UV resonance Raman spectroscopy probes the localization of tryptophan‐containing antimicrobial peptides in lipid vesicles

In this work we employed UV resonance Raman spectroscopy with 229 nm excitation to study two tryptophan‐containing antimicrobial peptides with a broad‐spectrum activity against Gram‐positive and Gram‐negative bacteria: lactoferricin B (LfB, RRWQWRMKKLG) and pEM‐2 (KKWRWWLKALAKK). UV resonance Raman spectra of both peptides are dominated by tryptophan bands. Raman spectra of LfB and pEM‐2 in D₂O and 2,2,2‐trifluoro ethanol (TFE) have been measured and used to identify the hydrogen‐bond strength marker bands W6 and W17. The tryptophan doublet, W7, at 1340 and 1360 cm⁻¹ was used to detect an increase in the hydrophobicity of Trp environment in TFE. The spectra of LfB in complex with model cell membranes composed of zwitterionic dipalmitoylglycero‐phosphocholine (DPPC) or anionic dipalmitoyglycero‐phosphoglycerol (DPPG) lipid vesicles revealed a more hydrophobic Trp environment in DPPG, suggesting stronger interactions between the cationic peptide and anionic model cell membrane. Copyright © 2008 John Wiley & Sons, Ltd.     

Residual benzamide contamination in synthetic oligonucleotides observed using UV resonance Raman spectroscopy

Spectroscopic methods based on Raman scattering have for many years employed synthetic oligonucleotides in a broad range of applications, either as probes or as model analytes for biophysical investigations. Benzamide is commonly used as a protecting group in the phosphoramidite synthesis of oligonucleotides and, while standard desalting used after synthesis yields sufficiently pure reagents for most assay reactions or other routine uses of the oligomer, it does not completely remove benzamide. We show that the 1609 cm⁻¹ band of residual benzamide contamination can interfere with certain nucleic acid bands, particularly when using excitation wavelengths near 244 nm where the benzamide band is strongly enhanced. For example, the 1609 cm⁻¹ band of benzamide could obscure (or be mistaken as) a weak vibration attributed to an  NH₂ scissoring. The extent of benzamide contamination in desalted preparations varies considerably among different commercial sources, and hence caution is advised when making direct comparisons of ultraviolet Raman data of oligonucleotides from different sources. Copyright © 2010 John Wiley & Sons, Ltd.     

UV resonance Raman spectroscopy probes the amide II′p band position in short breast milk peptides with antioxidant activity

UV resonance Raman spectroscopic study of six short proline‐containing peptides with antioxidant activity isolated from human breast milk was performed. The amide II′ proline spectroscopic band was used to estimate relative cis trans isomerization state of proline amide bonds in the different peptides. Antioxidant activity of the peptides was determined using 1,1‐diphenyl‐2‐picryl‐hydrazyl (DPPH) assay and linoleic acid emulsion assay. Although no clear correlation between the amide II′p position and antioxidant activity of the peptides was observed, they both were found to be sensitive to the presence and/or relative position of proline and tyrosine residues in the peptide. Copyright © 2011 John Wiley & Sons, Ltd.     

Ultraviolet resonance Raman spectroscopy of a β‐sheet peptide: a model for membrane protein folding

The partitioning of a hydrophobic hexapeptide, N‐acetyl‐tryptophan‐pentaleucine (AcWL5), into self‐associated β‐sheets within a vesicle membrane was studied as a model for integral membrane protein folding and insertion via vibrational and electronic spectroscopy. Ultraviolet resonance Raman spectroscopy allows selective examination of the structures of amino acid side chains and the peptide backbone and provides information about local environment and molecular conformation. The secondary structure of AcWL5 within a vesicle membrane was investigated using 207.5‐nm excitation and found to consist of β‐sheets, in agreement with previous studies. The β‐sheet peptide shows enhanced Raman scattering cross‐sections for all amide modes as well as extensive hydrogen‐bonding networks. Tryptophan vibrational structure was probed using 230‐nm excitation. Increases in Raman cross‐sections of tryptophan modes W1, W3, W7, W10, W16, W17, and W18 of membrane‐incorporated AcWL5 are primarily attributed to greater resonance enhancement with the B_b electronic transition. The W17 mode, however, undergoes a much greater enhancement than is expected for a simple resonance effect, and this observation is discussed in terms of hydrogen bonding of the indole ring in a hydrophobic environment. The observed tryptophan mode frequencies and intensities overall support a hydrophobic environment for the indole ring within a vesicle, and these results have implications for the location of tryptophan in membrane protein systems. Copyright © 2009 John Wiley & Sons, Ltd.     

