Trapping of dichlorosilane (H2SiCl2) gas by transition metals doped fullerene nanostructured materials

Dichlorosilane is a flammable and poisonous gas which is very toxic when inhaled. When handling this gas, extreme precautions must be taken to prevent exposure and so therefore there is need to develop a more sensitive and affordable sensor to detect and measure the concentration of gas in the environment in case of unintentional release of the gas into the air. Overtime, structured materials have been used in the adsorption of target gas. Herein, the detection of dichlorosilane (H₂SiCl₂) gas by transition metals (X = Cr, Fe, Ni, Ti, and Zn) anchored fullerene is studied using the density functional theory (DFT) computation at theωB97X-D/gen/6-311++G(d,p)/LanL2DZ level of theory. From the electronic properties, large energy gap signifies lower electrical conductivity and sensitivity. The result showed an increase in the energy gap on adsorption of the gas on nanocages except for N1 and T1 where the energy gap was lesser than that of the nanocages. Calculations shows among the five studied surfaces, C₂₃–Ti surface emerged with the highest adsorption energy value of ?2.231 eV and corresponding energy gap value of 5.200 eV. Also, the decreasing trend of adsorption energies: H₂Cl₂SiC₂₃Ti (T1), (?2.231) > H₂SiCl₂C₂₃Ni (N1), (?2.095) > H₂SiCl₂C₂₃Zn (Z1) (?2.068) > H₂SiCl₂C₂₃Cr (C1) (?1.796) > H₂SiCl₂C₂₃Fe (F1) (?1.742) was observed. High negative value of adsorption energy, the lesser the recovery time. H₂Cl₂SiC₂₃Ti (T1) complex with high negative value of adsorption energy has a lesser recovery time exhibits better sensing attributes. The C₂₃–Ti surface is relatively a better candidate in the adsorption and, hence, confirmed as suitable nanosensor material for the detection and adsorption of toxic dichlorosilane (H₂SiCl₂) gas molecule.     

Progress in natural polymer engineered biomaterials for transdermal drug delivery systems

The route of a specific drug carrier system is always a significant platform of development that combines the principles of biomedical technology, nanotechnology, and pharmaceutical drug design. Transdermal (TD) drug delivery involves the release of the drug via the stratum corneum of the tissue membrane into the sustained release by diffusion across the epidermal layer. This method (often known as topical drug delivery) has increased noteworthy research enthusiasm in the course of recent decades due to its relatively simpler and non-invasive administration. Over the past few decades, considerable advancement was achieved in TD delivery and a number of drugs are now successfully reported. In this review, we focus on the progress regarding applications of important biopolymers described for the TD drug release applications and related aspects. Three mostly reported plant and animal-derived polymers (such as natural rubber, chitosan, and cellulose for the development of TD carrier system) were extensively analyzed. The general principle of TD drug delivery, advantages, and limitations of the works reported were also discussed.     

Supramolecular nano drug delivery systems mediated via host-guest chemistry of cucurbit[n]uril (n = 6 and 7)

As a novel family of macrocyclic molecules,cucurbit[n]urils(CB[n]s) have emerged as promising building blocks of supramolecular nano drug delivery systems(SNDDS) in recent years.Direct encapsulation of amphiphilic guests by CB[6] and CB[7] can modulate their amphiphilicity,resulting in formation of supramolecular amphiphiles that self-assemble into supramolecular nanoparticles for drug delivery.Additionally,CB[n]'s host-guest chemistry on the surface of mesoporous nanoparticles makes CB[n] an ideal blocking agent to control drug release from delivery vehicles.These SNDDS possess intrinsic stimuli responsiveness towards external guest or host,which can further incorporate re s ponsiveness to a variety of other stimuli including pH,thermal,redox,photo and enzyme,to realize multiple stimuli-responsive drug release.Moreover,the recent breakthrough in direct functionalization of CB[n]s has provided a feasible method for preparing superior CB[6] and CB[7] derivatives that can be employed to build multifunctional SNDDS with unoccupied macrocycles located on surface,which could be decorated with various functional "tags" through host-guest chemistry.In this review,we summarized the recent progress of CB[6] and CB[7] based SNDDS through formation of supramolecular amphiphiles,supramolecular nanovalves as well as supramolecularly tailorable surface,which we hope to further promote the development of CB[n]s family as building blocks for advanced SNDDS.     

