UV-Vis, NMR, and time-resolved spectroscopy analysis of photoisomerization behavior of three- and six-azobenzene-bound tris(bipyridine)cobalt complexes

The photoisomerization properties of tris(bipyridine)cobalt complexes containing six or three azobenzene moieties, namely, [Co(II)(dmAB)3](BF4)2 [dmAB = 4,4'-bis[3'-(4'-tolylazo)phenyl]-2,2'-bipyridine], [Co(III)(dmAB)3](BF4)3, [Co(II)(mAB)3](BF4)2 [mAB = 4-[3' '-(4' '-tolylazo)phenyl]-2,2'-bipyridine], and [Co(III)(dmAB)3](BF4)3, derived from the effect of gathering azobenzenes in one molecule and the effect of the cobalt(II) or cobalt(III) ion were investigated using UV-vis absorption spectroscopy, femtosecond transient spectroscopy, and 1H NMR spectroscopy. In the photostationary state of these four complexes, nearly 50% of the trans-azobenzene moieties of the Co(II) complexes were converted to the cis isomer, and nearly 10% of the trans-azobenzene moieties of the Co(III) complexes isomerized to the cis isomer, implying that the cis isomer ratio in the photostationary state upon irradiation at 365 nm is controlled not by the number of azobenzene moieties in one molecule but rather by the oxidation state of the cobalt ions. The femtosecond transient absorption spectra of the ligands and the complexes suggested that the photoexcited states of the azobenzene moieties in the Co(III) complexes were strongly deactivated by electron transfer from the azobenzene moiety to the cobalt center to form an azobenzene radical cation and a Co(II) center. The cooperation among the photochemical structural changes of six azobenzene moieties in [Co(II)(dmAB)3](BF4)2 was investigated with 1H NMR spectroscopy. The time-course change in the 1H NMR signals of the methyl protons indicated that each azobenzene moiety in [Co(II)(dmAB)3](BF4)2 isomerized to a cis isomer with a random probability of 50% and without interactions among the azobenzene moieties.     

Amphiphilic ruthenium sensitizers and their applications in dye-sensitized solar cells

Amphiphilic ligands 4,4'-bis(1-adamantyl-aminocarbonyl)-2,2'-bipyridine (L(1)), 4,4'-bis[5-[N-[2-(3beta-cholest-5-en-3-ylcarbamate-N-yl)ethyl]aminocarbonyl]]-2,2'-bipyridine (L(2)), 4,4'-bis[5-[N-[2-(3beta-cholest-5-en-3-ylcarbamate-N-yl)propyl]aminocarbonyl]]-2,2'-bipyridine (L(3)), and 4,4'-bis(dodecan-12-ol)-2,2'-bipyridine (L(4)) and their heteroleptic ruthenium(II) complexes of the type [Ru(II)LL(1)(NCS)(2)] (5), [Ru(II)LL(2)(NCS)(2)] (6), [Ru(II)LL(3)(NCS)(2)] (7), and [Ru(II)LL(4)(NCS)(2)] (8) (where L = 4,4'-bis(carboxylic acid)-2,2'-bipyridine) have been synthesized starting from dichloro(p-cymene)ruthenium(II) dimer. All the ligands and the complexes were characterized by analytical, spectroscopic, and electrochemical techniques. The performance of these complexes as charge-transfer photosensitizers in nanocrystalline TiO(2)-based solar cells was studied. When complexes 5-8 anchored onto a 12 + 4 microm thick nanocrystalline TiO(2) films, very efficient sensitization was achieved (85 +/- 5% incident photon-to-current efficiencies in the visible region, using an electrolyte consisting of 0.6 M butylmethylimidazolium iodide, 0.05 M I(2), 0.1 M LiI, and 0.5 M tert-butyl pyridine in 1:1 acetonitrile + valeronitrile). Under standard AM 1.5 sunlight, the complex 8 yielded a short-circuit photocurrent density of 17 +/- 0.5 mA/cm(2), the open-circuit voltage was 720 +/- 50 mV, and the fill factor was 0.72 +/- 0.05, corresponding to an overall conversion efficiency of 8.8 +/- 0.5%.     

