Design of a triple-helix-specific cleaving reagent

BACKGROUND: Double-helical DNA can be recognized sequence specifically by oligonucleotides that bind in the major groove, forming a local triple helix. Triplex-forming oligonucleotides are new tools in molecular and cellular biology and their development as gene-targeting drugs is under intensive study. Intramolecular triple-helical structures (H-DNA) are expected to play an important role in the control of gene expression. There are currently no good probes available for investigating triple-helical structures. We previously reported that a pentacyclic benzoquinoquinoxaline derivative (BQQ) can strongly stabilize triple helices. RESULTS: We have designed and synthesized the first triple-helix-specific DNA cleaving reagent by covalently attaching BQQ to ethylenediaminetetraacetic acid (EDTA). The intercalative binding of BQQ should position EDTA in the minor groove of the triple helix. In the presence of Fe(2+) and a reducing agent, the BQQ-EDTA conjugate can selectively cleave an 80 base pair (bp) DNA fragment at the site where an oligonucleotide binds to form a local triple helix. The selectivity of the BQQ-EDTA conjugate for a triplex structure was sufficiently high to induce oligonucleotide-directed DNA cleavage at a single site on a 2718 bp plasmid DNA. CONCLUSIONS: This new class of structure-directed DNA cleaving reagents could be useful for cleaving DNA at specific sequences in the presence of a site-specific, triple-helix-forming oligonucleotide and also for investigating triple-helical structures, such as H-DNA, which could play an important role in the control of gene expression in vivo.     

Ligand-induced formation of Hoogsteen-paired parallel DNA

zIntroduction: Based on molecular modeling studies, a model has been proposed for intercalation of triple-helixspecific ligands (benzopyridoindole (BPI) derivatives) into triple helices, in which the intercalating compounds interact mainly with the Hoogsteen-paired strands of the triple helix. We set out to test this model experimentally using DNA duplexes capable of forming parallel Hoogsteen base-paired structures.Results: We have investigated the possible formation of a parallel DNA structure involving Hoogsteen hydrogen bonds by thermal denaturation, FTIR spectroscopy and gel-shift experiments. We show that BPI derivatives bind to Hoogsteen base-paired duplexes and stabilize them. The compounds induce a reorganization from a non-perfectly matched antiparallel Watson-Crick duplex into a perfectly matched parallel Hoogsteen-paired duplex.Conclusions: These results suggest that preferential intercalation of BPI derivatives in triple helices is due to their ability to interact specifically with the Hoogsteen-paired bases. The results are consistent with a model proposed on the basis of molecular modeling studies using energy minimization, and they open a new field of investigations regarding the biological relevance of Hoogsteen base-pairing.     

Probing hydrogen bonding in a DNA triple helix using protium-deuterium fractionation factors

In this communication we report protium-deuterium fractionation factors for the intramolecular triple helix formed by the DNA oligonucleotide 5'-d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT)-3'. The fractionation factors of individual Watson-Crick and Hoogsteen hydrogen bonds in the structure are measured by NMR spectroscopy. The results show that, in contrast to proteins, the fractionation factors are all equal or lower than unity. On the average, the values of the fractionation factors are centered between 0.6 and 0.8, and no significant differences are observed between Hoogsteen and Watson-Crick hydrogen bonds. Deviations from the average are observed for the 5'-end region of the molecule where a base triad is absent and the structure is strained by the intramolecular folding of the DNA strand.     

New junction models for alternate-strand triple-helix formation

Background: Oligonucleotide-directed triple-helix (triplex) formation can interfere with gene expression but only long tracts of oligopyrimidine·oligopurine sequences can be targeted. Attempts have been made to recognize short oligopurine sequences alternating on the two strands of double-stranded DNA by the covalent linkage of two triplex-forming oligonucleotides. Here we focus on the rational optimization of such an alternate-strand triplex formation on a DNA duplex containing a 5′-GpT-3′/3′-CpA-5′ or a 5′-TpG-3′/3′-ApC-5′ step by combination of (G,T)- and (G,A)-contain ing oligonucleotides that bind to the oligopurine strands in opposite orientations.Results: The deletion of one nucleotide in the reverse Hoogsteen region of the oligonucleotide provides the best binding at the 5′-GpT-3′/3′-CpA-5′ step, whereas the addition of two cytosines as a linker between the two oligonucleotides is the best strategy to cross a 5′-TpG-3′/3′-ApC-5′ step. Energy minimization and experimental data suggest that these two cytosines are involved in the formation of two novel base quadruplets.Conclusions: These data provide a rational basis for the design of oligonucleotides capable of binding to oligopurine sequences that alternate on the two strands of double-stranded DNA with a 5′-GpT-3′/3′-CpA-5′ or a 5′-TpG-3′/3′-ApC-5' step at the junction.     

