Mixed ligand ruthenium(II) complexes of bis(pyrid-2-yl)-/bis(benzimidazol-2-yl)-dithioether and diimines: study of non-covalent DNA binding and cytotoxicity

A series of mixed ligand ruthenium(II) complexes [Ru(pdto)(diimine)](ClO4)2/(PF6)2 1-3 and [Ru(bbdo)(diimine)](ClO4), 4-6, where pdto is 1,8-bis(pyrid-2-yl)-3,6-dithiooctane, bbdo is 1,8-bis(benzimidazol-2-yl)-3,6-dithiooctane and diimine is 1,10-phenanthroline (phen), dipyrido-[3,2-d:2',3'-f]-quinoxaline (dpq) and dipyrido[3,2-a:2',3'-c]phenazine (dppz), have been isolated and characterised by analytical and spectral methods. The complexes [Ru(pdto)(phen)](PF6)2 la, [Ru(pdto)(dpq)(Cl](PF6) 2a, [Ru(bbdo)(phen)](PF6)2 4a and [Ru(bbdo)(dpq)](ClO4)2 5 have been structurally characterized and their coordination geometries around ruthenium(II) are described as distorted octahedral. In la, 4a and 5 the two thioether sulfur and two py/bzim nitrogen atoms of the tetradentate pdto/bbdo ligand are folded around Ru(II) to give predominantly a "cis-alpha" configuration. (I)H NMR spectral data of the complexes support this configuration in solution. In [Ru(pdto)(dpq)Cl](PF6) 2a with a distorted octahedral coordination geometry, one of the two py nitrogens of pdto is not coordinated. The DNA binding constants (Kb: 2, 2.00 +/- 0.02 x 10(4) M(-1), s = 1.0; 3, 3.00 +/- 0.01 x 10(6) M(-1), s = 1.3) determined by absorption spectral titrations of the complexes with CT DNA reveal that 3 interacts with DNA more tightly than 2 through partial intercalation of the extended planar ring of coordinated dppz with the DNA base stack. The DNA binding affinities of the complexes increase with increase in the number of planar aromatic rings in the co-ligand, and on replacing both the py moieties in pdto complexes (1-3) by bzim moieties to give bbdo complexes (4-6). Upon interaction with CT DNA the complexes 1, 2, 5 and 6 show a decrease in anodic current in the cyclic voltammograms. On the other hand, interestingly, 3 and 4 show an increase in anodic current suggesting their involvement in electrocatalytic guanine oxidation. Interestingly, of all the complexes, only 6 alters the superhelicity of DNA upon binding with supercoiled pBR322 DNA. The cytotoxicities of the dppz complexes 3 and 6, which avidly bind to DNA, have been examined by screening them against cell lines of different cancer origins. It is noteworthy that 6 exhibits selectivity with higher cytotoxicity against the melanoma cancer cell line (A375) than other cell lines, potency approximately twice that of cisplatin and toxicity to normal cells 3 and 90 times less than cisplatin and adriamycin respectively.     

Cellular uptake, cytotoxicity, apoptosis, antioxidant activity and DNA binding of polypyridyl ruthenium(II) complexes

Ruthenium(II) polypyridyl complexes [Ru(phen)₂(APIP)](ClO₄)₂1 and [Ru(phen)₂(HAPIP)](ClO₄)₂2 have been synthesized and characterized. The DNA-binding behaviors were investigated by electronic absorption titration, luminescence spectra, viscosity measurements, thermal denaturation and photoactivated cleavage. The DNA-binding constants K_b for complexes 1 and 2 were determined to be 3.38 (±0.42) × 10⁵ M⁻¹ (s = 1.48) and 3.93 (±0.60) × 10⁵ M⁻¹ (s = 3.14), respectively. The studies on the photocleavage demonstrated that the effects of cleavage are concentration-dependent. The results showed that complexes 1 and 2 interact with CT-DNA by intercalative mode. The cytotoxicity of complexes 1 and 2 has been evaluated by MTT method. The apoptosis assay was carried out with acridine orange/ethidium bromide (AO/EB) staining methods. The cellular uptake showed that complexes can enter into the cytoplasm and accumulate in the nuclei. The antioxidant activity studies suggested that the ligands and complexes may be potential drugs to eliminate the radical.     