Simple and inexpensive instrument for deep‐UV Raman spectroscopy

Deep‐UV Raman spectroscopy is a powerful way to collect chemically specific information about complex samples. The availability of inexpensive and reliable light sources in the spectral region below 250 nm has been always considered a major bottleneck problem on the way of a widespread of this powerful spectroscopic technique. We report on the efficient fourth‐harmonic generation of a low‐power microchip Nd:YAG laser operating at 946 nm. High‐quality deep‐UV Raman spectra were collected using a newly developed laser source. Copyright © 2013 John Wiley & Sons, Ltd.     

UV‐resonance Raman micro‐spectroscopy to assess residual chromophores in cellulosic pulps

Ultraviolet‐resonance Raman (UV‐RR) micro‐spectroscopy is an appropriate and sensitive tool to assess the chromophore structures in bleached cellulosic pulps used for papermaking. The particular selectivity in detection and identification of chromophores in pulps is achieved by acquiring the UV‐RR spectra in the solid state with laser excitation at 325 nm. This wavelength corresponds to absorption of poly‐unsaturated chromophore structures in partially bleached/fully bleached pulps, and linearly correlated with the signal at ca 1600 cm⁻¹ in the UV‐RR spectra. The characteristic vibrations from particular pulp chromophore structures have been assigned from experiments with model compounds, thus allowing the establishment of a UV‐RR database. Among the components of bleached pulp, the xylan–lignin complex was suggested to be an important source of chromophores. The monitoring of pulp bleaching by UV‐RR allowed us to suggest that it is the formation of new polysaccharide‐derived chromophores upon bleaching that hinders development of further brightness and is co‐responsible for the brightness reversion of fully bleached pulps. Copyright © 2010 John Wiley & Sons, Ltd.     

Deep‐UV tip‐enhanced Raman scattering

We report for the first time the tip‐enhancement of resonance Raman scattering using deep ultraviolet (DUV) excitation wavelength. The tip‐enhancement was successfully demonstrated with an aluminum‐coated silicon tip that acts as a plasmonic material in DUV wavelengths. Both the crystal violet and adenine molecules, which were used as test samples, show electronic resonance at the 266‐nm excitation used in the experiments. With results demonstrated here, molecular analysis and imaging with nanoscale spatial resolution in DUV resonance Raman spectroscopy can be realized using the tip‐enhancement effect. Copyright © 2009 John Wiley & Sons, Ltd.     

Out‐of‐plane deformations of the heme group in different ferrocytochrome c proteins probed by resonance Raman spectroscopy

We measured the low‐wavenumber polarized resonance Raman spectra of horse heart (hhc), chicken (chc) and yeastC102T (yc) ferrocytochromes c with Soret excitation. We examined the out‐of‐plane (oop) deformations of the heme groups by virtue of relative intensities and depolarization ratios of a variety of oop and in‐plane (ip) Raman active bands. Analysis of relative Raman intensities shows differences in deviation from planarity of the heme groups of yeast, horse heart and chicken cytochromes c. The heme groups in cytochrome c proteins have been shown by normal coordinate static deformation (NSD) analysis from crystal structures to exhibit a dominant ruffling (B_1u) deformation. As a consequence the B_1u modes, γ₁₀ − γ₁₂, become resonance Raman active. We used normalized Raman intensity ratios and depolarization ratios of oop Raman active modes, whose intensities are attributable to specific nonplanar deformations, to estimate and compare their Franck‐Condon‐type and Jahn‐Teller‐type coupling magnitudes for horse heart, chicken and yeast ferrocytochrome c at neutral pH. These coupling magnitudes allow for a quantitative comparison of oop deformations between individual heme groups. Chicken ferrocytochrome was found to have the largest ruffling deformation of the three investigated proteins, followed by horse heart and yeast cytochrome c. The heme group of the former is slightly more ruffled than the corresponding active site of the latter, while saddling in both proteins is substantially larger than in chicken ferrocytochrome c. The Raman data are sensitive enough to allow a comparison of lesser deformations. Doming, which is a kinetic coordinate in many heme proteins, is largest in chicken and smallest in yeast cytochrome c. Waving is largest in yeast, followed by horse heart and chicken cytochrome c. Propellering deformations could be compared for chicken and horse heart cytochrome c and were found to be substantially larger in the latter. A comparison with heme deformations obtained from X‐ray structures (for horse heart and yeast cytochrome c) and from molecular dynamics simulations (MDS) (performed for all three proteins) yields some agreement with the main ruffling and saddling deformations derived from the crystal structures, whereas the heme conformations produced by MDS seem to account better for smaller deformations like doming and propellering. The present study demonstrates the usefulness of resonance Raman spectroscopy for the analysis of nonplanar deformations in heme proteins. Copyright © 2008 John Wiley & Sons, Ltd.     

