共查询到20条相似文献,搜索用时 328 毫秒
1.
2.
Recently developed procedures for determining near-r e structures (r m p )from scaled ground-state moment of inertia data have been extended to general polyatomic molecules. A simple and general empirical method for correctingl m p moments for the large vibration-rotation effects of deuterium substitution has been proposed and illustrated for a variety of polyatomic molecules. The correction requires utilization of a bond elongation parameter,δr D ,whose experimental value is found to be approximately 0.003 Å. A theoretical justification of the approximation has been provided for linear triatomic molecules. 相似文献
3.
Zerara M Brickmann J Kretschmer R Exner TE 《Journal of computer-aided molecular design》2009,23(2):105-111
Quantitative information of solvation and transfer free energies is often needed for the understanding of many physicochemical processes, e.g the molecular recognition phenomena, the transport and diffusion processes through biological membranes and the tertiary structure of proteins. Recently, a concept for the localization and quantification of hydrophobicity has been introduced (Jäger et al. J Chem Inf Comput Sci 43:237–247, 2003). This model is based on the assumptions that the overall hydrophobicity can be obtained as a superposition of fragment contributions. To date, all predictive models for the logP have been parameterized for n-octanol/water (logP oct ) solvent while very few models with poor predictive abilities are available for other solvents. In this work, we propose a parameterization of an empirical model for n-octanol/water, alkane/water (logP alk ) and cyclohexane/water (logP cyc ) systems. Comparison of both logP alk and logP cyc with the logarithms of brain/blood ratios (logBB) for a set of structurally diverse compounds revealed a high correlation showing their superiority over the logP oct measure in this context. 相似文献
4.
《Arabian Journal of Chemistry》2023,16(3):104521
The continuous development of resistance to antibiotic drugs by microorganisms causes high mortality and morbidity. Pathogens with distinct features and biochemical abilities make them destructive to human health. Therefore, early identification of the pathogen is of substantial importance for quick ailments and healthcare outcomes. Several phenotype methods are used for the identification and resistance determination but most of the conventional procedures are time-consuming, costly, and give qualitative results. Recently, great focus has been made on the utilization of advanced techniques for microbial identification. This review is focused on the research studies performed in the last five years for the identification of microorganisms particularly, bacteria using advanced spectroscopic techniques including mass spectrometry (MS), infrared (IR) spectroscopy, Raman spectroscopy (RS), and nuclear magnetic resonance (NMR) spectroscopy. Among all the techniques, MS techniques, particularly MALDI-TOF/MS have been widely utilized for microbial identification. A total of 44 bacteria i.e., 6 Staphylococcus spp., 3 Enterococcus spp., 6 Bacillus spp., 4 Streptococcus spp., 6 Salmonella spp., and one from each genus including Escherichia, Acinetobacter, Pseudomonas, Proteus, Clostridioides, Candida, Brucella, Burkholderia, Francisella, Yersinia, Moraxella, Vibrio, Shigella, Serratia, Citrobacter, and Haemophilus (spp.) were discussed in the review for their identification using the above-mentioned techniques. Among all the identified microorganisms, 21% of studies have been conducted for the identification of E. coli, 14% for S. aureus followed by 37% for other microorganisms. 相似文献
5.