Cobalt(II) complexes of terpyridine bases as photochemotherapeutic agents showing cellular uptake and photocytotoxicity in visible light

Cobalt(II) complexes of terpyridine bases [Co(L)?](ClO?)? (1-3), where L is 4'-phenyl-2,2':6',2'-terpyridine (ph-tpy in 1), 4'-(9-anthracenyl)-2,2':6',2'-terpyridine (an-tpy in 2) and 4'-(1- pyrenyl)-2,2':6',2'-terpyridine (py-tpy in 3), are prepared and their photo-induced DNA and protein cleavage activity and photocytotoxic property in HeLa cells studied. The 1?:?2 electrolytic and three-electron paramagnetic complexes show a visible band near 550 nm in DMF-Tris-HCl buffer. The complexes 1-3 show emission spectral bands at 355, 421 and 454 nm, respectively, when excited at 287, 368 and 335 nm. The quantum yield values for 1-3 in DMF-H?O (2?:?1 v/v) are 0.025, 0.060 and 0.28, respectively. The complexes are redox active in DMF-0.1 M TBAP. The Co(III)-Co(II) and Co(II)-Co(I) couples appear as quasi-reversible cyclic voltammetric responses near 0.2 and -0.7 V vs. SCE, respectively. Complexes 2 and 3 are avid binders to calf thymus DNA giving K(b) value of ～10? M?1. The complexes show chemical nuclease activity. Complexes 2 and 3 exhibit oxidative cleavage of pUC19 DNA in UV-A and visible light. The DNA photocleavage reaction of 3 at 365 nm shows formation of singlet oxygen and hydroxyl radical species, while only hydroxyl radical formation is evidenced in visible light. Complexes 2 and 3 show non-specific photo-induced bovine serum albumin protein cleavage activity at 365 nm. The an-tpy and py-tpy complexes exhibit significant photocytotoxicity in HeLa cervical cancer cells on exposure to visible light giving IC?? values of 24.2 and 7.6 μM, respectively. Live cell imaging study shows accumulation of the complexes in the cytosol of HeLa cancer cells.     

Synthesis and characterization of tris(heteroleptic) Ru(II) complexes bearing styryl subunits

We have developed and optimized a well-controlled and refined methodology for the synthesis of substituted π-conjugated 4,4'-styryl-2,2'-bipyridine ligands and also adapted the tris(heteroleptic) synthetic approach developed by Mann and co-workers to produce two new representative Ru(II)-based complexes bearing the metal oxide surface-anchoring precursor 4,4'-bis[E-(p-methylcarboxy-styryl)]-2,2'-bipyridine. The two targeted Ru(II) complexes, (4,4'-dimethyl-2,2'-bipyridine)(4,4'-di-tert-butyl-2,2'-bipyridine)(4,4'-bis[E-(p-methylcarboxy-styryl)]-2,2'-bipyridine) ruthenium(II) hexafluorophosphate, [Ru(dmbpy)(dtbbpy)(p-COOMe-styryl-bpy)](PF(6))(2) (1) and (4,4'-dimethyl-2,2'-bipyridine)(4,4'-dinonyl-2,2'-bipyridine)(4,4'-bis[E-(p-methylcarboxy-styryl)]-2,2'-bipyridine) ruthenium(II) hexafluorophosphate, [Ru(dmbpy)(dnbpy)(p-COOMe-styryl-bpy)](PF(6))(2) (2) were obtained as analytically pure compounds in high overall yields (>50% after 5 steps) and were isolated without significant purification effort. In these tris(heteroleptic) molecules, NMR-based structural characterization became nontrivial as the coordinated ligand sets each sense profoundly distinct magnetic environments greatly complicating traditional 1D spectra. However, rational two-dimensional approaches based on both homo- and heteronuclear couplings were readily applied to these structures producing quite definitive analytical characterization and the associated methodology is described in detail. Preliminary photoluminescence and photochemical characterization of 1 and 2 strongly suggests that both molecules are energetically and kinetically suitable to serve as sensitizers in energy-relevant applications.     

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+{bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the Lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+{Me(2)bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association with hairpin oligonucleotides, again with the Lambda enantiomer binding more strongly. A (1)H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.     

