共查询到20条相似文献,搜索用时 31 毫秒
1.
Flynn-Charlebois A Prior TK Hoadley KA Silverman SK 《Journal of the American Chemical Society》2003,125(18):5346-5350
Deoxyribozymes that ligate RNA expand the scope of nucleic acid catalysis and allow preparation of site-specifically modified RNAs. Previously, deoxyribozymes that join a 5'-hydroxyl and a 2',3'-cyclic phosphate were identified by in vitro selection from random DNA pools. Here, the alternative strategy of in vitro evolution was used to transform the 8-17 deoxyribozyme that cleaves RNA into a family of DNA enzymes that ligate RNA. The parent 8-17 DNA enzyme cleaves native 3'-5' phosphodiester linkages but not 2'-5' bonds. Surprisingly, the new deoxyribozymes evolved from 8-17 create only 2'-5' linkages. Thus, reversing the direction of the DNA-mediated process from ligation to cleavage also switches the selectivity in forming the new phosphodiester bond. The same change in selectivity was observed upon evolution of the 10-23 RNA-cleaving deoxyribozyme into an RNA ligase. The DNA enzymes previously isolated from random pools also create 2'-5' linkages. Therefore, deoxyribozyme-mediated formation of a non-native 2'-5' phosphodiester linkage from a 5'-hydroxyl and a 2',3'-cyclic phosphate is strongly favored in many different contexts. 相似文献
2.
Purtha WE Coppins RL Smalley MK Silverman SK 《Journal of the American Chemical Society》2005,127(38):13124-13125
An elusive goal for nucleic acid enzymology has been deoxyribozymes that ligate RNA rapidly, sequence-generally, with formation of native 3'-5' linkages, and in preparatively useful yield. Using in vitro selection, we have identified Mg2+- and Zn2+-dependent deoxyribozymes that simultaneously fulfill all four of these criteria. The new deoxyribozymes operate under practical incubation conditions and have modest RNA substrate sequence requirements, specifically D downward arrowRA for 9DB1 and A downward arrowR for 7DE5 (D = A, G, or U; R = A or G). These requirements are comparable to those of deoxyribozymes such as 10-23 and 8-17, which are already widely used as biochemical tools for RNA cleavage. We anticipate that the 9DB1 and 7DE5 deoxyribozymes will find immediate practical application for RNA ligation. 相似文献
3.
Flynn-Charlebois A Wang Y Prior TK Rashid I Hoadley KA Coppins RL Wolf AC Silverman SK 《Journal of the American Chemical Society》2003,125(9):2444-2454
In vitro selection was used to identify deoxyribozymes that ligate two RNA substrates. In the ligation reaction, a 2'-5' RNA phosphodiester linkage is created from a 2',3'-cyclic phosphate and a 5'-hydroxyl group. The new Mg(2+)-dependent deoxyribozymes provide 50-60% yield of ligated RNA in overnight incubations at pH 7.5 and 37 degrees C, and they afford 40-50% yield in 1 h at pH 9.0 and 37 degrees C. Various RNA substrate sequences may be joined by simple Watson-Crick covaration of the DNA binding arms that interact with the two RNA substrates. The current deoxyribozymes have some RNA substrate sequence requirements at the nucleotides immediately surrounding the ligation junction (either UAUA GGAA or UAUN GGAA, where the arrow denotes the ligation site and N equals any nucleotide). One of the new deoxyribozymes was used to prepare by ligation the Tetrahymena group I intron RNA P4-P6 domain, a representative structured RNA. Nondenaturing gel electrophoresis revealed that a 2'-5' linkage between nucleotides A233 and G234 of P4-P6 does not disrupt its Mg(2+)-dependent folding (DeltaDeltaG degrees ' < 0.2 kcal/mol). This demonstrates that a 2'-5' linkage does not necessarily interfere with structure in a folded RNA. Therefore, these non-native linkages may be acceptable in modified RNAs when structure/function relationships are investigated. Deoxyribozymes that ligate RNA should be particularly useful for preparing site-specifically modified RNAs for studies of RNA structure, folding, and catalysis. 相似文献
4.
