A convergent synthesis of Hexahomotriazacalix

A new, convergent synthesis of hexahomotriazacalix[3]arenes 1a-e is described. The key transformation in this synthesis involves the coupling of the triamines 4a-d with 2, 6-bis(chloromethyl)-4-methylphenol 5 and results in the formation of the hexahomotriazacalix[3]arenes 1a-d in 90-95% yield. The triamines 4a-d were constructed by the one-pot reaction of monochloroaldehyde 3 and a primary amine followed by reduction to yield the triamines 4a-d in 50-55% yield. Deallylation of macrocycle 1d was accomplished by palladium catalysis to obtain the N-unsubstituted macrocycle 1e, which has the potential to be a precursor to a variety of N-substituted hexahomotriazacalix[3]arenes.     

Preparation and antimicrobial studies of acyclic sulfamates.

A series of acyclic sulfamates have been prepared and tested for antimicrobial activity. Thus, the oxysulfonyl isocyanates, ROSO2NCO (1a, R = 4-methoxyphenyl; 1b, R = phenyl; 1c, R = 4-chlorophenyl and 1d, R = 2,2,2-trifluoroethyl) have been prepared in 76-91% yield from chlorosulfonyl isocyanate. Treatment of 1a-d with glycidol gave the glycidyl carbamates 2a d. Internal cyclisation afforded the corresponding 4-hydroxymethyl-2-oxazolidinones 3a-d, which in turn were hydrolysed to give the free amino alcohols 4a-d. The yields were in the range 39-85%. A preliminary agar diffusion test of 2a-d, 3a-d, 4a-d indicated 2a-d and 3c to be possible antimicrobial agents. A more thorough analysis of these compounds revealed a minimum inhibition concentration (MIC) of 128 and 64 mg l-1 for glycidyl p-methoxyphenoxysulfonylcarbamate (2a) and glycidyl phenoxysulfonylcarbamate (2b) respectively, against Branhamella catarrhalis.     

Solid phase synthesis and application of trisubstituted thioureas

Resin-bound amines 1a-e condense with isothiocyanates to give thiourea resins 2a-i. Resins 2a-g subsequently react with iodomethane followed by cleavage affording S-methyl isothioureas 4a-g, and resins 2a-b,h-i react with acyl chlorides to afford N-acylated thioureas 6a-d. N-Acylthioureas 8a-f (R(2) = H) were prepared directly from resin-bound amines 1a-d with acyl isothiocyanates. N-Acylthioureas 8a-d,f(R(2) = H) were used for the preparation of S-methyl-N-acylisothioureas 10a-e. Alkylation was performed using methyl iodide. Resin-bound S-methyl-N-acylisothioureas 10a,b,d are converted by an action of hydrazines into 3-amino-1,2,4-triazoles 13a-d. Condensation of resins 8a-e (R(2) = H) with 2-bromoacetophenones in the presence of TEA affords thiazoles 15 a-e. All transformations proceeded in high yields and gave products of good purities.     

The 3-(N-tert-butylcarboxamido)-1-propyl group as an attractive phosphate/thiophosphate protecting group for solid-phase oligodeoxyribonucleotide synthesis

Among the various phosphate/thiophosphate protecting groups suitable for solid-phase oligonucleotide synthesis, the 3-(N-tert-butylcarboxamido)-1-propyl group is one of the most convenient, as it can be readily removed, as needed, under thermolytic conditions at neutral pH. The deprotection reaction proceeds rapidly (t(1/2) approximately 100 s) through an intramolecular cyclodeesterification reaction involving the amide function and the release of the phosphate/thiophosphate group as a 2-(tert-butylimino)tetrahydrofuran salt. Incorporation of the 3-(N-tert-butylcarboxamido)-1-propyl group into the deoxyribonucleoside phosphoramidites 1a-d is achieved using inexpensive raw materials. The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioate analogue is comparable to that of commercial 2-cyanoethyl deoxyribonucleoside phosphoramidites. These oligonucleotides were phosphate/thiophosphate-deprotected within 30 min upon heating at 90 degrees C in Phosphate-Buffered Saline (PBS buffer, pH 7.2). Since no detectable nucleobase modification or significant phosphorothioate desulfurization occurs, the 3-(N-tert-butylcarboxamido)-1-propyl group represents an attractive alternative to the 2-cyanoethyl group toward the large-scale preparation of therapeutic oligonucleotides.     