Tuning and switching MLCT phosphorescence of [Ru(bpy)3]2+ complexes with triarylboranes and anions

Four new Ru(II) complexes, [Ru(bpy)(2)(4,4'-BP2bpy)][PF(6)](2) (1), [Ru(t-Bu-bpy)(2)(4,4'-BP2bpy)][PF(6)](2) (2), [Ru(bpy)(2)(5,5'-BP2bpy)][PF(6)](2) (3), and [Ru(t-Bu-bpy)(2)(5,5'-BP2bpy)][PF(6)](2) (4) have been synthesized (where 4,4'-BP2bpy = 4,4'-bis(BMes(2)phenyl)-2,2'-bpy; 5,5'-BP2bpy = 5,5'-bis(BMes(2)phenyl)-2,2'-bpy (4,4'-BP2bpy); and t-Bu-bpy = 4,4'-bis(t-butyl)-2,2'-bipyridine). These new complexes have been fully characterized. The crystal structures of 3 and 4 were determined by single-crystal X-ray diffraction analyses. All four complexes display distinct metal-to-ligand charge transfer (MLCT) phosphorescence that has a similar quantum efficiency as that of [Ru(bpy)(3)][PF(6)](2) under air, but is at a much lower energy. The MLCT phosphorescence of these complexes has been found to be highly sensitive toward anions such as fluoride and cyanide, which switch the MLCT band to higher energy when added. The triarylboron groups in these compounds not only introduce this color switching mechanism, but also play a key role in the phosphorescence color of the complexes.     

Structure and DNA cleavage properties of two copper(II) complexes of the pyridine-pyrazole-containing ligands mbpzbpy and Hmpzbpya

The DNA-cleavage properties of the two copper(II) complexes, [Cu(mbpzbpy)Br(2)](H(2)O)(2.5) (1) and [Cu(mpzbpya)Cl](CH(3)OH) (2), obtained from the ligands 6,6'-bis(3,5-dimethyl-N-pyrazolmethyl)-2,2'-bipyridine) (mbpzbpy) and 6'-(3,5-dimethyl-N-pyrazolmethyl)-2,2'-bipyridine-6-carboxylic acid) (Hmpzbpya), respectively, are reported. Upon coordination to Cu(II) chloride in methanol, one arm of the ligand mbpzbpy is hydrolyzed to form mpzbpya. Under the same experimental conditions, the reaction of mbpzbpy with CuBr(2) does not lead to ligand hydrolysis. The ligand mpzbpya is coordinated to a copper(ii) ion generating a CuN(3)OCl chromophore, resulting in a distorted square-pyramidal environment, whereas with the N(4) mbpzbpy ligand, the Cu(II) ion is four-coordinated in a distorted square planar geometry. Both complexes promote the oxidative DNA cleavage of phiX174 phage DNA in the absence of reductant. The oxidative nature of the DNA cleavage reaction has been confirmed by religation and cell-transformation experiments. Studies using standard radical scavengers suggest the involvement of hydroxyl radicals in the oxidative cleavage of DNA. Although both compounds do convert form I (supercoiled) DNA to form II (nicked, relaxed form), only complex 1 is able to produce small amounts of form III (linearized DNA). This observation may be explained either by the attack of the copper(ii) complexes to only one single strand of DNA, or by a single cleavage event. Statistical analysis of relative DNA quantities present after the treatment with both copper(ii) complexes supports a random mode of DNA cleavage.     

Rational enantioselective design of chiral heterobimetallic single-chain magnets: synthesis, crystal structures and magnetic properties of oxamato-bridged M(II)Cu(II) chains (M=Mn, Co)