Bicyclo-DNA: a Hoogsteen-selective pairing system

Background: The natural nucleic acids (DNA and RNA) can adopt a variety of structures besides the antiparallel double helix described by Watson and Crick, depending on base sequence and solvent conditions. Specifically base-paired DNA structures with regular backbone units include left-handed and parallel duplexes and triple and quadruple helical arrangements. Given the base-pairing pattern of the natural bases, preferences for how single strands associate are determined by the structure and flexibility of the sugar-phosphate backbone. We set out to determine the role of the backbone in complex formation by designing DNA analogs with well defined modifications in backbone structure.Results: We recently developed a DNA analog (bicyclo-DNA) in which one (γ) of the six torsion angles (a-ζ) describing the DNA-backbone conformation is fixed in an orientation that deviates from that observed in B-DNA duplexes by about +100°, a shift from the synclinal to the antiperiplanar range. Upon duplex formation between homopurine and homopyrimidine sequences, this analog preferentially selects the Hoogsteen and reversed Hoogsteen mode, forming A-T and G-C⁺ base pairs. Base-pair formation is highly selective, but degeneracy is observed with respect to strand orientation in the duplex.Conclusions: The flexibility and orientation of the DNA backbone can influence the preferences of the natural bases for base-pairing modes, and can alter the relative stability of duplexes and triplexes.     

Infrared Spectroscopic Observation of a G–C+ Hoogsteen Base Pair in the DNA:TATA‐Box Binding Protein Complex Under Solution Conditions

Hoogsteen DNA base pairs (bps) are an alternative base pairing to canonical Watson–Crick bps and are thought to play important biochemical roles. Hoogsteen bps have been reported in a handful of X‐ray structures of protein–DNA complexes. However, there are several examples of Hoogsteen bps in crystal structures that form Watson–Crick bps when examined under solution conditions. Furthermore, Hoogsteen bps can sometimes be difficult to resolve in DNA:protein complexes by X‐ray crystallography due to ambiguous electron density and by solution‐state NMR spectroscopy due to size limitations. Here, using infrared spectroscopy, we report the first direct solution‐state observation of a Hoogsteen (G–C⁺) bp in a DNA:protein complex under solution conditions with specific application to DNA‐bound TATA‐box binding protein. These results support a previous assignment of a G–C⁺ Hoogsteen bp in the complex, and indicate that Hoogsteen bps do indeed exist under solution conditions in DNA:protein complexes.     

Design of triple helix forming C-glycoside molecules

The modeling, synthesis, and characterization of oligomers containing 2-aminoquinazolin-5-yl 2'-deoxynucleotide residues are reported. The 2-aminoquinazoline residues sequence specifically bind via Hoogsteen base pairing as a third strand in the center of the major groove at T:A base pair Watson-Crick duplex sequences. Evidence for the formation of a sequence specific three-stranded structure is based on thermal denaturation UV-vis and fluorescence studies. The novel 2-aminoquinazoline C-nucleotide is a component of a system designed to overcome the homopurine requirement for triple helix structures.     

Cu~（2＋）对三螺旋poly（A：2I）解旋的结构分析

通过圆二色谱（ＣＤ）和吸收光谱研究了Ｃｕ（２＋）对三螺旋ｐｏｌｙ（Ａ：２Ｉ）的解旋行为，并从结构的角度分析了其解旋机理。结果表明：Ｃｕ（２＋）通过与ｐｏｌｙ（Ａ：２Ｉ）中的碱基的结合，破坏了Ｈｏｏｇｓｔｅｅｎ碱基对和Ｗａｔｓｏｎ－Ｃｒｉｃｋ碱基对中的氢键，从而导致了三螺旋ｐｏｌｙ（Ａ：２Ｉ）不可复性的解旋。     