2-vinylpyrroles and pyrrolo[3,2-d]pyrimidines from direct addition of aldehydes to 4-amino-pyrrole-2-carboxylate derivatives

A new methodology for the direct preparation of 2-vinylpyrroles is presented. Treatment of 4-amino-pyrrole-2-carboxylates 5a-c and 6a-d with aliphatic aldehydes and TFA furnished 2-vinylpyrroles 2a-k in 9-87% yields. Under similar conditions ureidopyrroles 5a-c reacted with aryl aldehydes to provide pyrrolo[3,2-d]pyrimidines 1a-d in 28-63% yields.     

The 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleosides in the solid-phase synthesis of oligoribonucleotides

Emerging RNA-based technologies for controlling gene expression have triggered a high demand for synthetic oligoribonucleotides and have motivated the development of ribonucleoside phosphoramidites that would exhibit coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites. To fulfill these needs, the novel 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleoside phosphoramidites 9a-d has been implemented (Schemes 1 and 2). The solid-phase synthesis of AUCCGUAGCUAACGUCAUGG was then carried out employing 9a-d as 0.2 M solutions in dry MeCN and 5-benzylthio-1H-tetrazole as an activator. The coupling efficiency of 9a-d averaged 99% within a coupling time of 180 s. Following removal of all base-sensitive protecting groups, cleavage of the remaining 2'-[4-(N-methylamino)benzyl] acetals from the RNA oligonucleotide was effected in buffered 0.1 M AcOH (pH 3.8) within 30 min at 90 degrees C. RP-HPLC and PAGE analyses of the fully deprotected AUCCGUAGCUAACGUCAUGG were comparable to those of a commercial RNA oligonucleotide sharing an identical sequence. Enzymatic digestion of the RNA oligomer catalyzed by bovine spleen phosphodiesterase and bacterial alkaline phosphatase revealed no significant amounts of RNA fragments containing (2'-->5')-internucleotidic phosphodiester linkages or noteworthy nucleobase modifications.     

Structures, photoluminescence, and reversible vapoluminescence properties of neutral platinum(II) complexes containing extended pi-conjugated cyclometalated ligands

Reacting K2PtCl4 with the tridentate R-C(wedge)N(wedge)C-H2 ligands 2,6-di-(2'-naphthyl)-4-R-pyridine (R = H, 1a; Ph, 1b; 4-BrC6H4, 1c; 3,5-F2C6H3, 1d) in glacial acetic acid, followed by heating in dimethyl sulfoxide (DMSO), gave complexes [(R-C(wedge)N(wedge)C)Pt(DMSO)] (2a-d). In the crystal structures of 2a-c, the molecules are paired in a head-to-tail orientation with Pt...Pt separations >6.3 A, and there are extensive close C-H...pi (d = 2.656-2.891 A), pi...pi (d = 3.322-3.399 A), and C-H...O=S (d = 2.265-2.643 A) contacts. [(Ph-C(wedge)N(wedge)C)Pt(PPh3)] (3) was prepared by reacting 2b with PPh3. Reactions of 2a-d with bis(diphenylphosphino)methane (dppm) gave [(R-C(wedge)N(wedge)C)2Pt2(mu-dppm)] (4a-d). Both head-to-head (syn) and head-to-tail (anti) conformations were found for 4a.6CHCl3.C5H12, whereas only one conformation was observed for 4b.2CHCl3 (syn), 4c.3CH2Cl2 (syn), and 4d.2CHCl3 (anti). In the crystal structures of 4a-d, there are close intramolecular Pt...Pt contacts of 3.272-3.441 A in the syn conformers, and long intramolecular Pt...Pt separations of 5.681-5.714 A in the anti conformers. There are weak C-H...X (d = 2.497-3.134 A) and X...X (X = Cl or Br; d = 2.973-3.655 A) interactions between molecules 4a-d and occluded CHCl3/CH2Cl2 molecules, and their solvent channels are of varying diameters (approximately 9-28 A). Complexes 2a-d, 3, and 4a-d are photoluminescent in the solid state, with emission maxima at 602-643 nm. Upon exposure to volatile organic compounds, 4a shows a fast and reversible vapoluminescent response, which is most intense with volatile halogenated solvents (except CCl4). Powder X-ray diffraction analysis of desolvated 4a revealed a more condensed molecular packing of syn and anti complexes than crystal 4a.6CHCl3.C5H12.     