A new series of neutral oxamato-bridged M(II)Cu(II) chiral chains of general formula [MCuL(x)(S)(m)(H(2)O)(n)]·aS·bH(2)O [L(1)=(M)-1,1'-binaphthalene-2,2'-bis(oxamate) with M=Mn (1a) and Co (1b); L(2)=(P)-1,1'-binaphthalene-2,2'-bis(oxamate) with M=Mn (2a) and Co (2b)] and the analogous racemic chains of formula [MCuL(3)(S)(m)(H(2)O)(n)]·aS·bH(2)O [L(3)=1,1'-binaphthalene-2,2'-bis(oxamate) with M=Mn (3a) and Co (3b)] have been prepared by reaction of the corresponding dianionic oxamatocopper(II) complex [Cu(L(x))](2-) with Mn(2+) or Co(2+) cations in either dimethylformamide (DMF) or dimethyl sulfoxide (DMSO). Solid circular dichroism (CD) spectra of the bimetallic chain compounds were recorded to establish their chiral and enantiomeric nature. They exhibit maximum positive and negative Cotton effects, each pair of enantiomeric chains being non-superimposable mirror images. The crystal structures of the Mn(II)Cu(II) (1a-3a) and the Co(II)Cu(II) (1b and 2b) chain compounds were solved by single-crystal X-ray diffraction methods. Our attempts to obtain X-ray quality crystals of 3b were unsuccessful. The values of the shortest interchain Mn···Mn and Co···Co distances are indicative of a good isolation of neighbouring chains in the crystal lattice, which is caused by the bulky aromatic ligand. Although all the Mn(II)Cu(II) and Co(II)Cu(II) chains exhibit ferrimagnetic behaviour (-J(MnCu)=18.9-26.6 cm(-1) and -J(CoCu)=19.5-32.5 cm(-1)), only the enantiopure Co(II)Cu(II) chains (1b and 2b) show slow magnetic relaxation at low temperatures (T(B)=0.6-1.8 K), which is a characteristic of single-chain magnets (SCMs) and is related to the magnetic anisotropy of the high-spin Co(II) ion. Analysis of the SCM behaviour of 1b and 2b, based on Glauber's theory for an Ising one-dimensional system, shows a thermally activated mechanism for the magnetic relaxation (Arrhenius law dependence). The energy barriers (E(a)) to reverse the magnetisation direction are 8.2 (1b) and 8.1cm(-1) (2b), whereas the pre-exponential factor (τ(0)) is 1.9×10(-8) (1b) and 6.0×10(-9) s (2b). Interestingly, the racemic Co(II)Cu(II) chain analogue, 3b, showed no evidence of SCM behaviour.     

Spectroelectrochemical studies of hole percolation on functionalised nanocrystalline TiO2 films: a comparison of two different ruthenium complexes

We report the application of spectroelectrochemical techniques to compare the hole percolation dynamics of molecular networks of two ruthenium bipyridyl complexes adsorbed onto mesoporous, nanocrystalline TiO(2) films. The percolation dynamics of the ruthenium complex cis-di(thiocyanato)(2,2'-bipyridyl-4,4'-dicarboxylic acid)-(2,2'-bipyridyl-4,4'-tridecyl) ruthenium(II), N621, is compared with those observed for an analogous dye with an additional tri-phenyl amine (TPA) donor moiety, cis-di(thiocyanato)(2,2'-bipyridyl-4,4'-dicarboxylic acid)-(2,2'-bipyridyl-4,4'-bis(vinyltriphenylamine)) ruthenium(II), HW456. The in situ oxidation of these ruthenium complexes adsorbed to the TiO(2) films is monitored by cyclic voltammetry and voltabsorptometry, whilst the dynamics of hole (cation) percolation between adsorbed ruthenium complexes is monitored by potentiometric spectroelectrochemistry and chronoabsorptometry. The hole diffusion coefficient, D(eff), is shown to be dependent on the dye loading on the nanocrystalline TiO(2) film, with a threshold observed at ～60% monolayer surface coverage for both dyes. The hole diffusion coefficient of HW456 is estimated to be 2.6 × 10(-8) cm(2)/s, 20-fold higher than that obtained for the control N621, attributed to stronger electronic coupling between the TPA moieties of HW456 accelerating the hole percolation dynamics. The presence of mercuric ions, previously shown to bind to the thiocyanates of analogous ruthenium complexes, resulted in a quenching of the hole percolation for N621/TiO(2) films and an enhancement for HW456/TiO(2) films. These results strongly suggest that the hole percolation pathway is along the overlapped neighbouring -NCS groups for the N621 molecules, whereas in HW456 molecules cation percolation proceeds between intermolecular TPA ligands. These results are discussed in the context of their relevance to the process of dye regeneration in dye sensitised solar cells, and to the molecular wiring of wide bandgap inorganic materials for battery and sensing applications.     