We have found that nonenzymatic, template-directed ligation reactions of oligoribonucleotides display high selectivity for the formation of 3'-5' rather than 2'-5' phosphodiester bonds. Formation of the 3'-5'-linked product is favored regardless of the metal ion catalyst or the leaving group, and for several different ligation junction sequences. The degree of selectivity depends on the leaving group: the ratio of 3'-5'- to 2'-5'-linked products was 10-15:1 when the 5'-phosphate was activated as the imidazolide, and 60-80:1 when the 5'-phosphate was activated by the formation of a 5'-triphosphate. Comparison of oligonucleotide ligation reactions with previously characterized single nucleotide primer extension reactions suggests that the strong preference for 3'-5'-linkages in oligonucleotide ligation is primarily due to occurence of ligation within the context of an extended Watston-Crick duplex. The ability of RNA to correctly self-assemble by template-directed ligation is an intrinsic consequence of its chemical structure and need not be imposed by an external catalyst (i.e., an enzyme polymerase); RNA therefore provides a reasonable structural basis for a self-replicating system in a prebiological world. 相似文献
5.
We report here the results of a comparative study of hairpin loops that differ in the connectivity of phosphodiester linkages (3',5'- versus 2',5'-linkages). In addition, we have studied the effect of changing the stem composition on the thermodynamic stability of hairpin loops. Specifically, we constructed hairpins containing one of six stem duplex combinations, i.e., DNA:DNA ("DD"), RNA:RNA ("RR"), DNA:RNA ("DR"), 2',5'-RNA:RNA ("RR"), 2',5'-RNA:DNA ("RD"), and 2',5'-RNA:2',5'-RNA ("RR"), and one of three tetraloop compositions, i.e., 2',5'-RNA ("R"), RNA ("R"), and DNA ("D"). All hairpins contained the conserved and well-studied loop sequence 5'-...C(UUCG)G...-3' [Cheong et al. Nature 1990, 346, 680-682]. We show that the 2',5'-linked loop C(UUCG)G, i.e.,...C(3'p5')U(2'p5')U(2'p5')C(2'p5')G(2'p5')G(3'p5')..., like its "normal" RNA counterpart, forms an unusually stable tetraloop structure. We also show that the stability imparted by 2',5'-RNA loops is dependent on base sequence, a property that is shared with the regioisomeric 3',5'-RNA loops. Remarkably, we find that the stability of the UUCG tetraloop is virtually independent of the hairpin stem composition (DD, RR, RR, etc.), whereas the native RNA tetraloop exerts extra stability only when the stem is duplex RNA (R:R). As a result, the relative stabilities of hairpins with a 2',5'-linked tetraloop, e.g. ggac(UUCG)gtcc (T(m) = 61.4 degrees C), are often superior to those with RNA tetraloops, e.g. ggac(UUCG)gtcc (T(m) = 54.6 degrees C). In fact, it has been possible to observe the formation of a 2',5'-RNA:DNA hybrid duplex by linking the hybrid's strands to a (UUCG) loop. These duplexes (RD), which are not stable enough to form in an intermolecular complex [Wasner et al. Biochemistry 1998, 37, 7478-7486], were stable at room temperature (T(m) approximately 50 degrees C). Thus, 2',5'-loops have potentially important implications in the study of nucleic acid complexes where structural data are not yet available. Furthermore, they may be particularly useful as structural motifs for synthetic ribozymes and nucleic acid "aptamers". 相似文献
6.
Branched RNA molecules with a 2',5'-phosphodiester linkage are important biochemical intermediates. Lariat RNA is a particular type of branched RNA that is formed during intron splicing in vivo. Synthesis of branched and lariat RNA is challenging, and there are few general approaches that are applicable in vitro. Here we report the identification of divalent metal-dependent deoxyribozymes (DNA enzymes) that synthesize branched and lariat RNA. In vitro selection was used to obtain deoxyribozymes that selectively join an internal RNA 2'-hydroxyl with a 5'-terminal triphosphate in a convenient "binding arms" format. At least 85% yield of 2',5'-branched RNA is obtained at 37 degrees C and 20 mM Mn2+, pH 7.5 in =30 min, and for some DNA enzymes in as little as 2 min (kobs approximately 0.1-2 min-1). This represents a rate enhancement of up to 5 million-fold over the background reaction. Lariat RNA is also synthesized by the new deoxyribozymes, which have significant potential as generalizable reagents for the practical preparation of branched and lariat RNA. Because nucleic acid enzymes apparently create branched RNA in nature (e.g., group II introns and the spliceosome), the new deoxyribozymes are of substantial mechanistic interest as well as practical importance. 相似文献
7.