Humbelani Silas Mudau Hilda Kwena Mokoboki Khuliso Emmanuel Ravhuhali Zimbili Mkhize 《Molecules (Basel, Switzerland)》2022,27(5)
In semi-arid regions, browse plant species are used as feed and for medicinal purposes for both animals and humans. The limitation of the utilization of these species to medicinal purposes or as feed for livestock is a lack of knowledge on the concentration level of phytochemicals and other bioactive compounds found in these plants. The study sought to assay the qualitative and quantitative bioactive constituents of some browse species found in the savannah biome of South Africa, viz. Adansonia digitate, Androstachys johnsonii, Balanites maughamii, Berchemia discolor, Berchemia zeyheri, Bridelia mollis hutch, Carissa edulis, Catha edulis, Colophospermum mopane, Combretum Imberbe, Combretum molle, Combretum collinum, Dalbergia melanoxylon, Dichrostachys cinerea, Diospros lycioides, Diospyros mespiliformis, Euclea divinorum, Flueggea virosa, Grewia flava, Grewia flavescens, Grewia monticola, Grewia occidentalis, Melia azedarach, Peltophorum africanum, Prosopis velutina, Pseudolachnostylis maprouneifolia, Pterocarpus rotundifolius, Schinus molle, Schotia brachypetala, Sclerocarya birrea, Searsia lancea, Searsia leptodictya, Searsia pyroides, Senegalia caffra, Senegalia galpinii, Senegalia mellifera, Senegalia nigrescens, Senegalia polyacantha, Strychnos madagascariensis, Terminalia sericea, Trichilia emetic, Vachellia erioloba, Vachellia hebeclada, Vachellia karroo, Vachellia nilotica, Vachellia nilotica subsp. Kraussiana, Vachellia rechmanniana, Vachellia robusta, Vachellia tortilis, Vachellia tortilis subsp. raddiana, Vangueria infausta, and Ziziphus mucronata. These browse species’ leaf samples were harvested from two provinces (Limpopo and North-West) of South Africa. The Limpopo province soil type was Glenrosa, Mispah, and Lithosols (GM-L), and the soil types in the North-West Province were Aeolian Kalahari Sand, Clovelly, and Hutton (AKS-CH). The harvested browse samples were air dried at room temperature for about seven days and ground for analysis. The methanol and distilled water extracts of the browse species leaves showed the presence of common phytoconstituents, including saponins, flavonoids, tannins, phenols, cardio glycosides, terpenoids, and phlobatannins, as major active compounds in browse species leaves. In the quantitative analysis, phytochemical compounds, such as soluble phenols, insoluble tannins, and condensed tannins, were quantified for common species found in both sites. Two-way ANOVA and multivariate analysis were used to test soil type and species effect on soluble phenols, insoluble tannins, and condensed tannins of woody species. Dichrostachys cinerea (0.1011% DM) in GM-L soil type and Z. mucronata (0.1009% DM) in AKS-CH soil type showed the highest (p < 0.05) concentration of soluble phenols. In AKS-CH soil type, D. cinerea (0.0453% DM) had the highest insoluble tannins concentration, while V. hebeclada had the lowest (0.0064% DM) insoluble tannins content. Vacchelia hebeclada had lower (p < 0.05) condensed tannins concentration levels than all other browse plants in both soil types. Under multivariate analysis tests, there was a significant effect (p < 0.001) of soil type, species, and soil type x species interaction on soluble phenols, insoluble tannins, and condensed tannins of woody species. In this study, most of the woody species found in GM-L soil type showed a lower amount of tannins than those harvested in AKS-CH soil type. There is a need to identify the amount of unquantified phytochemicals contained in these browse species and valorize the high-bioactive-compound browse species to enhance and maximize browsing of these browse species for animal production. 相似文献
6.
The viscosity of pure n-alkanes and n-alkane mixtures was studied by molecular dynamics (MD) simulations using the Green–Kubo method. n-Alkane molecules were modeled based on the Transferable Potential for Phase Equilibria (TraPPE) united atom force field. MD simulations at constant number of molecules or particles, volume and temperature (NVT) were performed for n-C8 up to n-C96 at different temperatures as well as for binary and six-component n-alkane mixtures which are considered as prototypes for the hydrocarbon wax produced during the Gas-To-Liquid (GTL) Fischer–Tropsch process. For the pure n-alkanes, good agreement between our simulated viscosities and existing experimental data was observed. In the case of the n-alkane mixtures, the composition dependence of viscosity was examined. The simulated viscosity results were compared with literature empirical correlations. Moreover, a new macroscopic empirical correlation for the calculation of self-diffusion coefficients of hydrogen, carbon monoxide, and water in n-alkanes and mixtures of n-alkanes was developed by combining viscosity and self-diffusion coefficient values in n-alkanes. The correlation was compared with the simulation data and an average absolute deviation (AAD) of 11.3% for pure n-alkanes and 14.3% for n-alkane mixtures was obtained. 相似文献
7.
The problem of defining N(E), the density of states, for molecular systems is discussed. It is shown that a numeric evaluation of N(E) is often only approximate, even for continuous data, and is not well defined for quantized systems. The application of the concept of density of states is discussed, particularly with regard to the RRKM theory of unimolecular reactions. The sum of states, W(E), and density of states curves are evaluated for several harmonic and anharmonic model systems and the results discussed in order to illustrate the foregoing considerations. 相似文献
8.