Electrochemical and luminescent properties of new mononuclear ruthenium(II) and binuclear iridium(III)-ruthenium(II) terpyridine complexes.

Hexafluorophosphate salts of mononuclear complexes [Ru(II)Cl(L)(terpy)]+ (L = dmbpy (1); dpbpy (2), sambpy (3), and dpp (7), and binuclear complexes [Ru(II)2Cl2(dpp)(terpy)2]2+ (8) and [Ir(III)Ru(II)Cl2(dpp)(terpy)2]3+ (9) were prepared and characterized. Abbreviations of the ligands are bpy = 2,2'-bipyridine, dmbpy = 4,4'-dimethyl-2,2'-bipyridine, dpbpy = 4,4'-diphenyl-2,2'-bipyridine, dpp = 2,3-bis(2-pyridyl)pyrazine, sambpy = 4,4'-bis((S)-(+)-alpha-1-phenylethylamido)-2,2'-bipyridine, and terpy = 2,2':6',2'-terpyridine. The absorption spectra of 8 and 9 are dominated by ligand-centered bands in the UV region and by metal-to-ligand charge-transfer bands in the visible region. The details of their spectroscopic and electrochemical properties were investigated. In both binuclear complexes, it has been found that the HOMO is based on the Ru metal, and LUMO is dpp-based. [Ir(III)Ru(II)Cl2(dpp)(terpy)2]3+, indicating intense emission at room temperature, and a lifetime of 154 ns. The long lifetime of this bimetallic chromophore makes it a useful component in the design of supramolecular complexes.     

Synthesis and Crystal Structure of a Co（II） Coordination Polymer Derived from a Flexible Bipyridyl Derivative Ligand

1 INTRODUCTION The infinite networks constructed from transition metal complexes have attracted considerable current interest in recent years. The motivation behind this activity has been stimulated by their potential appli- cations in selective inclusion of ions, molecular re- cognition, host-guest chemistry, ion exchange, cata- lysis, electrical conductivity, magnetism, optics and so on[1～4]. It is well known that the diversity in structures and topologies of supramolecules is attri- b…     

p-tert-Butylcalix[4]arene Derivatives Containing Azathiol Receptors and Their Recognition towards Hg(II)

25,27(2,2'-bis(ethoxybenzyl))-1,9-diimine-3,7-dithianonane-p-tert-butylcalix[4]arene (3),25,27(4,4'-bis(ethoxybenzyl))-1,9-diimine-3,7-dithianonane-p-tert-butylcalix[4]arene (4),25,27(2,2'-bis(ethoxybenzyl))-1,8-diimine-3,6-dithianonane-p-tert-butylcalix[4]arene (5) and25,27(4,4'-bis(ethoxybenzyl))-1,8-diimine-3,6-dithianonane-p-tert-butylcalix[4]arene (6) havebeen synthesized by condensation reactions between25,27(2,2'-bis(ethoxybenzaldehyde))-p-tert-butylcalix[4]arene (1) and25,27(4,4'-bis(ethoxybenzaldehyde))-p-tert-butylcalix[4]arene (2) and appropriateamines. Reduction of 3 and 4 withNaBH₄ and subsequent protonation byHCl/CH₃OH resulted in25,27(2,2'-bis(ethoxybenzyl))-1,9-diaza-3,7-dithianonane-p-tert-butylcalix[4]arenedihydrogenchloride (7) and25,27(4,4'-bis(ethoxybenzyl))-1,9-diaza-3,7-dithianonane-p-tert-butylcalix[4]arenedihydrogenchloride (8), respectively. Complexation studies of 7 and 8 withZn(II), Cd(II) and Hg(II) ions were carried out bypotentiometric titration. Compounds 7 and8 selectively form 1 : 1 complexes with Hg(II), andtheir stability constants (log Ks) were estimated tobe 4.47 ± 0.08 and 3.20 ± 0.13, respectively. From spiecies distribution plots, 7 and 8were found to form the highest amount of 1 : 1 complexes with Hg(II) at pH 8.7 and 9.1, respectively.     