Khanduri D Collins S Kumar A Adhikary A Sevilla MD 《The journal of physical chemistry. B》2008,112(7):2168-2178
In previous work, we have shown that photoexcitation of guanine cation radical (G*+) in frozen aqueous solutions of DNA and its model compounds at 143 K results in the formation of neutral sugar radicals with substantial yield. In this report, we present electron spin resonance (ESR) and theoretical (DFT) evidence regarding the formation of sugar radicals after photoexcitation of guanine cation radical (G*+) in frozen aqueous solutions of one-electron-oxidized RNA model compounds (nucleosides, nucleotides and oligomers) at 143 K. Specific sugar radicals C5'*, C3'* and C1'* were identified employing derivatives of Guo deuterated at specific sites in the sugar moiety, namely, C1'-, C2'-, C3'- and C5'-. These results suggest C2'* is not formed upon photoexcitation of G*+ in one-electron-oxidized Guo and deuterated Guo derivatives. Phosphate substitution at C5'- (i.e., in 5-GMP) hinders formation of C5'* via photoexcitation at 143 K but not at 77 K. For the RNA-oligomers studied, we observe on photoexcitation of oligomer-G*+ the formation of mainly C1'* and an unidentified radical with a ca. 28 G doublet. The hyperfine coupling constants of each of the possible sugar radicals were calculated employing the DFT B3LYP/6-31G* approach for comparison to experiment. This work shows that formation of specific neutral sugar radicals occurs via photoexcitation of guanine cation radical (G*+) in RNA systems but not by photoexcitation of its N1 deprotonated species (G(-H)*). Thus, our mechanism regarding neutral sugar formation via photoexcitation of base cation radicals in DNA appears to be valid for RNA systems as well. 相似文献
8.
Wilds CJ Wawrzak Z Krishnamurthy R Eschenmoser A Egli M 《Journal of the American Chemical Society》2002,124(46):13716-13721
(L)-alpha-Threofuranosyl-(3'-->2')-oligonucleotides (TNA) containing vicinally connected phosphodiester linkages undergo informational base pairing in an antiparallel strand orientation and are capable of cross-pairing with RNA and DNA. TNA is derived from a sugar containing only four carbon atoms and is one of the simplest potentially natural nucleic acid alternatives investigated thus far in the context of a chemical etiology of nucleic acid structure. Compared to DNA and RNA that contain six covalent bonds per repeating nucleotide unit, TNA contains only five. We have determined the atomic-resolution crystal structure of the B-form DNA duplex [d(CGCGAA)Td(TCGCG)](2) containing a single (L)-alpha-threofuranosyl thymine (T) per strand. In the modified duplex base stacking interactions are practically unchanged relative to the reference DNA structure. The orientations of the backbone at the TNA incorporation sites are slightly altered in order to accommodate fewer atoms and covalent bonds. The conformation of the threose is C4'-exo with the 2'- and 3'-substituents assuming quasi-diaxial orientation. 相似文献
9.
The major hurdle associated with utilizing oligodeoxyribonucleotides for therapeutic purposes is their poor delivery into cells coupled with high nuclease susceptibility. In an attempt to combine the nonionic nature and high nuclease stability of the P-C bond of methylphosphonates with the high membrane permeability, low toxicity, and improved gene silencing ability of borane phosphonates, we have focused our research on the relatively unexplored methylborane phosphine (Me-P-BH(3)) modification. This Article describes the automated solid-phase synthesis of mixed-backbone oligodeoxynucleotides (ODNs) consisting of methylborane phosphine and phosphate or thiophosphate linkages (16-mers). Nuclease stability assays show that methylborane phosphine ODNs are highly resistant to 5' and 3' exonucleases. When hybridized to a complementary strand, the ODN:RNA duplex was more stable than its corresponding ODN:DNA duplex. The binding affinity of ODN:RNA duplex increased at lower salt concentration and approached that of a native DNA:RNA duplex under conditions close to physiological saline, indicating that the Me-P-BH(3) linkage is positively charged. Cellular uptake measurements indicate that these ODNs are efficiently taken up by cells even when the strand is 13% modified. Treatment of HeLa cells and WM-239A cells with fluorescently labeled ODNs shows significant cytoplasmic fluorescence when viewed under a microscope. Our results suggest that methylborane phosphine ODNs may prove very valuable as potential candidates in antisense research and RNAi. 相似文献
10.