Spectroelectrochemistry and localization of added electrons in ruthenium (II) mixed-ligand complexes

The ruthenium (II) mixed-ligand complexes cis-[Ru(bpy)₂(NCS)₂] (I), [Ru(bpy)₂(pn)]²⁺ (II) and [Ru(bpy)₂(phen)]²⁺ (III) (bpy, 2,2′-bipyridine; pn, 1,2-diaminopropane; phen, 1,10-phenanthroline) were subjected to two (for I and II), and three (for III) stepwise, one-electron reductions, and one-electron oxidations (all fully reversible); the products were studied in situ by solution UV—vis-near IR spectroscopy. The first two reductions took place in all cases on separate bpy ligands, while the third reduction of III took place on phen. Bands of the reduced species in the near IR—vis region are observed and assigned to anion radical ligands. Novel features of the LMCT bands of the oxidized species are presented and discussed.     

Ruthenium(II)–arene complexes of diimines: Effect of diimine intercalation and hydrophobicity on DNA and protein binding and cytotoxicity

A series of half‐sandwich Ru(II)–arene complexes [Ru(η⁶‐benzene)(diimine)Cl](PF₆) ( 1 – 4 ), where diimine is 1,10‐phenanthroline ( 1 ), 5,6‐dimethyl‐1,10‐phenanthroline ( 2 ), dipyrido[3,2‐a:2′,3′‐c]phenazine ( 3 ) or 11,12‐dimethyldipyrido[3,2‐a:2′,3′‐c]phenazine ( 4 ), have been isolated and characterized using analytical and spectral methods. Complex 2 possesses a familiar pseudo‐octahedral ‘piano‐stool’ structure. The intrinsic DNA binding affinity of the complexes depends upon the diimine ligand: 3 (dppz) > 4 (11,12‐dmdppz) > 2 (5,6‐dmp) > 1 (phen). The π‐stacking interaction of extended planar ring of coordinated dppz ( 3 ) in between the DNA base pairs is more intimate than that of phen ( 1 ), and the incorporation of methyl groups on the dppz ring ( 4 ) discourages the stacking interaction leading to a lower DNA binding affinity for 4 than 3 . Docking studies show that all the complexes bind in the major groove of DNA. Interestingly, 3 shows an ability to convert supercoiled DNA into nicked circular DNA even at 20 μM concentration beyond which complete oxidative DNA degradation is observed. The protein binding affinity of the complexes decreases in the order 4 > 3 > 2 > 1 , and the higher protein binding affinity of 4 illustrates the strong involvement of methyl groups on dppz ring in hydrophobic interaction with protein. Also, 4 cleaves protein more efficiently than the other complexes in the presence of H₂O₂. It is notable that 2 , 3 and 4 display cytotoxicity against human cervical cancer cell lines (SiHa) with potency higher than the currently used drug cisplatin. Acridine orange/ethidium bromide staining studies reveal that 3 induces apoptosis in cancer cells much more efficiently than 4 .     

DNA binding and topoisomerase II inhibitory activity of water-soluble ruthenium(II) and rhodium(III) complexes

Water-soluble piano-stool arene ruthenium complexes based on 1-(4-cyanophenyl)imidazole (CPI) and 4-cyanopyridine (CNPy) with the formulas [(eta6-arene)RuCl2(L)] (L = CPI, eta6-arene = benzene (1), p-cymene (2), hexamethylbenzene (3); L = CNPy, eta6-arene = benzene (4), p-cymene (5), hexamethylbenzene (6)) have been prepared by our earlier methods. The molecular structure of [(eta6-C6Me6)RuCl2(CNPy)] (6) has been determined crystallographically. Analogous rhodium(III) complex [(eta5-C5Me5)RhCl2(CPI)] (7) has also been prepared and characterized. DNA interaction with the arene ruthenium complexes and the rhodium complex has been examined by spectroscopic and gel mobility shift assay; condensation of DNA and B-->Z transition have also been described. Arene ruthenium(II) and EPh3 (E = P, As)-containing arene ruthenium(II) complexes exhibited strong binding behavior, however, rhodium(III) complexes were found to be Topo II inhibitors with an inhibition percentage of 70% (7) and 30% (7a). Furthermore, arene ruthenium complexes containing polypyridyl ligands also act as mild Topo II inhibitors (10%, 3c and 40%, 3d) in contrast to their precursor complexes. Complexes 4-6 also show significant inhibition of beta-hematin/hemozoin formation activity.     