Mixed ligand cobalt(II) picolinate complexes: synthesis, characterization, DNA binding and photocleavage

Complexes of the type [Co(pic)(2)(NN)], where pic = picolinate, NN = dipyrido[3,2-d:2',3'-f]quinoxaline (dpq) (4) and 4b,5,7,7a-tetrahydro-4b,7a-epiminomethanoimino-6H-imidazo[4,5-f][1,10]-phenanthroline-6,13-dione (bipyridyl-glycoluril) (bpg) (6) have been synthesized and characterized by elemental analysis, IR, UV-vis, NMR and ESI-MS spectroscopy and thermogravimetic analysis (TGA). Their physicochemical properties are compared with previously synthesized complexes, where NN = (H(2)O)(2) (1), 2,2'-bipyridine (bpy) (2), 1,10-phenanthroline (phen) (3) and dipyrido[3,2-a:2',3'-c]phenazine (dppz) (5). The crystal structures of the complexes 4-6 were solved by single-crystal X-ray diffraction. The complexes 4 and 5 crystallize from a mixture of chloroform and methanol in monoclinic and orthorhombic crystal systems, respectively, whereas complex 6 crystallizes from dimethyl sulfoxide (DMSO) in a tetragonal crystal system. The coordination sphere consists of two oxygen atoms and two nitrogen atoms from the two picolinates and two nitrogen atoms from the dpq, dppz or bpg ligand, respectively. Co(ii)/Co(iii) oxidation potentials have been determined by cyclic voltammetry. The DNA binding of complexes 1-5 has been investigated using thermal melting, fluorescence quenching and viscosity measurements, which indicate the partial intercalation of complex 5 with an apparent binding constant (k(app)) of 8.3 × 10(5) M(-1). DNA cleavage studies of complexes 1-5 have been investigated using gel electrophoresis in the presence of H(2)O(2) as an oxidizing agent and also by photoirradiation at 365 nm. The mechanistic investigations suggest that singlet oxygen ((1)O(2)) is the major species involved in the DNA cleavage by these complexes. The structures of complexes 2-6 were optimized with density functional theory (DFT) method (B3LYP/6-31G(d,p)). The low vertical ionization potential values indicate photoredox pathways for the DNA cleavage activity by complexes 4 and 5, which is corroborated by DNA cleavage experiments.     

New Class of Chiral Diphosphine Ligands for Highly Efficient Transition Metal-Catalyzed Stereoselective Reactions: The Bis(diphenylphosphino) Five-membered Biheteroaryls

The synthesis and application of three examples of a new class of chiral (C(2)) atropisomeric diphosphines characterized by two interconnected five-membered heteroaromatic rings, with hindered rotation around the interanular bond, are described. Optically pure (+)- and (-)-2,2'-bis(diphenylphosphino)-4,4',6,6'-tetramethyl-3,3'-bibenzo[b]thiophene (tetraMe-bitianp) (1a) and the parent unsubstituted system (+)- and (-)-bitianp (1b) were synthesized. They were found to be optically stable at 100 degrees C and were successfully employed as ligands in the Ru(II)-catalyzed hydrogenation of alpha- and beta-oxo esters to the corresponding alpha- and beta-hydroxy esters and in the hydrogenation of olefinic substrates. The optical and chemical yields were comparable with those reported for the same Ru(II)-binap-catalyzed reactions carried out under the same experimental conditions. The 2,2'-bis(diphenylphosphino)-3,3'-bibenzo[b]furan (1c), the oxygenated analogue of bitianp, was found to be configurationally unstable at room temperature. Complete structural X-ray elucidation of the Pd complexes of 1a-c is reported. The advantages of these biheteroaromatic ligands over the classical biaryl systems are discussed.     

Synthesis,characterization, photocleavage,antimicrobial activity and DNA binding of [Co(bpy)2MHPIP]3+, [Co(dmb)2MHPIP]3+, and [Co(phen)2MHPIP]3+ complexes

4-Methyl-2-(2-hydroxyphenyl)imidazo[4,5-f][1,10]phenanthroline) (MHPIP) and its complexes [Co(bpy)₂MHPIP]³⁺ (1) (bpy = 2,2′-bipyridine), [Co(dmb)₂MHPIP]³⁺ (2) (dmb = 4,4′-dimethyl-2,2′-bipyridine), and [Co(phen)₂MHPIP]³⁺ (3) (phen = 1,10-phenanthroline) have been synthesized and characterized by UV/VIS, IR, EA, ¹H, ¹³C-NMR, and mass spectra. The binding of the three complexes with calf-thymus-DNA (CT-DNA) has been investigated by absorption and emission spectroscopy, DNA-melting techniques, viscosity measurements, and DNA cleavage assay. The spectroscopic data and viscosity results indicate that these complexes bind to CT-DNA via an intercalative mode. The complexes also promote photocleavage of plasmid pBR322 DNA and were screened for antimicrobial activity.     

