. The peptides, 19ZP1, 19ZP2 and 19ZP3, formed α-helical structures and had positive and negative electrostatic potential surfaces (range of −1 to +1). According to the in silico algorithms, the peptides displayed low probabilities for cytotoxicity (≤0.05%), cell penetration (10–33%) and antioxidant activities (9–12.5%). Instead, they displayed a 40% probability for angiotensin-converting enzyme (ACE) inhibitory activity. For in vitro characterization, peptides were synthesized by solid phase synthesis and tested accordingly. We assumed α-helical structures for 19ZP1 and 19ZP2 under hydrophobic conditions. The peptides displayed antioxidant activity and ACE-inhibitory activity, with 19ZP1 being the most active. Our results highlight that the 19 kDa α-zein sequences could be explored as a source of bioactive peptides, and indicate that in silico approaches are useful to predict peptide bioactivities, but more structural analysis is necessary to obtain more accurate data.     

Computational Study of Asian Propolis Compounds as Potential Anti-Type 2 Diabetes Mellitus Agents by Using Inverse Virtual Screening with the DIA-DB Web Server,Tanimoto Similarity Analysis,and Molecular Dynamic Simulation

Propolis contains a wide range of pharmacological activities because of their various bioactive compounds. The beneficial effect of propolis is interesting for treating type-2 diabetes mellitus (T2DM) owing to dysregulation of multiple metabolic processes. In this study, 275 of 658 Asian propolis compounds were evaluated as potential anti-T2DM agents using the DIA-DB web server towards 18 known anti-diabetes protein targets. More than 20% of all compounds could bind to more than five diabetes targets with high binding affinity (<−9.0 kcal/mol). Filtering with physicochemical and pharmacokinetic properties, including ADMET parameters, 12 compounds were identified as potential anti-T2DM with favorable ADMET properties. Six of those compounds, (2R)-7,4′-dihydroxy-5-methoxy-8-methylflavone; (RR)-(+)-3′-senecioylkhellactone; 2′,4′,6′-trihydroxy chalcone; alpinetin; pinobanksin-3-O-butyrate; and pinocembrin-5-methyl ether were first reported as anti-T2DM agents. We identified the significant T2DM targets of Asian propolis, namely retinol-binding protein-4 (RBP4) and aldose reductase (AKR1B1) that have important roles in insulin sensitivity and diabetes complication, respectively. Molecular dynamic simulations showed stable interaction of selected propolis compounds in the active site of RBP4 and AKR1B1. These findings suggest that Asian propolis compound may be effective for treatment of T2DM by targeting RBP4 and AKR1B1.     

From Myricetin to the Discovery of Novel Natural Human ENPP1 Inhibitors: A Virtual Screening,Molecular Docking,Molecular Dynamics Simulation,and MM/GBSA Study

It was recently revealed that naturally occurring myricetin can inhibit ectonucleotidase ectonucleotide pyrophosphatase/phosphodiesterase 1 (ENPP1), which, in turn, can treat ischemic cardiac injury. However, due to myricetin’s poor druggability, its further developments are relatively limited, which necessitates the discovery of novel ENPP1-inhibiting myricetin analogs as alternatives. In this study, the binding model of myricetin with ENPP1 was elucidated by molecular docking and molecular dynamics studies. Subsequently, virtual screening on the self-developed flavonoid natural product database (FNPD), led to the identification of two flavonoid glycosides (Cas No: 1397173-50-0 and 1169835-58-8), as potential ENPP1 inhibitors. Docking scores and MM/GBSA binding energies predicted that they might have higher inhibitory effects than myricetin. This study provides a strong foundation for the future development of ischemic cardiac injury drugs.     

Computational Approaches for the Design of Novel Anticancer Compounds Based on Pyrazolo[3,4-d]pyrimidine Derivatives as TRAP1 Inhibitor

In the present in-silico study, various computational techniques were applied to determine potent compounds against TRAP1 kinase. The pharmacophore hypothesis DHHRR_1 consists of important features required for activity. The 3D QSAR study showed a statistically significant model with R² = 0.96 and Q² = 0.57. Leave one out (LOO) cross-validation (R² CV = 0.58) was used to validate the QSAR model. The molecular docking study showed maximum XP docking scores (−11.265, −10.532, −10.422, −10.827, −10.753 kcal/mol) for potent pyrazole analogs (42, 46, 49, 56, 43), respectively, with significant interactions with amino acid residues (ASP 594, CYS 532, PHE 583, SER 536) against TRAP1 kinase receptors (PDB ID: 5Y3N). Furthermore, the docking results were validated using the 100 ns MD simulations performed for the selected five docked complexes. The selected inhibitors showed relatively higher binding affinities than the TRAP1 inhibitor molecules present in the literature. The ZINC database was used for a virtual screening study that screened ZINC05297837, ZINC05434822, and ZINC72286418, which showed similar binding interactions to those shown by potent ligands. Absorption, distribution, metabolism, and excretion (ADME) analysis showed noticeable results. The results of the study may be helpful for the further development of potent TRAP1 inhibitors     

Natural Phytocompounds from Common Indian Spices for Identification of Three Potential Inhibitors of Breast Cancer: A Molecular Modelling Approach