Shigeru Furukubo 《Tetrahedron letters》2004,45(44):8177-8181
A new method using electrochemical oxidation has been exploited for the stereoselective synthesis of 2,3,6-trihydroxylated 5S-piperidine derivatives. The electrochemical method was successively used for the conversion of N-protected piperidines to N-protected 1-methoxypiperidines and for the conversion of 1-methoxy-2,3-didehydropiperidine derivatives to 1,2,3-triacetoxypiperidine derivatives. The method provided a new synthetic route to 2S,3S,6-triacetoxy-5S-methylpiperidine and 2R,3R,6-triacetoxy-5S-methylpiperidine. 相似文献
9.
Yu. I. Matveev 《Polymer Science Series A》2006,48(11):1185-1189
An expression for the ratio of the glass transition temperature to the melting temperature, T g/T m, was derived with allowance for fluctuations of the packing factor in the amorphous state. This relationship made it possible to describe the actual range of variation in T g/T m depending on a change in the packing factor in the crystalline state k o, cr. The proposed approach forms the basis for the method of determination of increments in the packing ratio k o, cr and formulation of the principles of selection of experimental data for calculations. The glass transition temperatures in polyethylene depending on the type of unit cell were calculated. 相似文献
10.
Mitsuru ShojiSatoshi Kishida Yusuke KoderaIsamu Shiina Hideaki KakeyaHiroyuki Osada Yujiro Hayashi 《Tetrahedron letters》2003,44(38):7205-7207
Of the 16 possible modes of the oxidation-6π-electrocylization-Diels-Alder reaction cascade for an epoxyquinone, and eight for a 2-alkenyl-3-hydroxymethyl-2-cyclohexen-1-one, only the endo-anti(epoxide)-anti(Me)-hetero and endo-anti(Me)-hetero are respectively observed, while both the endo-anti(epoxide)-anti(Me)-hetero and exo-anti(epoxide)-anti(Me)-homo reaction modes occur with epoxy-4-hydroxycyclohexenones owing to a hydrogen-bonding interaction. 相似文献
11.
We calculate the rotational magnetic moments and the corresponding g-factors for water and ammonia. Our results are gxx = 0.397, gyy = 0.769 and zz = 0.345 for water and gxx = gyy = 0.69 and gzz = 0.51 for ammonia. The experimental values are gxx = 0.585, gyy = 0.742 and gzz = 0.666 for water and gxx = gyy = 0.56 and gzz = 0.484 for ammonia. 相似文献
12.
Gonzalo Blay 《Tetrahedron》2007,63(39):9621-9626
1αH,7αH,10αH-Guaia-4,11-dien-3-one and its 1βH,10βH diastereomer, easily obtained from (+)-dihydrocarvone, are good starting materials for the synthesis of natural guaiane derivatives. Allylic oxidation of the 1αH,10αH isomer gave as main product its 13-hydroxy derivative and a small amount of (+)-7β-hydroxy-1αH,10αH-guaia-4,11-dien-3-one, whereas the 1βH,10βH diastereomer afforded selectively the (−)-7α-hydroxy-1βH,10βH enantiomer in excellent yield. From the 13-hydroxy derivative (+)-pechueloic acid and (+)-methyl pechueloate were synthesized. Deoxygenation at C3 of the 1βH,10βH guaiadienone afforded a guaiadiene with the reported structure for aciphyllene but its spectral data did not agree with those reported for the natural diene. The structure of natural (+)-aciphyllene has been corrected to 1αH,7αH,10αH-guaia-4,11-diene obtained by deoxygenation of the 1αH,10αH guaiadienone. 相似文献
13.
Takashi Nakajima T. N. Chang 《Zeitschrift für Physik D Atoms, Molecules and Clusters》1996,36(1):41-46
We present a semi-empirical calculational procedure for thep 5 nl bound excited states of rare gas atoms based on the use of an LS-dependent orbital for an excitednl electron outside a frozen Hartree-Fockp 5 core. The spin-orbit interaction is accounted for approximately using a localized Hartree potential. The contribution from the long-range core polarization is estimated by using a parametrized potential. A model potential is also introduced to represent partially the short-range multi-electron interactions for thep 5 np levels. The energy levels are calculated by diagonalizing the Hamiltonian matrix following anLS →jl transformation. The calculated fine structure of the Nep 5 ns,p 5 np,p 5 nd, andp 5 nf ¦ (jl)KJ〉 levels are in close agreement with the observed level splittings. The transition probabilities are also in agreement with earlier theoretical and experimental results. 相似文献
14.
H. Pilkuhn H. G. Schlaile 《Zeitschrift für Physik D Atoms, Molecules and Clusters》1990,15(4):321-325
We present tables of vacuum polarization energies for light mesic atoms (p,d,3He and4He) with a precision of 10?4 for all values ofn andl. 相似文献
15.