Synthesis of panchromatic Ru(II) thienyl-dipyrrin complexes and evaluation of their light-harvesting capacity

Ru(II) complexes with 5-(3-thienyl)-4,6-dipyrrin (3-TDP), containing 2,2'-bipyridine (bpy) or 4,4'-bis(methoxycarbonyl)-2,2'-bipyridine (dcmb) as coligands, have been prepared and extensively characterized. Crystal structure determination of [Ru(bpy)(2)(3-TDP)]PF(6) (1a) and [Ru(bpy)(3-TDP)(2)] (2) reveals that the 3-thienyl substituent is rotated with respect to the plane of the dipyrrinato moiety. These complexes, as well as [Ru(dcmb)(2)(3-TDP)]PF(6) (1b), act as panchromatic light absorbers in the visible range, with two strong absorption bands observable in each case. A comparison to known Ru(II) complexes and quantum-chemical calculations at the density functional theory (DFT) level indicate that the lower-energy band is due to metal-to-ligand charge transfer (MLCT) excitation, although the frontier occupied metal-based molecular orbitals (MOs) contain significant contributions from the 3-TDP moiety. The higher energy band is assigned to the π-π* transition of the 3-TDP ligand. Each complex exhibits an easily accessible one-electron oxidation. According to DFT calculations and spectroelectrochemical experiments, the first oxidation takes place at the Ru(II) center in 1a, but is shifted to the 3-TDP ligand in 1b. An analysis of MO energy diagrams suggests that complex 1b has potential to be used for light harvesting in the dye-sensitized (Gr?tzel) solar cell.     

Electron-rich heteroaromatic conjugated bipyridine based ruthenium sensitizer for efficient dye-sensitized solar cells

A novel heteroleptic ruthenium complex carrying a heteroaromatic-4,4'-pi-conjugated 2,2'-bipyridine [Ru(II)LL'(NCS)(2)] (L = 4,4'-bis[(E)-2-(3,4-ethylenedioxythien-2-yl)vinyl]-2,2'-bipyridine, L' = 4,4'-(dicarboxylic acid)-2,2'-bipyridine) was synthesized and used in dye-sensitized solar cells, yielding photovoltaic efficiencies of 9.1% under standard global AM 1.5 sunlight.     

Enhanced rate of arene hydrogenation with imidazolium functionalized bipyridine stabilized rhodium nanoparticle catalysts

The imidazolium functionalized bipyridine compounds, {4,4'-bis[7-(2,3-dimethylimidazolium)heptyl]-2,2'-bipyridine}(2+) ([BIHB](2+)) and {4,4'-bis[(1,2-dimethylimidazolium)methyl]-2,2'-bipyridine}(2+) ([BIMB](2+)), were prepared and used as Rh nanoparticle stabilizers. The dispersed Rh nanoparticles were used as catalysts in the biphasic hydrogenation of various arene substrates. The catalytic activity was strongly influenced by the stabilizer employed and followed the trend [BIHB](2+) > bipy > [BIMB](2+). The steric and electronic characteristics of the imidazolium functionalized bipyridine ligands were assessed via the synthesis of rhenium carbonyl complexes, which facilitated the rationalization of the catalytic properties of the nanoparticles.     