Preparation and reactivity of mixed-ligand ruthenium(II) hydride complexes with phosphites and polypyridyls

Chloro complexes [RuCl(N-N)P3]BPh4 (1-3) [N-N = 2,2'-bipyridine, bpy; 1,10-phenanthroline, phen; 5,5'-dimethyl-2,2'-bipyridine, 5,5'-Me2bpy; P = P(OEt)3, PPh(OEt)2 and PPh2OEt] were prepared by allowing the [RuCl4(N-N)].H2O compounds to react with an excess of phosphite in ethanol. The bis(bipyridine) [RuCl(bpy)2[P(OEt)3]]BPh4 (7) complex was also prepared by reacting RuCl2(bpy)2.2H2O with phosphite and ethanol. Treatment of the chloro complexes 1-3 and 7 with NaBH4 yielded the hydride [RuH(N-N)P3]BPh4 (4-6) and [RuH(bpy)2P]BPh4 (8) derivatives, which were characterized spectroscopically and by the X-ray crystal structure determination of [RuH(bpy)[P(OEt)3]3]BPh4 (4a). Protonation reaction of the new hydrides with Br?nsted acid was studied and led to dicationic [Ru(eta2-H2)(N-N)P3]2+ (9, 10) and [Ru(eta(2-H2)(bpy)2P]2+ (11) dihydrogen derivatives. The presence of the eta2-H2 ligand was indicated by a short T(1 min) value and by the measurements of the J(HD) in the [Ru](eta2-HD) isotopomers. From T(1 min) and J(HD) values the H-H distances of the dihydrogen complexes were also calculated. A series of ruthenium complexes, [RuL(N-N)P3](BPh4)2 and [RuL(bpy)2P](BPh4)2 (P = P(OEt)3; L = H2O, CO, 4-CH3C6H4NC, CH3CN, 4-CH3C6H4CN, PPh(OEt)2], was prepared by substituting the labile eta2-H2 ligand in the 9, 10, 11 derivatives. The reactions of the new hydrides 4-6 and 8 with both mono- and bis(aryldiazonium) cations were studied and led to aryldiazene [Ru(C6H5N=NH)(N-N)P3](BPh4)2 (19, 21), [[Ru(N-N)P3]2(mu-4,4'-NH=NC6H4-C6H4N=NH)](BPh4)4 (20), and [Ru(C6H5N=NH)(bpy)2P](BPh4)2 (22) derivatives. Also the heteroallenes CO2 and CS2 reacted with [RuH(bpy)2P]BPh4, yielding the formato [Ru[eta1-OC(H)=O](bpy)2P]BPh4 and dithioformato [Ru[eta1-SC(H)=S](bpy)2P]BPh4 derivatives.     

Electrochemical behaviour of dicyanobis(2,2′-bipyridine) ruthenium(II) and dicyanobis(1,10-phenanthroline) ruthenium(II) complexes

The electrochemical behaviour of Ru(bipy)₂(CN)₂ and Ru(phen)₂(CN)₂ (bipy=2,2′-bipyridine; phen=1,10-phenanthroline) has been investigated in dimethylformamide. Both complexes exhibit one oxidation wave and three reduction waves. In the case of Ru(bipy)₂-(CN)₂ the anodic process and the first two cathodic processes involve one electron and are reversible in the time scale of polarographic and cyclic voltammetric experiments. The third reduction step is irreversible and has been attributed to the addition of three electrons to Ru(bipy)₂(CN)₂ followed by liberation of one or more ligands and reduction of liberated bipyridine. The features of the redox processes for the Ru(phen)₂(CN)₂ are similar to those found for the bipy complex except for the first reduction wave, which is complicated by adsorption phenomena. A qualitative MO discussion of the redox processes is also reported.     