Assessing a double silicon decorated fullerene for the delivery of interacting flurbiprofen and salicylic acid drugs: A DFT approach

Since the number of drugs increases constantly, drug interactions appear as a critical issue to handle. The effective use of multiple drugs appears as another important subject to discuss and the use of targeted and selective delivery of drugs is becoming more important. Impurity doped C₆₀ fullerenes with various dopant atoms such as silicon or boron appear as promising drug delivery vehicles. Therefore, in the framework of this study, we investigated the interaction between salicylic acid and flurbiprofen and their controlled delivery by using double silicon decorated C₆₀ fullerene using density functional theory. Stability and reactivity considerations were also examined by investigating some important structural parameters, interaction energies and frontier molecular orbitals. The interactions were also monitored by examining important diagnostic vibrational bands. The strength of the interactions between atoms at the interaction sites was also identified by using the quantum theory of atoms in molecules.     

Periodic mesoporous organosilicas with co-existence of diurea and sulfanilamide as an effective drug delivery carrier

In this article we report the synthesis of new periodic mesoporous organosilicas (PMOs) with the co-existence of diurea and sulfanilamide-bridged organosilica that are potentially useful for controlled drug release system. The materials possess hexagonal pores with a high degree of uniformity and show long-range order as confirmed by the measurements of small-angle X-ray scattering (SAXS), N₂ adsorption isotherms, and transmission electron microscopy(TEM). FT-IR and solid state ²⁹Si MAS and ¹³C CP MAS NMR spectroscopic analyses proved that the bridging groups in the framework are not cleaved and covalently attached in the walls of the PMOs. It was found that the organic functionality could be introduced in a maximum of 10 mol% with respect to the total silicon content and be thermally stable up to 230 °C. The synthesized materials were shown to be particularly suitable for adsorption and desorption of hydrophilic/hydrophobic drugs from a phosphate buffer solution at pH 7.4.     

Microcalorimetry in the screening of discovery compounds and in the investigation of novel drug delivery systems

Calorimetry has for some time been proposed as a rapid method for determination of bioactivity. This paper describes the background to this application and describes how it has been extended to the study of bioassay techniques via microcalorimetry in the development of structure activity relationships (SARs). That SARs can be developed indicates that it is possible to guide drug synthetic strategy through the results of microcalorimetric investigations, and this approach is explored here. In an extension of this approach it is argued that microcalorimetry is well suited to the examination of novel drug delivery systems, allowing investigation of the capacity of drug delivery molecules to release the drug in the presence of a target organism.     

A new crown ether as vesicular carrier for 5-fluoruracil: synthesis, characterization and drug delivery evaluation

Niosomes have shown promise as cheap and chemically stable drug delivery systems. In this paper a novel crown ether amphiphile, 1,16-hexadecanoyl-bis-(2-aminomethyl)-18-crown-6 (Bola A-16), has been synthesized with the aim of developing a long time stable controlled release system. Niosomes have been prepared with different molar ratios of amphiphile and cholesterol and their morphological properties have been determined by quasi-elastic light scattering and transmission electron microscopy. The composition of niosomes affects the entrapment efficiency and the release rate of 5-fluorouracil, a well-known antineoplastic molecule. In addition, other two known azacrown ether amphiphiles (4,7,10,13-pentaoxa-16-aza-cyclooctadecane)-hexadecanedioc acid diamide (Bola D-16) and ,ω-(4,7,10,13-pentaoxa-16-aza-cyclooctadecane)-hexadecane (Bola C-16), have been synthesized and the obtained vesicles have been characterized for comparison. Furthermore, the release profile of 5-fluorouracil in vitro, from these niosomes, has been studied over a period of 6 h in order to simulate a hematic adsorption.     