The effects of L‐ to D‐isomerization and C‐terminus deamidation on the secondary structure of antimicrobial peptide Anoplin in aqueous and membrane mimicking environment

UV resonance Raman spectra of the antimicrobial peptide (AMP) Anoplin (L ‐Anoplin‐NH₂) and two of its derivatives (enantiomer D ‐Anoplin‐NH₂ and C‐terminus deamidated L ‐Anoplin‐OH) were measured in aqueous buffer solution and in membrane‐mimetic environments including 2,2,2‐trifluoro ethanol (TFE), zwitterionic lipid dipalmitoylglycerophosphocholine (DPPC) and anionic lipid dipalmitoylglycerophosphoglycerol (DPPG) vesicle solutions. All three peptides were found to adopt random‐coil/β turn‐like conformation in aqueous solution over the temperature range of 1–60 °C. The conformation was found to become more α‐helical in membrane‐mimetic solutions such as TFE and DPPG but not in DPPC for all Anoplin derivatives. The data demonstrate that Anoplin preferentially binds to the anionic over the zwitterionic model cell membranes. Results also showed that deamidation does not change the conformation of L ‐Ano‐NH₂ very significantly, but does alter membrane rupturing and antimicrobial activities thus confirming that it is the physicochemical properties rather than the peptide conformation that define the mechanism of AMP action. Copyright © 2010 John Wiley & Sons, Ltd.     

Visible,near‐infrared,and ultraviolet laser‐excited Raman spectroscopy of the monocytes/macrophages (U937) cells

Raman spectra of the monocytes were recorded with laser excitation at 532, 785, 830, and 244 nm. The measurements of the Raman spectra of monocytes excited with visible, near‐infrared (NIR), and ultraviolet (UV) lasers lad to the following conclusions. (1) The Raman peak pattern of the monocytes can be easily distinguished from those of HeLa and yeast cells; (2) Positions of the Raman peaks of the dried cell are in coincidence with those of the monocytes in a culture cell media. However, the relative intensities of the peaks are changed: the peak centered around 1045 cm⁻¹ is strongly intensified. (3) Raman spectra of the dead monocytes are similar to those of living cells with only one exception: the Raman peak centered around 1004 cm⁻¹ associated with breathing mode of phenylalanine is strongly intensified. The Raman spectra of monocytes excited with 244‐nm UV laser were measured on cells in a cell culture medium. A peak centered at 1485 cm⁻¹ dominates the UV Raman spectra of monocytes. The ratio I₁₅₇₄/I₁₆₁₃ for monocytes is found to be around 0.71. This number reflects the ratio between proteins and DNA content inside a cell and it is found to be twice as high as that of E. coli and 5 times as high as that of gram‐positive bacteria. Copyright © 2009 John Wiley & Sons, Ltd.     

Quantifying amino acid and protein substitution using Raman spectroscopy

Raman spectroscopy can be a powerful tool for the characterization of modified amino acids and proteins. In addition to the potential for quantitative results, it offers the advantage of not requiring any sample preparation. Modification of amines and thiols on amino acids and proteins are common reactions used for medical, biological, food, and agricultural purposes. We hypothesized that the Raman spectrum could be used to quantify the reactions and would be more informative than typical characterization techniques such as the ninhydrin test. To prove the hypothesis, the amino acids alanine, cysteine, and lysine were modified with ethyl vinyl sulfone (EVS) using a nucleophilic addition reaction known as the Michael addition and the product was characterized using Raman spectroscopy. The Raman spectroscopy results were compared with ultraviolet‐visible spectroscopy results based on ninhydrin analysis of the modified amino acids. The Raman spectroscopy analysis was able to discern site‐specific reactions on the amino acids and suggested that more amino acid moieties were substituted than predicted using the ninhydrin test alone. Substitution of the full protein ovalbumin with EVS showed similar results. The ninhydrin test showed the substitution of primary amines and thiols but could not detect substitution of secondary amines remaining after loss of the primary amine. Copyright © 2010 John Wiley & Sons, Ltd.     