Re(2)(CO)(10)-promoted S-binding, C-S bond cleavage, and hydrogenation of benzothiophenes: organometallic models for the hydrodesulfurization of thiophenes

In hydrodesulfurization model reactions of dinuclear metal complexes with thiophenes, we observe that ultraviolet photolysis of Re(2)(CO)(10) and benzothiophenes (BT) in hexanes solution produces the ring-opened BT complexes Re(2)(CO)(7)(mu-BT) (1a-d) (BT = benzothiophene (BT) 1a, 2-methylbenzothiophene (2-MeBT) 1b, 3-methylbenzothiophene (3-MeBT) 1c, and 3,5-dimethylbenzothiophene (3,5-Me(2)BT) 1d). The eta(1)(S)-bound BT complexes Re(2)(CO)(9)(eta(1)(S)-BT) (2a-d), prepared from Re(2)(CO)(9)(THF) and BT, are readily converted into 1a-d in good yields (40-60%) during UV photolysis in hexanes solution, which suggests that the eta(1)(S)-bound complexes 2a-d are precursors to 1a-d in the reactions of Re(2)(CO)(10) with BT. Irradiation of Re(2)(CO)(10) and 3,5-Me(2)BT with UV light in decane solution under an atmosphere of H(2) produces complex 1d and the partially hydrogenated BT complex Re(2)(CO)(7)(mu-3,5-Me(2)BT-H)(eta-H) (3d). Reactions of 1a with phosphines yield further ring-opened BT-Re complexes of the types Re(2)(CO)(7)(PMe(3))(3)(mu-BT) (4) and Re(2)(CO)(7)(PR(3))(2)(mu-BT) (R = Me (5), (i)Pr (6), Cy (7), and bis(diethylphosphino)ethane (8)). Structures of 1d, 2c, 3d, and 6, which demonstrate various bonding modes of benzothiophene and its C-S cleaved derivatives to two metal centers, were determined by X-ray crystallographic studies.     

Well-defined silica-supported rare-earth silylamides

Rare-earth silylamides [Ln{N(SiMe3)2}3] [1a-d, Ln = Y (1a), La (1b), Nd (1c), Sm (1d)] react with partially dehydroxylated silica to generate the singly surface-bonded species [(Si-O)Ln{N(SiMe3)2}2] (2a-d). Trimethylsilylation of silanols occurs during the grafting process, affording in fine a hydroxyl-free surface. Contacting these well-defined surface species with excess triphenylphosphine oxide yields [(Si-O)Ln{N(SiMe3)2}2(OPPh3)] surface adducts 3a-d as the major (80%) species, leaving about 20% of unreacted siloxide bisamido species (20%). In addition to elemental analysis and infrared spectroscopy, solid-state NMR spectroscopy was used to characterize these new materials and proved to be a particularly efficient tool for the study of the paramagnetic Nd- and Sm-containing materials and for providing unambiguous verification of OPPh3 coordination on the rare-earth center. Silica-supported rare-earth amides 2a-d are active catalysts for 1-hexene and styrene hydrosilylation and for phenylacetylene dimerization. When compared to the molecular species 1a-d, grafting of the catalyst induces significant changes in the activity and selectivity of these systems.     