Controlling the helicity of 2,2'-bipyridyl ruthenium(II) and zinc(II) hemicage complexes

Two enantiomers of a new 4,5-pineno-2,2'-bipyridine ligand were synthesized and subsequently incorporated into hemicage ligands through a phenyl linker to yield ligands (+)-L1 and (-)-L1 or through a mesityl linker to yield ligands (+)-L2 and (-)-L2. Complexation of these ligands to Ru(II) afforded diastereomerically pure Delta and Lambda isomers, as verified through circular dichroism and circularly polarized luminescence spectroscopy. Ligands (+)-L2 and (-)-L2 were further coordinated to Zn(II) to form a complex with intriguing photophysical properties. Whereas Zn(bpy)32+ was shown to be a fluorescent emitter outside the visible spectrum, the caging process provided an unprecedented enhancement of intersystem crossing and subsequent switching to the phosphorescent emission of blue light. Additionally, the chiroptical properties of the Zn(II) complexes were also studied.     

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+{bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the Lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+{Me(2)bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association with hairpin oligonucleotides, again with the Lambda enantiomer binding more strongly. A (1)H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.     

Spectral characteristics, DNA-binding and cytotoxicity of two functional Ru(II) mixed-ligand complexes

Two functional Ru(II) mixed-ligand complexes, [Ru(phen)(2)(ttbd)](2+) (1) (ttbd = 4-(6-propenyl-pyrido[3,2-a]phenzain-10-yl-benzene-1,2-diamine, phen = 1,10-phenanthroline) and [Ru(bpy)(2)(ttbd)](2+) (2) (bpy = 2,2'-bipyridine), have been synthesized and characterized. The spectral characteristics of complexes 1 and 2 were investigated using fluorescence spectroscopy and revealed that both complexes were very sensitive to solvent polarity and oxygen molecules in nonaqueous solvents. The binding properties of the two complexes towards calf thymus DNA (CT-DNA) were investigated with different spectrophotometric methods, viscosity measurements and quantum chemistry calculations, indicating that both complexes could enantioselectively bind to CT-DNA by means of intercalation, but with different binding strengths and discrimination. On the other hand, the cytotoxicity of both complexes have been evaluated by MTT assays and Giemsa staining experiments. The main results reveal that the hydrophobicity and surface area of the ancillary ligands have a significant effect on their DNA binding behavior and both complexes are likely to be useful for optically probing nonaqueous and oxygen-free environments.     

Synthesis,characterization, DNA binding,DNA cleavage,antioxidant and in vitro cytotoxicity studies of ruthenium(II) complexes containing hydrazone ligands

The synthesis, spectral characterization, and biological studies of ruthenium(II) hydrazone complexes [RuCl(CO)(PPh₃)₂L] (where L = hydrazone ligands) have been carried out. The hydrazones are monobasic bidentate ligands with O and N as the donors and are preferably found in the enol form in all the complexes. The molecular structure of the ligands HL¹, HL²_, and HL³ were determined by single-crystal X-ray diffraction. The DNA binding studies of the ligands and complexes were carried out by absorption spectroscopic and viscosity measurements. The results revealed that the ligands and complexes bind to DNA via intercalation. The DNA cleavage activity of the complexes, evaluated by gel electrophoresis assay, revealed that the complexes are good DNA cleaving agents. The antioxidant properties of the complexes were evaluated against DPPH, OH, and NO radicals, which showed that the complexes have strong radical-scavenging. Further, the in vitro cytotoxic effect of the complexes examined on HeLa and MCF-7 cancer cell lines showed that the complexes exhibited significant anticancer activity.     