Silverman SK 《Organic & biomolecular chemistry》2004,2(19):2701-2706
Deoxyribozymes are DNA molecules with catalytic activity. For historical and practical reasons, essentially all reported deoxyribozymes catalyze reactions of nucleic acid substrates, although this is probably not a fundamental limitation. In vitro selection strategies have been used to identify many deoxyribozymes that catalyze RNA cleavage, RNA and DNA ligation, and a variety of covalent modification reactions of nucleic acid substrates. Many deoxyribozymes are capable of catalysis with substantial rate enhancements reaching up to 10(10)-fold over background, and their very high selectivities would often be difficult or impossible to achieve using traditional organic synthesis approaches. This report summarizes the current utility and potential future applications of deoxyribozymes from the bioorganic chemistry perspective. 相似文献
11.
Puzhou Wang Prof. Scott K. Silverman 《Angewandte Chemie (International ed. in English)》2016,55(34):10052-10056
We show that DNA enzymes (deoxyribozymes) can introduce azide functional groups at tyrosine residues in peptide substrates. Using in vitro selection, we identified deoxyribozymes that transfer the 2′‐azido‐2′‐deoxyadenosine 5′‐monophosphoryl group (2′‐Az‐dAMP) from the analogous 5′‐triphosphate (2′‐Az‐dATP) onto the tyrosine hydroxyl group of a peptide, which is either tethered to a DNA anchor or free. Some of the new deoxyribozymes are general with regard to the amino acid residues surrounding the tyrosine, while other DNA enzymes are sequence‐selective. We use one of the new deoxyribozymes to modify free peptide substrates by attaching PEG moieties and fluorescent labels. 相似文献
12.
13.
Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method 总被引:1,自引:0,他引:1
Hayakawa Y Kawai R Hirata A Sugimoto JI Kataoka M Sakakura A Hirose M Noyori R 《Journal of the American Chemical Society》2001,123(34):8165-8176
The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core). 相似文献
14.
Ebert MO Mang C Krishnamurthy R Eschenmoser A Jaun B 《Journal of the American Chemical Society》2008,130(45):15105-15115
TNA (alpha-( l)-threofuranosyl-(3'-2') nucleic acid) is a nucleic acid in which the ribofuranose building block of the natural nucleic acid RNA is replaced by the tetrofuranose alpha-( l)-threose. This shortens the repetitive unit of the backbone by one bond as compared to the natural systems. Among the alternative nucleic acid structures studied so far in our laboratories in the etiological context, TNA is the only one that exhibits Watson-Crick pairing not only with itself but also with DNA and, even more strongly, with RNA. Using NMR spectroscopy, we have determined the structure of a duplex consisting entirely of TNA nucleotides. The TNA octamer (3'-2')-CGAATTCG forms a right-handed double helix with antiparallel strands paired according to the Watson-Crick mode. The dominant conformation of the sugar units has the 2'- and 3'-phosphodiester substituents in quasi-diaxial position and corresponds to a 4'-exo puckering. With 5.85 A, the average sequential P i -P i+1 distances of TNA are shorter than for A-type DNA (6.2 A). The helix parameters, in particular the slide and x-displacement, as well as the shallow and wide minor groove, place the TNA duplex in the structural vicinity of A-type DNA and RNA. 相似文献
15.
Current studies of lariat RNA structure and function are hindered by the lack of access to synthetic lariats. A novel approach to the synthesis of both DNA and RNA lariats is presented here. Noteworthy features of the methodology are the regiospecific formation of the 2'-5'-phosphodiester linkage, the unusual parallel stranded DNA/RNA hybrid (or parallel RNA/RNA duplex) that forms between an RNA template and a folded 22-nt DNA (or RNA) substrate, and the efficiency of the chemical ligation step at an adenosine branchpoint (50-80%). The DNA and RNA lariats were purified by polyacrylamide gel electrophoresis, and their structure and nucleotide composition were confirmed by MALDI-TOF mass spectrometry. Thermal denaturation as well as enzymatic and chemical hydrolysis fully supported the proposed lariat structures. Characterization of control parallel duplexes was conducted by gel shift assays and enzymatic degradation with RNase H. The successful synthesis of the lariat molecules described here will allow structural and biochemical studies aimed at better understanding the splicing and debranching mechanisms in which these unusual nucleic acids are involved. 相似文献
16.