Head-to-tail regioregular oligothiophene-functionalized 9,9'-spirobifluorene derivatives. 1. Synthesis

Two series of novel fully conjugated oligomers, oligothiophene-functionalized 9,9'-spirobifluorene derivatives, have been developed in this contribution. First, four 9,9'-spirobifluorene bromide derivatives (compounds 1a-d) are prepared through various synthetic routes. Oligothiophene derivatives with or without substituents are synthesized through the Grignard and Suzuki coupling reactions. The Negishi coupling reactions between oligothienylzinc chloride and various 9,9'-spirobifluorene bromides with Pd(PPh(3))(4) as catalyst successfully produce the desired compounds, unsubstituted oligothiophene-functionalized 9,9'-spirobifluorene derivatives, compounds 2 to 4a-d. Since the Negishi coupling reactions afford regioregularly head-to-tail (H-T) oligo(4-n-hexylthiophene)-functionalized 9,9'-spirobifluorene derivatives in poor yields, the Suzuki coupling reactions between sodium 4-n-hexylthienyl-2-boronate 8, and various 9,9'-spirobifluorene-based bromides 1a-d and 9-16 are employed to produce highly regioregular head-to-tail oligothiophene-functionalized 9,9'-spirobifluorene derivatives (compounds 5 to 7a-d) in very high yields. We also investigate the effect of solvents on the Suzuki coupling reactions. The structure and purity of all compounds are verified by FT-IR, (1)H and (13)C NMR, MS, and elemental analysis.     

Synthesis of novel (1-alkanoyloxy-4-alkanoylaminobutylidene)-1,1-bisphosphonic acid derivatives

A novel strategy for the synthesis of (1-alkanoyloxy-4-alkanoylaminobutylidene)-1,1-bisphosphonic acid derivatives (1a-d) via (1-hydroxy-4-alkanoylaminobutylidene)-1,1-bisphosphonic acid derivatives (2a-d), starting from alendronate has been developed with reasonable 51-77% overall yields. Intermediate products, (1-hydroxy-4-alkanoylaminobutylidene)-1,1-bisphosphonic acid derivatives (2a-d), were prepared in water with reasonable to high yields (52-94%).     

Synthesis of 5H-tetrazolo[5,1-c][1,4]benzodiazepines

A three step synthesis of 5H-tetrazolo[5,1-c][1,4]benzodiazepin-11-ones 8a-d via the reaction of a substituted benzyl azide and ethyl cyanoformate is described. The derived lactams are converted to the corresponding 11-thiones 9a-d and, through the S-methylated derivatives, to the 11-amino analogs 11a-f. All of the described compounds are representatives of a novel ring system.     

Furopyridines. XIV. Synthesis of 2-aminoalkyl derivatives of furo[2,3-b]-, furo[3,2-b], furo[2,3-c]- and furo[3,2-c]pyridine

The preparation of 2-aminomethyl- 3a-d , 2-acetamidomethyl- 4a-d , 2-N,N-dimethylaminomethyl- 5a-d , 2-(1-hydroxy-2-nitroethyl)- 6a-d , 2-(1-hydroxyl-2-aminoethyl)- 7a-d and 2-(1-hydroxy-2-N,N-dimethylaminoethyl)- 8b-d derivatives of furo[2,3-b]-, furo[3,2-b]-, furo[2,3-c]- and furo[3,2-c]pyridine is described.     

Synthesis and evaluation of in vitro antibacterial activity of novel 2,5-disubstituted-1,3,4-thiadiazoles from fatty acids

A series of new 1-(alkenoyl/hydroxyalkenoyl)-4-benzoyl-thiosemicarbazides 2a-d and 2-benzamide-5-alkenyl/hydroxyalk-enyl-1,3,4-thiadiazoles 3a-d were synthesized from fatty acid hydrazides. Structure of all these compounds was confirmed by IR, 1H NMR, 13C NMR, mass spectra and elemental analysis. The bioassay results indicate that some compounds 2,c, 2d, 3c and 3d have good antibacterial activity.     