DNA binding,cleavage, and cytotoxicity of binuclear phenolate nickel(II) complexes

Three binuclear phenolate complexes, [Ni₂(L¹)₂(OAc)](BPh₄)·DMF (1), [Ni₂(L²)₂(OAc)](BPh₄) (2), and [Ni₂(L³)₂(OAc)](OH)·3H₂O (3), where L¹ = 2-{[bis-(2-hydroxy-ethyl)-amino]-methyl}-4-methyl-phenol, L² = 2-{[bis-(2-hydroxy-ethyl)-amino]-methyl}-4-methoxy-phenol, and L³ = 2-{[bis-(2-hydroxy-ethyl)-amino]-methyl}-4-tert-butyl-phenol), have been synthesized. Single-crystal diffraction reveals that all the metal atoms are in a distorted octahedral geometry. The interactions of the complexes with calf thymus DNA (CT-DNA) have been investigated by UV–vis absorption, fluorescence emission, and circular dichroism spectroscopy and viscosity measurements. Furthermore, DNA cleavage mechanism shows that the complexes may be capable to promote DNA cleavage through oxidative DNA damage pathway, which is indicative of the involvement of hydroxyl radical, singlet oxygen, or singlet oxygen-like entity in the cleavage process. Cytotoxicity studies on the Hela and MCF-7 cancer cell lines show that complexes 1–3 exhibit excellent activity toward the tested tumor cell lines with respect to the standard drug carboplatin, revealing that they have the potential to act as effective metal-based anticancer drugs.     

DNA binding and cytotoxicity of ruthenium(II) and rhenium(I) complexes of 2-amino-4-phenylamino-6-(2-pyridyl)-1,3,5-triazine

[Ru(tBu2bpy)2(2-appt)](PF6)2 [1.(PF6)2, tBu2bpy = 4,4'-di-tert-butyl-2,2'-bipyridine, 2-appt = 2-amino-4-phenylamino-6-(2-pyridyl)-1,3,5-triazine] and [Re(CO)3(2-appt)Cl] (2) were prepared and characterized by X-ray crystal analysis. The binding of 1.(PF6)2 and 2 to calf thymus DNA (ct DNA) led to increases in the DNA melting temperature (Delta Tm = +12 degrees C), modest hypochromism (29% and 5% of the absorption bands at lambda max = 450 and 376 nm, respectively), and insignificant shifts in the absorption maxima. The binding constants of 1.(PF6)2 and 2 with ct DNA, as determined by absorption titration, are (8.9 +/- 0.5) x 104 and (3.6 +/- 0.1) x 104 dm3 mol-1, respectively. UV-vis absorption titration, DNA melting studies, and competition dialysis using synthetic oligonucleotides [poly(dA-dT)2 and poly(dG-dC)2] revealed that 1.(PF6)2 and 2 exhibit a binding preference for AT sequences. A modeling study on the interaction between 1 or 2 and B-DNA revealed that the minor groove is the most favored binding site and an extensive hydrogen-bonding network is formed. As determined by MTT assays, 1.(PF6)2 and 2 exhibited moderate cytotoxicities toward several human cancer cell lines (KB-3-1, HepG2, and HeLa), as well as a multi-drug-resistant cancer cell line (KB-V-1). According to confocal microscopic and flow cytometric studies, 1.(PF6)2 and 2 induced apoptosis (50-60%) in cancer cells with <5% necrosis detected.     

The isolation and secondary functionalisation of fac-tris-2,2'-bipyridine complexes of ruthenium(II)

fac-Ruthenium(II) tris-(5-carboxy-2,2'-bipyridine) has been synthesised as a single geometric isomer for the first time, and proves to be a good 'building-block' to introduce new functionality with retention of the isomeric integrity.     