Syntheses, characterization, and photo-hydrogen-evolving properties of tris(2,2'-bipyridine)ruthenium(II) derivatives tethered to a cis-Pt(II)Cl2 unit: insights into the structure-activity relationship

The photo-hydrogen-evolving activity (activity to enhance the photochemical EDTA-reduction of water into molecular hydrogen) was evaluated for three different Ru(II)Pt(II) dimers with a general formula of [(bpy)2Ru(micro-bridge)PtCl2]2+(bpy = 2,2'-bipyridine; bridge = 4,4'-bis(N-(3-aminopropyl)carbamoyl)-2,2'-bipyridine (L1), 2,3-bis(2-pyridyl)pyrazine (L2), and 4,4'-bis(N-(4-pyridyl)methylcarbamoyl)-2,2'-bipyridine (L3); EDTA = ethylenediaminetetraacetic acid disodium salt). A new Ru(II)Pt(II) complex, [(bpy)2Ru(micro-L3)PtCl2]2+, was synthesized and characterized. It was confirmed that all three compounds are ineffective towards photochemical H2 production. In each case, an acetate-buffer solution (pH = 5) containing the Ru(II)Pt(II) dimer and EDTA was photolysed using a 350-W Xe lamp under an Ar atmosphere, during which the amount of H2 evolved was analysed by gas chromatography. Additional photolysis experiments were carried out by adding [Ru(bpy)3]2+ and methylviologen (N,N'-dimethyl-4,4'-bipyridinium) to the photolysis solutions described above to test the H2-evolving activity of the Pt(II) unit involved in these Ru(II)Pt(II) dimers. As a result, the Pt(II) units involved in the L1 and L2 compounds were found to be active as an H2-evolving catalyst, while that of the L3 compound was found to show no activity at all. The extent of intramolecular electron-transfer quenching from the 3MLCT excited state of the [Ru(bpy)3]2+ derivative to the tethering Pt(II) catalyst centre was investigated by comparison of the luminescence spectra of these compounds, together with the related compounds. The results showed that the quenching of the 3MLCT luminescence is not at all enhanced in either the L1 or the L3 compounds. On the other hand, the L2 compound is strongly quenched as previously reported. In addition to the above studies, the H2-evolving activity of some Pt(II) monomers, cis-PtCl2(NH3)2, PtCl2(en)(en = ethylenediamine), cis-PtCl2(4-methylpyridine)2, PtCl2(2,2'-bipyrimidine), PtCl2(4,4'-dicarboxy-2,2'-bipyridine), and [PtCl(terpy)]+(terpy = 2,2':6',2'-terpyridine), were similarly investigated in the presence of EDTA, [Ru(bpy)3]2+ and methylviologen, since they were regarded as structural analogues of the Pt(II) units involved in the L1-L3 compounds. The compounds having a cis-Pt(II)Cl2 unit were generally found to show high H2-evolving activity. This was interpreted in terms of the ligation of negatively charged chloride anions leading to the destabilization of the Pt(II) dz2 orbital responsible for the hydrogenic activation. Importantly, cis-PtCl2(4-methylpyridine)2 exhibited relatively high activity as an H2-evolving catalyst, suggesting the importance of the flexible rotation of the pyridyl ligands for efficient hydrogenic activation at the axial site of the Pt(II) ion. The DFT calculations also showed the validity of the structure-activity relationship discussed above for the L3 compound.     

Synthesis,DNA binding,and antimicrobial studies of novel metal complexes containing a pyrazolone derivative Schiff base

A novel series of Co(II), Ni(II), Cu(II), Zn(II), and VO(IV) complexes has been synthesized from the Schiff base derived from 4-[(3,4-dimethoxybenzylidene)amino]-1,5-dimethyl-2-phenyl-1,2-dihydropyrazol-3-one and 1,2-diaminobenzene. Structural features were determined by analytical and spectral techniques. Binding of synthesized complexes with calf thymus DNA (CT DNA) was studied by spectroscopic methods and viscosity measurements. Experimental results indicate that the complexes are able to form adducts with DNA and to distort the double helix by changing the base stacking. Lower DNA affinity of the VO(IV) complex is caused by the change of coordination geometry by the vanadyl ion resulting in a somewhat unfavorable configuration for the DNA binding. Oxidative DNA cleavage activities of the complexes were studied with supercoiled (SC) pUC19 DNA using gel electrophoresis; the mechanism studies revealed that the hydroxyl radical is likely to be the reactive species responsible for the cleavage of pUC19 DNA by the synthesized complexes. The in vitro antimicrobial screening effects of the investigated compounds were monitored by the disc diffusion method. The synthesized Schiff base complexes exhibit higher antimicrobial activity than the respective free Schiff base.