Synthesis of novel 4(5)-(5-aminotetrahydropyran-2-yl)imidazole derivatives and their in vivo release of neuronal histamine measured by brain microdialysis

The (2R,5S)-trans- and (2S,5S)-cis-stereoisomers 1a and 1b of 4(5)-(5-aminotetrahydropyran-2-yl)imidazole, which have two chiral centers and adopt a stable chair conformation, were synthesized via cyclization of diol intermediates 7 using L-glutamine as the starting material. Their enantiomers, (2S,5R)-trans-1c and (2R,5R)-cis-1d, were synthesized by the same methodology from D-glutamine. Stereo isomers 1a-d were converted into cyanoguanidines 11a-d, and into N-isopropyl and N-3,3-dimethylbutyl derivatives 12a-d and 13a-d, respectively. The results of in vivo brain microdialysis of the derivatives apparently indicated that only (2S,5R)-isomers increased the release of neuronal histamine. Among the many (2S,5R)-N-alkyl derivatives, 13c (OUP-133) and 18 (OUP-153) increased histamine release to 180-190% and 180-200% of basal levels, respectively, and were found to be novel histamine H(3) antagonists.     

Peri- and enantioselectivity of thermal, scandium-, and [pybox/scandium]-catalyzed Diels-Alder and hetero-Diels-Alder reactions of methyl (E)-2-oxo-4-aryl-butenoates with cyclopentadiene

The cycloaddition between methyl (E)-2-oxo-4-aryl-3-butenoates (2 a-d) and cyclopentadiene, in addition to the expected normal Diels-Alder (DA) adducts endo-3 a-d and exo-4 a-d, gives the less expected endo-5 a-d products of the [4+2] hetero-Diels-Alder (HDA) reaction in which the alpha-ketoester behaves as a heterodiene. If a comparison is made between the thermal and the scandium(III) triflate-catalyzed conditions, the periselectivity changes and whereas under thermal conditions the main products are those from the DA reaction (3 a-d), in the presence of Sc(OTf)3 (OTf=triflate), the HDA products 5 a-d become largely predominant. The reactions are enantioselectively catalyzed by the scandium(III) triflate complex of (4'S,5'S)-2,6-bis[4'-(triisopropylsilyl)oxymethyl-5'-phenyl-1',3'-oxazolin-2'-yl]pyridine (1) and both the DA and the HDA products are obtained with excellent enantiomeric excess, up to >99% ee. The X-ray crystallographic structure determination of 5 c assigns it the 4R,4aS,7aR absolute configuration. The thermal retro-Claisen rearrangement of 3 c into (4R,4aS,7aR)-5 c allows the correlation of their absolute configuration, and 3 c has therefore the 2R,3R configuration. By analogy the same absolute configuration can be assigned to 3 a,b,d and 5 a,b,d, and the stereospecific thermal Claisen rearrangement of the optically active 5 a,b,d into 3 a,b,d completes the correlation between their absolute configuration. The [3,3]-sigmatropic rearrangements can be easily carried out under catalytic conditions with scandium(III) triflate, which promotes the equilibration between 3 a-d and 5 a-d, with a different degree of enantioselectivity characterizing the process starting from 3 a-d or 5 a-d. The unambiguous attributions of the configuration to the products allows us to propose a rationale of the stereochemical outcome of the catalyzed cycloaddition and to investigate the reaction mechanism of the competing DA and HDA reactions and shifts in products distribution by acid catalysis.     

Radical-mediated hydroalkylation of 2-vinylpyrrolidine derivatives: a versatile entry into indolizidine alkaloids

A concise route for the preparation of two simple optically pure indolizidin-5-ones has been developed. The key chain elongation process was achieved using a triethylborane/catechol mediated hydroalkylation of Boc-protected 2-vinylpyrrolidines. By using complementary strategies, these two bicyclic lactams can be alkylated with complete control of the stereochemistry at C(5) and their conversion to a variety of indolizidine alkaloids such as coniceine, indolizidine 209 D and 167 B, 5-epi-indolizidine 249A and monomorine has been reported in the literature.     