Breast cancer is the second most common cancer-related cause of death for women throughout the globe. In spite of some effective measures, the main concerns with traditional anti-cancer chemotherapy are its low bioavailability, physical side effects, acquired resistance of cancer cells and non-specific targeting. Now researchers have taken the initiative to establish natural product-based therapy methods and to identify viable hits for future lead optimization in the development of breast cancer medication. Our study aims to identify the potent phytocompounds from five very popular Indian spices (Zingiber officinale Roscoe, Cuminum cyminum L., Piper nigrum L., Curcuma longa L., and Allium sativum L.). From these spices, a total of 200 phytocompounds were identified and screened against three target genes, namely, cyclin-dependent kinase 8 (CDK 8), progesterone receptor (PR) and epidermal growth factor receptor (EGFR), through structure-based virtual screening using iGEMDOCK 2.1 software. Based on the binding affinity score, the top three phytocompounds against each target protein (cynaroside (−149.66 Kcal/mol), apigetrin (−139.527 Kcal/mol) and curcumin (−138.149 Kcal/mol) against CDK8; apigetrin (−123.298 Kcal/mol), cynaroside (−118.635 Kcal/mol) and xyloglucan (−113.788 Kcal/mol) against PR; cynaroside (−119.18 Kcal/mol), apigetrin (−105.185 Kcal/mol) and xyloglucan (−105.106 Kcal/mol) against EGFR) were selected. Apigetrin, cynaroside, curcumin, and xyloglucan were finally identified for further docking analysis with the respective three target proteins. Autodock 4.2 was applied to screen the optimal binding position and to assess the relative intensity of binding interactions. In addition, the ADME/T property checks and bioactivity scores analysis of were performed to understand the suitability of these four phytocompounds to be potential candidates for developing effective and non-toxic anticancer agents. Based on this in silico analysis, we believe this study could contribute to current efforts to develop new drugs for treating breast cancer.     

Computational Simulations Highlight the IL2Rα Binding Potential of Polyphenol Stilbenes from Fenugreek

Widely used in global households, fenugreek is well known for its culinary and medicinal uses. The various reported medicinal properties of fenugreek are by virtue of the different natural phytochemicals present in it. Regarded as a promising target, interleukin 2 receptor subunit alpha (IL2Rα) has been shown to influence immune responses. In the present research, using in silico techniques, we have demonstrated the potential IL2Rα binding properties of three polyphenol stilbenes (desoxyrhaponticin, rhaponticin, rhapontigenin) from fenugreek. As the first step, molecular docking was performed to assess the binding potential of the fenugreek phytochemicals with IL2Rα. All three phytochemicals demonstrated interactions with active site residues. To confirm the reliability of our molecular docking results, 100 ns molecular dynamics simulations studies were undertaken. As discerned by the RMSD and RMSF analyses, IL2Rα in complex with the desoxyrhaponticin, rhaponticin, and rhapontigenin indicated stability. The RMSD analysis of the phytochemicals alone also demonstrated no significant structural changes. Based on the stable molecular interactions and comparatively slightly better MM/PBSA binding free energy, rhaponticin seems promising. Additionally, ADMET analysis performed for the stilbenes indicated that all of them obey the ADMET rules. Our computational study thus supports further in vitro IL2Rα binding studies on these stilbenes, especially rhaponticin.     

A robust in vitro Anticancer,Antioxidant and Antimicrobial Agents Based on New Metal-Azomethine Chelates Incorporating Ag(I), Pd (II) and VO (II) Cations: Probing the Aspects of DNA Interaction

A novel azomethine ligand (HNAP) [HNAP = 1-(Pyridin-3-yliminomethyl)-naphthalen-2-ol] and its Ag(I), Pd (II) and VO (II) chelates have been synthesized and structurally inspected using a wide range of spectroscopic and analytical tools, including infra-red (IR), ultraviolet-visible (UV-Vis) and ¹H NMR spectroscopy techniques, CHN analysis, molar conductance, magnetic susceptibility, and thermogravimetric analysis. The molar conductance measurements reveal that the chelates are non-electrolytes. The thermal behavior of the investigated metal chelates shows that the hydrated, coordinated water molecules and the anions are removed in successive steps followed immediately by decomposition of the ligand in the subsequent steps. The activation thermodynamic parameters are calculated from the TG curves and discussed. Complexes formation study via continuous variation m molar ratio has been investigated, and results were consistent to those found in the solid complexes with a ratio of (M:L) as (1:1) or 1:2 (M:L) molar ratio for all the monolithic and bi-valent metal complexes with square planar for Pd (II), and Ag(I) cations while, square pyramidal geometry for VO (II) cation. DFT calculations for the titled different metal-chelates have been studied and showed a good correlation with the experimental data. The prepared compounds had been checked In vitro towards numerous sorts of plant pathogenic fungi and bacteria to evaluate their antimicrobial properties and compared with some known antibiotics. Significantly, all the complexes show excellent antimicrobial activity against various strains of bacteria and fungi, including both Gram-negative and Gram-positive bacteria. Besides, the complexes exhibited high cytotoxicity against various carcinoma cell lines, including HCT-116, MCF-7, and HepG-2. Moreover, the effect of the new synthesized compounds as antioxidants was determined by reduction of 1,1-diphenyl-2-picryl hydrazyl (DPPH) and compared with that of Vitamin C. Furthermore, the binding interactions of the complexes with CT-DNA were explored using UV-Vis spectroscopy, viscosity and gel electrophoreses measurements. They cooperatively bind to DNA possibly through intercalations. The binding ability of the complexes was shown as HNAPAg > HNAPPd > HNAPVO complex.