Sequence‐Dependent dsDNA‐Templated Formation of Fluorescent Copper Nanoparticles

There are only a few systematic rules about how to selectively control the formation of DNA‐templated metal nanoparticles (NPs) by varying sequence combinations of double‐stranded DNA (dsDNA), although many attempts have been made. Herein, we develop a facile method for sequence‐dependent formation of fluorescent CuNPs by using dsDNA as templates. Compared with random sequences, AT sequences are better templates for highly fluorescent CuNPs. Other specific sequences, for example, GC sequences, do not induce the formation of CuNPs. These results shed light on directed DNA metallization in a sequence‐specific manner. Significantly, both the fluorescence intensity and the fluorescence lifetime of CuNPs can be tuned by the length or the sequence of dsDNA. In order to demonstrate the promising practicality of our findings, a sensitive and label‐free fluorescence nuclease assay is proposed.     

Three's a crowd – stabilisation,structure, and applications of DNA triplexes

DNA is a strikingly flexible molecule and can form a variety of secondary structures, including the triple helix, which is the subject of this review. The DNA triplex may be formed naturally, during homologous recombination, or can be formed by the introduction of a synthetic triplex forming oligonucleotide (TFO) to a DNA duplex. As the TFO will bind to the duplex with sequence specificity, there is significant interest in developing TFOs with potential therapeutic applications, including using TFOs as a delivery mechanism for compounds able to modify or damage DNA. However, to combine triplexes with functionalised compounds, a full understanding of triplex structure and chemical modification strategies, which may increase triplex stability or in vivo degradation, is essential – these areas will be discussed in this review. Ruthenium polypyridyl complexes, which are able to photooxidise DNA and act as luminescent DNA probes, may serve as a suitable photophysical payload for a TFO system and the developments in this area in the context of DNA triplexes will also be reviewed.

Triplex-forming oligonucleotides can target specific DNA sequences by binding in the duplex major groove. Chemical modifications and ligand binding have been explored, for use in a variety of biological applications.     

Contiguous metal-mediated base pairs comprising two Ag(I) ions

The incorporation of transition‐metal ions into nucleic acids by using metal‐mediated base pairs has proved to be a promising strategy for the site‐specific functionalization of these biomolecules. We report herein the formation of Ag⁺‐mediated Hoogsteen‐type base pairs comprising 1,3‐dideaza‐2′‐deoxyadenosine and thymidine. By defunctionalizing the Watson–Crick edge of adenine, the formation of regular base pairs is prohibited. The additional substitution of the N3 nitrogen atom of adenine by a methine moiety increases the basicity of the exocyclic amino group. Hence, 1,3‐dideazaadenine and thymine are able to incorporate two Ag⁺ ions into their Hoogsteen‐type base pair (as compared with one Ag⁺ ion in base pairs with 1‐deazaadenine and thymine). We show by using a combination of experimental techniques (UV and circular dichroism (CD) spectroscopies, dynamic light scattering, and mass spectrometry) that this type of base pair is compatible with different sequence contexts and can be used contiguously in DNA double helices. The most stable duplexes were observed when using a sequence containing alternating purine and pyrimidine nucleosides. Dispersion‐corrected density functional theory calculations have been performed to provide insight into the structure, formation and stabilization of the twofold metalated base pair. They revealed that the metal ions within a base pair are separated by an Ag???Ag distance of about 2.88 Å. The Ag–Ag interaction contributes some 16 kcal mol^?1 to the overall stability of the doubly metal‐mediated base pair, with the dominant contribution to the Ag–Ag bonding resulting from a donor–acceptor interaction between silver 4d‐type and 4s orbitals. These Hoogsteen‐type base pairs enable a higher functionalization of nucleic acids with metal ions than previously reported metal‐mediated base pairs, thereby increasing the potential of DNA‐based nanotechnology.     

Stabilization by extra-helical thymines of a DNA duplex with Hoogsteen base pairs

We present the crystal structure of the DNA duplex formed by d(ATATATCT). The crystals contain seven stacked antiparallel duplexes in the asymmetric unit with A.T Hoogsteen base pairs. The terminal CT sequences bend over so that the thymines enter the minor groove and form a hydrogen bond with thymine 2 of the complementary strand in the Hoogsteen duplex. Cytosines occupy extra-helical positions; they contribute to the crystal lattice through various kinds of interactions, including a unique CAA triplet. The presence of thymine in the minor groove apparently contributes to the stability of the DNA duplex in the Hoogsteen conformation. These observations open the way toward finding under what conditions the Hoogsteen duplex may be stabilized in vivo. The present crystal structure also confirms the tendency of A.T-rich oligonucleotides to crystallize as long helical stacks of duplexes.     