普鲁兰多糖在药物释放系统中的应用

本综述重点介绍了近年来普鲁兰多糖作为药物释放系统载体材料的研究进展及其在药物释放系统中的应用情况。     

A versatile liposome/cyclodextrin supramolecular carrier for drug delivery through the blood-brain barrier

For many commercial drugs, reaching the central nervous system in large amount without damaging the blood-brain-barrier (BBB) remains a challenging task. We present here a supramolecular strategy aiming at using a well-defined cyclodextrin-coated liposomes as drug carrier and adamantoyl saccharides as BBB-interacting ligands. In this study, the liposome is constituted of n-alkyldimethylammoniumcyclodextrins incorporated in the lipid bilayer of a 3/7 cholesterol/dipalmitoylphosphatidylcholine mixture and the ligand is constituted of an adamantoylglucose molecule whose adamantoyl moiety can be included in the CD cavity. The whole supramolecular assembly has been characterized by light-scattering and ³¹P NMR measurements. Toxicity and permeability studies on an in vitro model of the BBB clearly demonstrated a 5-fold improved ability of the modified liposome to enter the BBB-endothelial cells compared to the non-coated liposome. Fluorescence labelling of these liposomes is also displayed with DiI as a fluorescent probe.     

Molecular dynamics simulation study of gold nanosheet as drug delivery vehicles for anti-HIV-1 aptamers

The adsorption process of three aptamers with gold nanosheet (GNS) as a drug carrier has been investigated with the help of molecular dynamics simulations. The sequencing of the considered aptamers are as (CUUCAUUGUAACUUCUCAUAAUUUCCCGAGGCUUUUACUUUCGGGGUCCU) and (CCGGGUCGUCCCCUACGGGGACUAAAGACUGUGUCCAACCGCCCUCGCCU) for AP1 and AP2, respectively. AP3 is a muted version of AP1 in which nucleotide positions 4, 6, 18, 28 and 39 have C4A, U6G, A18G, G28A, and U39C mutations. At positions 24, and 40, a deletion mutation is seen to eliminate U24 and U40 bases. These aptamers are inhibitors for HIV-1 protease and can be candidates as potential pharmaceutics for treatment of AIDS in the future. The interactions between considered aptamers and GNS have been analyzed in detail with help of structural and energetic properties. These analyses showed that all three aptamers could well adsorb on GNS. Overall, the final results show that the adsorption of AP2 on the GNS is more favorable than other considered ones and consequently GNS can be considered as a device in order to immobilize these aptamers.     

Biodegradable and self-fluorescent ditelluride-bridged mesoporous organosilica/polyethylene glycol-curcumin nanocomposite for dual-responsive drug delivery and enhanced therapy efficiency

Mesoporous organosilica as drug delivery carriers capable of achieving improved cargo release, enhanced biodegradation, and direct imaging with prolonged circulation time and tracking cargo distribution is highly in demand for biomedical applications. Herein, we report a ditelluride-bridged mesoporous organosilica nanoparticle (DTeMSN)/polyethylene glycol-curcumin (PEG-CCM) nanocomposite through coassembly with oxidative/redox and self-fluorescent response. Tellurium is introduced into the silica framework for the first time as a drug delivery vehicle. In this case, the DTeMSNs as an inner core enable disassembly under oxidative and redox conditions via the cleavage of ditelluride bond, facilitating the drug release of doxorubicin (DOX) in a matrix degradation controlled manner. Through the systematical comparison of diselenide-bridged MSNs and DTeMSNs, DTeMSNs exhibit remarkable advantages in loading capacity, drug release, and degradation behavior, thereby significantly affecting the cytotoxicity and antitumor efficacy. The self-fluorescent response of PEG-CCM shell coated on the surface of DTeMSNs can real-timely track the cellular uptake, DOX release, and biodistribution owing to the intrinsic and stable fluorescence of CCM. Moreover, PEG-CCM could prolong circulation time, provide preferable drug accumulation in tumors, and increase antitumor efficacy of DOX-loaded DTeMSNs. Our findings are likely to enrich the family of organosilica that served as fluorescence-guided drug delivery carriers.     

Synthesis of PHB-based carrier for drug delivery systems with pH-controlled release

Synthetic route to prepare model PHB-amine conjugate containing hydrolysable imine bond is reported. Short-chain PHB crotonate is converted into PHB glyoxylate via clean and efficient ozonolysis followed by reductive decomposition of peroxidic products with dimethylsulfide. Aldehyde-functionalized PHB is obtained quantitatively without polymer backbone degradation while PHB-amine conjugate is synthesized with very high yield. Release properties of such-prepared conjugate is confirmed in hydrolysis experiment revealing pH-dependent kinetics of amine release. Simplicity of the protocol in conjunction with unique properties of PHB carrier are believed to be powerful tool for development of novel drug conjugates.     