Photochemistry of bicyclo[2.2.2]oct-7-ene-2,5-diones and the corresponding 5-hydroxyimino and 5-methylene derivatives

Synthesis and photochemistry of several title compounds 1-3 containing multiple chromophoric systems are described. The Diels-Alder reactions of 2,6,6-trimethylcyclohexa-2,4-dienone (5) with acetylenes 6a-d provided the adducts 7a-d, which upon hydrolysis furnished the desired bicyclo[2.2.2]octenediones 1a-d. Oximes 2a-d were prepared from diones 1a-d by treatment with hydroxylamine hydrochloride in pyridine. 5-Methylenebicyclo[2.2.2]oct-7-en-2-ones 3a-d were obtained via chemoselective Wittig reaction of the corresponding diones 1a-d. Bicyclo[2.2.2]octenediones 1a-c underwent chemoselective oxa-di-pi-methane rearrangement under sensitized conditions and suffered formal ketene extrusion upon direct irradiation. Direct irradiation of 1d afforded 11d via formal ketene extrusion but under sensitization it remained unchanged. Oximes 2a-d suffered ketene extrusion upon direct irradiation and E/Z isomerization under sensitized conditions. On the other hand, 5-methylenebicyclo[2.2.2]oct-7-en-2-ones 3a-d generally underwent 1,3-acyl shift. The plausible courses of all these photochemical processes are discussed.     

Generation of a silylethylene-titanium alkoxide complex. A versatile reagent for silylethylation and silylethylidenation of unsaturated compounds

(Trimethylsilyl)ethylene-titanium alkoxide complex (1) was generated from trimethyl(vinyl)silane, Ti(O-i-Pr)(4), and i-PrMgCl as a preformed alkene-titanium complex and reacted with several unsaturated compounds such as aldehyde, imine, other vinylsilane, and acetylene to give the corresponding coupling products 4a-f, 6, 8, and 10a-d in a regioselective manner. Both of the two carbon-titanium bonds of the complex 1 reacted successively with esters to afford silylcyclopropanols 11a-j, 13, and 15, some synthetic applications of which were illustrated in the preparation of beta-silyl ketones 16 and cyclopropenes 17. Asymmetric addition of 1 to a chiral acyloxazolidinone 19 gave optically active cyclopropanol (+)-11a of 50% ee.     

General preparative route to benzo[g]quinolines (1-azaanthracenes)

A convenient synthetic pathway to benzo[g]quinolines (1-azaanthracenes) has been developed. The nickel catalyzed coupling of methyl 2-chloronicotinate ( 3a ) with benzylic organo zinc reagents 2a-e led to the methyl 2-benzylic substituted nicotinates 4a-e. Treatment of methyl 2-chloro-6-methylnicotinate ( 3b )with 2a in a similar manner led to methyl 2-benzyl-6-methyInicotinate ( 4f ). The coupling of 2-chloro-3-acetylpyridine ( 5 ) with benzyl zinc bromide ( 2a ) led to 2-benzyl-3-acetylpyridine ( 4g ). The coupling of the 2,5-dichlorobenzylic organic zinc reagent ( 2f ) with methyl 2-choronicotinate ( 3a ) was unselective but readily coupled with methyl 2-bromonicotinate ( 6 ) to yield methyl 2-(2,5-dichlorobenzyl)nicotinate ( 4h ). The esters 4a-f,h on reduction with lithium aluminum hydride led to the corresponding alcohols 7a-f,h which were subsequently oxidized with manganese dioxide to the respective 2-benzylic substituted pyridine-3-carboxaldehydes 8a-f,h. In one case the coupling of benzy] zinc bromide ( 2a ) with 2-chloropyridine-3-carboxaldehyde ( 9 ) led directly to 2-benzylpyridine-3-carboxaldehyde ( 8a ), but in poor yield. Cyclizations of the aldehydes 8a-d,f,h or the ketone 4g with polyphosphoric acid afforded the benzo[g]quinolines 10a-d,f-h in high yields. Aldehyde 8e was cyclized to 10e using a solution of sulfuric acid in methanol. Several of the benzo[g]quinolines 10c,d could be readly converted into the benzo[q]quinoline-5,10-diones 11c,d on treatment with ammonium ceric nitrate.