The influence of divalent metal ions on low pH induced LacDNA structural changes as probed with UV resonance Raman spectroscopy

UV (275 nm) resonance Raman spectra of LacDNA 22‐mer duplex [d(TAATGTGAGTTAGCTCACTCAT) · d(ATGAGTGAGCTAACTCACATTA)], which contain protein binding sites within the E. coli lac promoter, were measured at two pH values (6.4 and 3.45) in the absence and presence of Mn²⁺ and Ca²⁺ metal ions, respectively. Also, the UV (275 nm) resonance Raman markers of the corresponding oligonucleotide d(TAATGTGAGTTAGCTCACTCAT) and of its complementary anti‐sense strand d(ATGAGTGAGCTAACTCACATTA) were established and tentatively assigned. Large changes in the UV (275 nm) resonance Raman spectra of LacDNA duplex were observed at pH 3.45 as compared with the corresponding spectrum at pH 6.4, in the absence of divalent metal ions and at low concentrations of Ca²⁺ ions, respectively. Major changes comprise: adenine protonation, GC base pair protonation, DNA bases unstacking and changes in the hydrogen bonding strength between the strands of different LacDNA complexes, respectively. Divalent metal ions (Mn²⁺ and Ca²⁺) were found to inhibit LacDNA protonation even at low concentrations. Manganese(II) ions are much more effective in this regard, as compared with calcium(II) ions. Binding of Mn²⁺ ions to N7 of guanine and, possibly, in a lesser extent to adenine was observed as judging from the difference Raman bands at 1315, 1354 and 1493 cm⁻¹. Copyright © 2013 John Wiley & Sons, Ltd.     

Two‐dimensional stimulated ultraviolet resonance Raman spectra of tyrosine and tryptophan: a simulation study

We report an ab initio simulation study of the ultrafast broad bandwidth ultraviolet stimulated resonance Raman spectra (SRRS) of l ‐tyrosine, l ‐tryptophan, and trans‐l ‐tryptophan‐l ‐tyrosine (WY) dipeptide. Two‐pulse one‐dimensional SRRS and three‐pulse two‐dimensional SRRS that reveal inter‐residue and intra‐residue vibrational correlations are simulated using electronically resonant or pre‐resonant pulse configurations that select the Raman signal and discriminate against excited state pathways. Multimode effects are incorporated via the cumulant expansion. The two‐dimensional SRRS technique is more sensitive to residue couplings than spontaneous Raman. Copyright © 2013 John Wiley & Sons, Ltd.     

Deep UV resonance Raman spectroscopic study on electron‐phonon coupling in hexagonal III‐nitride wide bandgap semiconductors

Electron–phonon coupling (EPC) is an important issue in semiconductor physics because of its significant influence on the optical and electrical properties of semiconductors. In this work, the EPC in wide bandgap semiconductors including hexagonal BN and AlN was studied by deep UV resonance Raman spectroscopy. Up to fourth‐order LO phonons are observed in the resonance Raman spectrum of hexagonal AlN. By contrast, only the prominent emission band near the band‐edge and the Raman band attributed to E_2g mode are detected for hexagonal BN with deep UV resonance excitation. The different behavior in resonant Raman scattering between the III‐nitrides reflects their large difference in EPC. The mechanism for EPC in hexagonal BN is the short‐range deformation interaction, while that in hexagonal AlN is mainly associated with the weak long‐range Fröhlich interaction. Copyright © 2016 John Wiley & Sons, Ltd.     

Surface‐enhanced Raman scattering of hydroxyproline

Surface‐enhanced Raman scattering (SERS) spectra of hydroxyproline and one deuterated analogue are reported. In this work, we tackled the problem of SERS reproducibility by employing gold colloids instead of the usual silver sols to achieve plasmon enhanced Raman scattering. We slightly modified modified a previously published procedure to obtain to obtain the colloid, and concentrated the gold particles by centrifugation. The SERS spectra show distinctive bands of hydroxyproline, assigned by comparison to normal Raman spectra and density functional theory calculations. Repeated measurements using this procedure showed reproducible SERS spectra. Copyright © 2011 John Wiley & Sons, Ltd.     