Cationic carbonyl complexes of ruthenium(II) and osmium(II) containing 2,2′-bipyridyl and 1,10-phenanthroline

Summary Reactions of ruthenium carbonyl complexes of the type [RuX₂(CO)(Ph₂RAs)₃] (X=Cl or Br; R=Me or Et) with 2,2-bipyridyl (bipy) and 1,10-phenanthroline (phen) in alcohol produce orange red cationic products of the formula [RuX(CO)(N-N)(Ph₂RAs)₂]ClO₄ (N-N=bipy or phen). Likewise, the hydridocarbonyls of ruthenium and osmium of the type [MHX(CO)(Ph₂RAs)₃] (M=Ru or Os) react with bipy and phen to yield yellow cationic complexes of the composition [(MH(CO)(N-N)(Ph₂RAs)₂]ClO₄. Structures have been assigned to all the complexes on the basis of i.r. and¹ H n.m.r. spectral data.     

Thin-film solid-state electroluminescent devices based on tris(2,2'-bipyridine)ruthenium(II) complexes

The behavior of light-emitting electrochemical cells (LEC) based on solid films ( approximately 100 nm) of tris(2,2'-bipyridine)ruthenium(II) between an ITO anode and a Ga-In cathode was investigated. The response times were strongly influenced by the nature of the counterion: small anions (BF(4)(-) and ClO(4)(-)) led to relatively fast transients, while large anions (PF(6)(-), AsF(6)(-)) produced a slow time-response. From comparative experiments of cells prepared and tested in a glovebox to those in ambient, mobility of the anions in these films appears to be related to the presence of traces of water from atmospheric moisture. An electrochemical model is proposed to describe the behavior of these LECs. The simulation results agreed well with experimental transients of current and light emission as a function of time and show that the charge injection is asymmetric at the two electrodes. At a small bias, electrons are the major carriers, while for a larger bias the conduction becomes bipolar.     

Tris(2,2'-bipyridyl)ruthenium(II) chemiluminescence

This paper critically reviews analytical applications of the chemiluminescence from tris(2,2'-bipyridyl)ruthenium(II) and related compounds published in the open literature between mid-1998 and October 2005. Following the introduction, which summarises the reaction chemistry and reagent generation, the review divides into three major sections that focus on: (i) the techniques that utilise this type of detection chemistry, (ii) the range of analytes that can be determined, and (iii) analogues and derivatives of tris(2,2'-bipyridyl)ruthenium(II).     

Crystal structure of tetracarbonyl(2,2'-dipyridylamine)tungsten.

Tetracarbonyl(2,2'-dipyridylamine)tungsten was prepared from W(CO)6 and 2,2'-dipyridylamine in toluene. The structure was determined by an X-ray diffraction analysis. Crystal data: triclinic; space group, P-1 (No.2); a = 8.454(1)A, b = 13.369(2)A, c = 6.9452(9) A, a= 85.88(1) degrees, beta = 68.28(1) degrees, gamma = 80.93(1) degrees, V= 720.0(1)AI; Z = 2.     

DNA binding, nuclease activity and cytotoxicity studies of Cu(II) complexes of tridentate ligands

Cu(II) complexes of three tridentate ligands, L(1), L(2) and L(3), [L(1), N-((1H-imidazole-2-yl)methyl)-2-(pyridine-2-yl)ethanamine; L(2), N-((1-methyl-1H-imidazole-2-yl)methyl)-2-(pyridine-2-yl)ethanamine; L(3), 2-(pyridine-2-yl)-N-((pyridine-2-yl)methyl)ethanamine] respectively, were synthesized and characterized. The single crystal X-ray structure of complex 1 reveals the pseudo octahedral coordination geometry around the copper center. Absorption and fluorescence experimental evidence show good DNA binding propensity (in the order of 10(5) M(-1)) of the complexes. Thermal denaturation and circular dichroism (CD) analyses reveal minor structural changes of calf thymus (CT) DNA in presence of complexes and groove and/or surface binding of the complexes to CT-DNA. Kinetic DNA cleavage assay shows pseudo-first-order kinetic reaction between the complex and supercoiled (SC) DNA. In addition, mechanistic SC DNA cleavage results show higher DNA cleavage activity in presence of reducing agent, due to the presence of hydroxyl radicals. In vitro cytotoxicity assay of the complexes demonstrate that the complexes have low toxicity for different cancer cell lines and IC(50) values were between 37 and 156 μM.