Controlled drug delivery systems based on calixarenes

Recent advances on calixarene-based drug delivery systems in the form of inclusion complexes, amphiphilic self-assembly nanocarriers including micelles, hydrogels, vesicles and liposomes, and supramolecular nanovalves on mesoporous silicas, were reviewed and discussed.     

Self-aggregated nanoparticles of cholesterol-modified glycol chitosan conjugate: Preparation, characterization, and preliminary assessment as a new drug delivery carrier

Cholesterol-modified glycol chitosan (CHGC) conjugate was synthesized and characterized by FTIR and ¹H NMR. The degree of substitution (DS) was 6.7 cholesterol groups per 100 sugar residues of glycol chitosan. CHGC formed self-aggregated nanoparticles with a roughly spherical shape and a mean diameter of 228 nm by probe sonication in aqueous medium. The physicochemical properties of the self-aggregated nanoparticles were studied using dynamic light scattering (DLS), transmission electron microscopy (TEM) and fluorescence spectroscopy. The critical aggregation concentration (CAC) of self-aggregated nanoparticles in aqueous solution was 0.1223 mg/mL. Indomethacin (IND), as a model drug, was physically entrapped into the CHGC nanoparticles by dialysis method. The characteristics of IND-loaded CHGC (IND-CHGC) nanoparticles was analyzed using DLS, TEM and high performance liquid chromatography (HPLC). The IND-CHGC nanoparticles were almost spherical in shape and their size increased from 275 to 384 nm with the IND-loading content increasing from 7.14% to 16.2%. The in vitro release behavior of IND from CHGC nanoparticles was studied by a dialysis method in phosphate buffered saline (PBS, pH 7.4). IND was released in a biphasic way. The initial rapid release in 2 h and slower release for up to 12 h were observed. The results indicated that CHGC nanoparticles had a potential as a drug delivery carrier.     

Preparation and drug controlled-release of polyion complex micelles as drug delivery systems

Block copolymers, poly(N-vinylprrolidone)-block-poly(styrene-alter-maleic anhydride) (PVP-b-PSMA) and poly(N-vinylprrolidone)-block-poly(N,N-dimethylaminoethyl methacrylate) (PVP-b-PDMAEMA), were synthesized by reversible addition- fragmentation chain transfer (RAFT) polymerization. In aqueous media, this a pair of oppositely-charged diblock copolymers could self-assemble into stable and narrow distribution polyion complex micelles (PICMs). Transmission electron micrographs (TEM) and dynamic light scattering (DLS) analysis showed that the micelles to be spherically shaped with mean hydrodynamic diameter around 70 nm. In addition, the PICMs display ability to response to external stimuli. All of theses features are quite feasible for utilizing it as a novel intelligent drug delivery system. In order to assess its application in biomedical area, release profiles of coenzyme A (Co A) from PICMs were studied under both simulated gastric and intestinal pH conditions. The release was much quicker in pH 7.4 buffer than in pH 2.0 solution. Based on these results, these PICMs could be a potential pH-sensitive carrier for colon-specific drug delivery system.     

Rectal administration of nanosystems: from drug delivery to diagnostics

The rectal administration of drugs has been an enduring medical practice for either the management of local or systemic conditions. Although mostly regarded as an alternative to other delivery routes, the colorectal mucosa offers an effective pathway for enhanced systemic bioavailability of many active molecules. The fairly stable physicochemical and enzymatic environment of the mucosa and the possibility of partially avoiding the hepatic first-pass effect are some of the potential advantages of rectal drug delivery. At the same time, higher drug levels of drugs can be achieved at colorectal fluids and tissues, which can aid management of local conditions. However, problems with patient acceptability as well as poor and erratic drug absorption may impair efficient use of the rectal drug delivery route. The valuable features of nanotechnology-based systems for mucosal use are well recognized, and their potential as carriers for drug delivery has already been proven for different medical applications/delivery routes. Although still limited, the development of rectal nanomedicines with therapeutic, diagnostic, and prophylactic purposes is steadily emerging and may circumvent some of the problems associated with the more standard delivery approaches. This review discusses the rationale behind the use of nanotechnology-based strategies for rectal drug delivery and provides a critical overview on the various types of nanosystems proposed so far.     