Observation of persistent α‐helical content and discrete types of backbone disorder during a molten globule to ordered peptide transition via deep‐UV resonance Raman spectroscopy

The molten globule (MG) state can aid in the folding of a protein to a functional structure and is loosely defined as an increase in structural disorder with conservation of the ensemble secondary structure content. Simultaneous observation of persistent secondary structure content with increased disorder has remained experimentally problematic. As a consequence, modeling how the MG state remains stable and how it facilitates proper folding remains difficult due to a lack of amenable spectroscopic techniques to characterize this class of partially unfolded proteins. Previously, deep‐UV resonance Raman (dUVRR) spectroscopy has proven useful in the resolution of global and local structural fluctuations in the secondary structure of proteins. In this work, dUVRR was employed to study the MG to ordered transition of a model four‐helix bundle protein, HP7. Both the average ensemble secondary structure and types of local disorder were monitored, without perturbation of the solvent, pH, or temperature. The MG to ordered transition is induced by stepwise coordination of two heme molecules. Persistent dUVRR spectral features in the amide III region at 1295–1301 and 1335–1338 cm⁻¹ confirm previous observations that HP7 remains predominantly helical in the MG versus the fully ordered state. Additionally, these spectra represent the first demonstration of conserved helical content in a MG protein. With successive heme binding, significant losses are observed in the spectral intensity of the amide III₃ and S regions (1230–1260 and 1390 cm⁻¹, respectively), which are known to be sensitive to local disorder. These observations indicate that there is a decrease in the structural populations able to explore various extended conformations with successive heme binding events. DUVRR spectra indicate that the first heme coordination between two helical segments diminishes exploration of more elongated backbone structural conformations in the inter‐helical regions. A second heme coordination by the remaining two helices further restricts protein motion. Copyright © 2013 John Wiley & Sons, Ltd.     

Deep‐UV surface‐enhanced Raman scattering

The presented work demonstrates, to the best of our knowledge, for the first time the capability of an aluminium surface to act as an SERS‐active substrate for deep‐UV excitation wavelengths. Copyright © 2007 John Wiley & Sons, Ltd.     

Studies on the resonance Raman spectra of polyaniline obtained with near‐IR excitation

The effects of near‐IR (NIR) laser power over the Raman spectra of poly(aniline) emeraldine salt (PANI‐ES) and base (PANI‐EB) were investigated. The reasons for the existence of several bands from 1324 to 1500 cm⁻¹ in the Raman spectra of poly(aniline) obtained at NIR region were also studied. The bands from 1324 to 1375 cm⁻¹ were associated to νC N of polarons with different conjugation lengths and the bands from 1450 to 1500 cm⁻¹ in Raman spectra of PANI emeraldine and pernigraniline base forms were correlated to νCN modes associated with quinoid units having different conjugation lengths. The increase of laser power at 1064.0 nm causes the deprotonation of PANI‐ES and the formation of cross‐linking segments having phenazine and/or oxazine rings. For PANI‐EB only a small spectral change is observed when the laser power is increased, owing to the low absorption of this form in the NIR region. Copyright © 2007 John Wiley & Sons, Ltd.     

Enhanced Raman scattering based on fabry‐perot like resonance in a metal‐cladding waveguide

A liquid‐core metal‐cladding waveguide structure of millimeter scale is designed to enhance Raman signal via the excitation of Fabry–Perot‐like resonance. Theoretically, an oscillating field distribution covering the whole guiding layer is generated by the multireflection at the two metal interfaces. The large detection area covers the whole sample chamber because of the oscillating nature of excited high order modes with concentrated intensity. By adding metal nanoparticles, the Fabry–Perot‐like resonance can be combined with local surface plasmons resonance to further enhance the light‐matter interaction with the target molecules, which is also confirmed by the experimental results. Copyright © 2015 John Wiley & Sons, Ltd.     

A‐band structural dynamics of thioanisole by resonance Raman spectroscopy

The structural dynamics of thioanisole in the S₂(ππ*) electronic state that has large oscillator strength was studied by using the resonance Raman spectroscopy. The vibrational assignments were done for thioanisole on the basis of the FT‐Raman and FT‐IR measurements, the density‐functional theory computations and the normal mode analysis. The A‐ and B‐band resonance Raman spectra were obtained in cyclohexane, methanol and acetonitrile, in which ten modes in A’ irreducible representations were observed. The structural dynamics were obtained according to the resonance Raman intensity pattern. The vibroinc‐coupling between the S₃(πσ*) electronic state that has no oscillator strength and the S₂(ππ*) electronic state were revealed. We discuss the correlation between our present structural dynamics and the previous S₂(ππ*)/S₃(πσ*) conical intersectional dynamics revealed by resonant‐enhanced two‐photon ionization and the photofragment excitation spectroscopic study. Copyright © 2012 John Wiley & Sons, Ltd.