Ito KR Kodama T Makimura F Hosoki N Osaki T Orita A Imanishi T Obika S 《Molecules (Basel, Switzerland)》2011,16(12):10695-10708
Double-stranded DNA (dsDNA) templates can hybridize to and accelerate cleavage of oligonucleotides containing a P3'→N5' phosphoramidate (P-N) linkage. This dsDNA-templated cleavage of P-N linkages could be due to conformational strain placed on the linkage upon triplex formation. To determine whether duplex formation also induced conformational strain, we examined the reactivity of the oligonucleotides with a P-N linkage in the presence of single-stranded templates, and compared these reactions to those with dsDNA templates. P-N oligonucleotides that are cleaved upon duplex formation could be used as probes to detect single-stranded nucleic acids. 相似文献
17.
18.
Komiyama M Kina S Matsumura K Sumaoka J Tobey S Lynch VM Anslyn E 《Journal of the American Chemical Society》2002,124(46):13731-13736
The cooperative action of multiple Cu(II) nuclear centers is shown to be effective and selective in the hydrolysis of 2'-5' and 3'-5' ribonucleotides. Reported herein is the specific catalysis by two trinuclear Cu(II) complexes of L3A and L3B. Pseudo first-order kinetic studies reveal that the L3A trinuclear Cu(II) complex effects hydrolysis of Up(2'-5')U with a rate constant of 28 x 10(-)(4) min(-)(1) and Up(3'-5')U with a rate constant of 0.5 x 10(-)(4) min(-)(1). The hydrolyses of Ap(3'-5')A and Ap(2'-5')A proceed with rate constants of 24 x 10(-)(4) min(-)(1) and 0.5 x 10(-)(4) min(-)(1) respectively. The L3A trinuclear Cu(II) complex demonstrates high specificity for Up(2'-5')U and Ap(3'-5')A. Similar studies with the more rigid L3B trinuclear Cu(II) complex shows no selectivity and yields lower rate constants for hydrolysis. The selectivity observed with the L3A ligand is attributed to the geometry of the ligand-bound diribonucleotide which ultimately dictates the proximity of the attacking hydroxyl and the phosphoester to a Cu(II) center for activation and subsequent hydrolysis. 相似文献
19.
Yoanes Maria Vianney Pit Preckwinkel Swantje Mohr Prof. Dr. Klaus Weisz 《Chemistry (Weinheim an der Bergstrasse, Germany)》2020,26(70):16910-16922
A parallel quadruplex derived from the Myc promoter sequence was extended by a stem-loop duplex at either its 5′- or 3′-terminus to mimic a quadruplex–duplex (Q–D) junction as a potential genomic target. High-resolution structures of the hybrids demonstrate continuous stacking of the duplex on the quadruplex core without significant perturbations. An indoloquinoline ligand carrying an aminoalkyl side chain was shown to bind the Q–D hybrids with a very high affinity in the order Ka≈107 m −1 irrespective of the duplex location at the quadruplex 3′- or 5′-end. NMR chemical shift perturbations identified the tetrad face of the Q–D junction as specific binding site for the ligand. However, calorimetric analyses revealed significant differences in the thermodynamic profiles upon binding to hybrids with either a duplex extension at the quadruplex 3′- or 5′-terminus. A large enthalpic gain and considerable hydrophobic effects are accompanied by the binding of one ligand to the 3′-Q–D junction, whereas non-hydrophobic entropic contributions favor binding with formation of a 2:1 ligand-quadruplex complex in case of the 5′-Q–D hybrid. 相似文献
20.
Carina Hey Pui Cheung Jianchao Xu Chi Lung Lee Yanfeng Zhang Ruohan Wei Donald Bierer Xuhui Huang Xuechen Li 《Chemical science》2021,12(20):7091
Herein, we report the development of a facile synthetic strategy for constructing diverse peptide structural architectures via chemoselective peptide ligation. The key advancement involved is to utilize the benzofuran moiety as the peptide salicylaldehyde ester surrogate, and Dap–Ser/Lys–Ser dipeptide as the hydroxyl amino functionality, which could be successfully introduced at the side chain of peptides enabling peptide ligation. With this method, the side chain-to-side chain cyclic peptide, branched/bridged peptides, tailed cyclic peptides and multi-cyclic peptides have been designed and successfully synthesized with native peptidic linkages at the ligation sites. This strategy has provided an alternative strategic opportunity for synthetic peptide development. It also serves as an inspiration for the structural design of PPI inhibitors with new modalities.Methods of introducing peptide salicylaldehyde esters and hydroxyl amine functionality into the peptide side chain have been developed. Diverse peptide structural motifs were constructed via ligation with native amide linkages at the ligation sites. 相似文献