Erythrocyte-derived drug delivery systems in cancer therapy

As natural blood components,erythrocytes were good candidates for being used as drug delive ry systems to improve the pharmacokinetics,biocompatibility and many other aspects of different drugs.The advantages brought by erythrocytes making erythrocyte-derived drug delivery systems,also known as erythrocyte carriers,suitable for various anti-cancer agents,especially newly invented agents like nanoparticles,which were characterized by their undesired systematic toxicity,anaphylactic reactions and poor biocompatibility.Current researches on erythrocyte carriers in ca ncer therapy showed inspiring results in four major aspects:cancer enzyme therapy,delivering chemotherapeutic agents,combining with nanoparticles,and several other anti-cancer agents for gene or immune therapy.This novel delivering system was now undergoing the translation process from laboratory to clinical practice.Erythrocyte carriers for cancer enzyme therapy have entered the stage of clinical trial and have showed promising outcomes,and others were still at pre-clinical stage.In summary,erythrocyte-derived drug delivery system might play an indispensable role in the management of cancer in the future.     

Bioinspired self-assembly supramolecular hydrogel for ocular drug delivery

Based on a recent report concerning endogenous agents (i.e., pyridoxal phosphate, adenosine triphosphate, adenosine monophosphate, folinic acid) that modulate the oligomerization of apoptosis-associated speck-like protein (ASC) via the peptide epitope of KKFKLKL, we rationally designed and synthesized a nonapeptide (NapFFKKFKLKL), which can co-assemble with dexamethasone sodium phosphate (Dexp) to generate a NapFFKKFKLKL/Dexp supramolecular hydrogel for ocular drug delivery. The NapFFKKFKLKL/Dexp hydrogel formed instantly after the complexation of NapFFKKFKLKL with Dexp in aqueous solution. The formed supramolecular hydrogels were thoroughly characterized by transmission electron microscopy (TEM), fluorescent spectrum, circular dichroism (CD) spectra and rheology. The peptide concentration significantly affected the in vitro release behavior of Dexp from the supramolecular hydrogel, and the higher peptide concentration resulted in the slower drug release. Following a single intravitreal injection, the proposed NapFFKKFKLKL/Dexp hydrogel displayed good intraocular biocompatibility without having an adverse impact on the retinal architecture and eyesight functions during one month of follow-up. Using an experimental autoimmune uveitis (EAU) rat model, we demonstrated that the resulting NapFFKKFKLKL/Dexp hydrogel had potent capacity to alleviate the intraocular inflammation and retain the morphology of retinal architecture. Overall, the resulting NapFFKKFKLKL/Dexp hydrogel may be a promising drug carrier system to treat various posterior disorders (i.e., uveitis).     

The intragastrointestinal fate of paclitaxel-loaded micelles: Implications on oral drug delivery

The goal of the present study is to elucidate the intragastrointestinal fate of micellar delivery systems by monitoring fluorescently labeled different micelles and the model drug paclitaxel (PTX). Both in vitro and ex vivo leakage studies showed fast PTX release in fluids while micelles remained intact, except in fed-state simulated intestinal fluid and fasted-state pig intestinal fluid, thus referring to the intact absorption of micelles and PTX leakage in the gastrointestinal tract with d-α-tocopherol polyethylene glycol 1000 succinate (TPGS) micelles showing higher stability than other micelles. All groups of micelles were absorbed intact in Caco-2 and Caco-2/HT29-MTX cell models and the absorption of TPGS micelles was found to be higher than other micelles. The transport of the micelles across Caco-2/Raji (1.6%–3.5%), Caco-2 (0.8%–1%), and Caco-2/HT29-MTX (0.58%–1%) cell monolayers further verified the absorption of micelles and their subsequent transport; however, more TPGS micelles transported across cell monolayers than other groups. Moreover, the histological examination also confirmed that micelles entered the enterocytes and were transported to basolateral tissues and TPGS showed the stronger ability of penetration than other groups. Thus, these results are succinctly presenting the absorption of intact micelles in GIT confirmed by imaging evidence with prior leakage of the drug, uptake by enterocytes and the transport of micelles that survive the digestion by enterocytes and mainly by microfold cells in material nature dependent way with TPGS showing better results than other groups. In conclusion, these results identify the mechanism by which the gastrointestinal tract processes micelles and point to the likely use of this approach in the design of micelles-based therapies.