N. Kulagin 《Journal of solid state chemistry》2005,178(2):554-562
Theoretical study of electronic structure of antinide ions and its dependence on N and Z are presented in this paper. The main 5fN and excited 5fNn′l′N′ configurations of actinides have been studied using Hartree-Fock-Pauli approximation. Results of calculations of radial integrals and the energy of X-ray lines for all 5f ions with electronic state AC+1−AC+4 show approximate dependence on N and Z. A square of N and cubic of Z are ewalized for the primary electronic parameters of the actinides. Theoretical values of radial integrals for free actinides and for ions in a cluster AC+n:[L]k are compared, too. 相似文献
16.
Kana M. Sureshan 《Tetrahedron》2009,65(13):2703-5526
A metal mediated unusual 1-3 acyl migration from C4-O to C2-OH of myo-inositol 1,3,5-orthoformate was observed during the alkylation of racemic 4-O-benzoyl-myo-inositol 1,3,5-orthoformate. This has been exploited for the selective esterification of either the C4(6)-OH or the C2-OH of myo-inositol by varying the amount of the base used. While the use of 1 equiv of the base (sodium hydride or potassium tert-butoxide) for the acylation of myo-inositol orthoesters gives the corresponding C4-ester exclusively, the use of two or more equivalents of base for the same reaction gives the C2-ester exclusively. The relatively higher stability of the alkoxide of racemic 2-O-acyl-myo-inositol 1,3,5-orthoester as compared to the alkoxide of 4-O-acyl-myo-inositol 1,3,5-orthoester is suggested to be responsible for the observed isomerization. 相似文献
17.
Li Gao 《Tetrahedron》2005,61(15):3805-3811
Trihydroxy-2-thiaquinolizidines, a new class of bicyclic dideoxy-iminohexitol glycosidase inhibitor derivatives with nominally the d-gluco, l-ido, d-manno and l-gulo configurations were synthesized. X-ray analyses indicated that the preferred conformation for d-gluco and d-manno derivatives was a flat trans-fused system. Unlike deoxynojirimycin, the compound with d-gluco configuration was selective for α-glucosidases (yeast and rice) and showed no inhibitory activity towards β-glucosidase (almond), α-galactosidase (green coffee beans), α-galactosidase (E. coli) and α-mannosidase (jack bean), while the l-ido derivative was specific for β-glucosidase (almond). 相似文献
18.
Gang Wang Xuanjiao Bai Xiaochen Chen Ying Ren Jianping Han 《Molecules (Basel, Switzerland)》2022,27(7)
Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra-containing products. 相似文献
19.
Rumex confertus belongs to the genus Rumex and is classified as an invasive parasitic plant in agriculture. Despite other Rumex species being widely used in herbal medicine due to their antimicrobial, antioxidant, antitumor, and anti-inflammatory effects, there are almost no information about the potential of Rumex confertus for the treatment of various diseases. In this review we analyzed scientific articles revealing properties of Rumex plant’s substances against cancer, diabetes, pathogenic bacterial invasions, viruses, inflammation, and oxidative stress for the past 20 years. Compounds dominating in each composition of solvents for extraction were discussed, and common thin layer chromatography(TLC) and high performance liquid chromatography(HPLC) methods for efficient separation of the plant’s extract are included. Physico-chemical properties such as solubility, hydrophobicity (Log P), pKa of flavonoids, anthraquinones, and other derivatives are very important for modeling of pharmacokinetic and pharmacodynamics. An overview of clinical studies for abounded selected substances of Rumex species is presented. 相似文献
20.
Jozef Gonda Michael Široký Miroslava Martinková Samuel Homolya Mária Vilková Martina Bago Pilátová Sergej Šesták 《Tetrahedron》2019,75(3):398-408
A straightforward stereoselective route towards (3aR,5R,6S,7R,7aR)- and (3aR,5R,6S,7R,7aR)-octahydro-1H-indole-5,6,7-triol, analogues of castanospermine, starting from the corresponding shikimic acid derivatives is described. The key transformations of this approach are the Overman rearrangement and ring-closing metathesis to form the diastereoisomeric cis-fused (5R,6S,7R)-octahydro-1H-indole-5,6,7-triols in good overall yields. Evaluation for in vitro cytotoxicity revealed for some prepared compounds significant antiproliferative activity and weak glycosidase inhibition. 相似文献