Water-mediated interactions in the CRP–cAMP–DNA complex: Does water mediate sequence-specific binding at the DNA primary-kink site?

The cyclic AMP receptor protein (CRP) of Escherichia coli binds preferentially to DNA sequences possessing a T:A base pair at position 6 (at which the DNA becomes kinked), but with which it does not form any direct interactions. It has been proposed that indirect readout is involved in CRP-DNA binding, in which specificity for this base pair is primarily related to sequence effects on the energetic susceptibility of the DNA to kink formation. In the current study, the possibility of contributions to indirect readout by water-mediated hydrogen bonding of CRP with the T:A base pair was investigated. A 1.0 ns molecular dynamics simulation of the CRP-cAMP-DNA complex in explicit solvent was performed, and assessed for water-mediated CRP-DNA hydrogen bonds; results were compared to several X-ray crystal structures of comparable complexes. While several water-mediated CRP-DNA hydrogen bonds were identified, none of these involved the T:A base pair at position 6. Therefore, the sequence specificity for this base pair is not likely enhanced by water-mediated hydrogen bonding with the CRP.     

Stepwise "click" chemistry for the template independent construction of a broad variety of cross-linked oligonucleotides: influence of linker length, position, and linking number on DNA duplex stability

Cross-linked DNA was constructed by a "stepwise click" reaction using a bis-azide. The reaction is performed in the absence of a template, and a monofunctionalized oligonucleotide bearing an azido-function is formed as intermediate. For this, an excess of the bis-azide has to be used compared to the alkynylated oligonucleotide. The cross-linking can be carried out with any alkynylated DNA having a terminal triple bond at any position of the oligonucleotide, independent of chain length or sequence with identical or nonidentical chains. Short and long linkers with terminal triple bonds were introduced in the 7-position of 8-aza-7-deaza-2'-deoxyguanosine (1 or 2), and the outcome of the "stepwise" click and the "bis-click" reaction was compared. The cross-linked DNAs form cross-linked duplexes when hybridized with single-stranded complementary oligonucleotides. The stability of these cross-linked duplexes is as high as respective individual duplexes when they were ligated at terminal positions with linkers of sufficient length. The stability decreases when the linkers are incorporated at central positions. The highest duplex stability was reached when two complementary cross-linked oligonucleotides were hybridized.     

Computational investigation of the role of hydration in nucleic acid structure and function

The results of the Monte Carlo Metropolis simulation of water structure and of the hydration of nucleic acid fragments, complementary base pairs and mispairs, base pair stacks, and duplex fragments have been summarized. Systematic investigations suggest some general conclusions: (1) the hydration shell structure of the major and minor grooves of the duplex depends significantly on DNA conformation (or stack configuration) and nucleotide sequence, while global hydration characteristics (average energy, the number of water–water and water–base H-bonds) are only slightly dependent on these factors, (2) hydration economy takes place in the B–A transition due to an increase of the number of water molecules forming hydrogen bonds with two or more atoms of bases (water bridging), and (3) the hydration of the duplex could contribute to nucleic acid functioning via water-bridged mispair formation and stabilization of specific conformations.     

Probing transient Hoogsteen hydrogen bonds in canonical duplex DNA using NMR relaxation dispersion and single-atom substitution

Nucleic acids transiently morph into alternative conformations that can be difficult to characterize at the atomic level by conventional methods because they exist for too little time and in too little abundance. We recently reported evidence for transient Hoogsteen (HG) base pairs in canonical B-DNA based on NMR carbon relaxation dispersion. While the carbon chemical shifts measured for the transient state were consistent with a syn orientation for the purine base, as expected for A(syn)?T(anti) and G(syn)?C(+)(anti) HG base pairing, HG type hydrogen bonding could only be inferred indirectly. Here, we develop two independent approaches for directly probing transient changes in N-H···N hydrogen bonds and apply them to the characterization of transient Hoogsteen type hydrogen bonds in canonical duplex DNA. The first approach takes advantage of the strong dependence of the imino nitrogen chemical shift on hydrogen bonding and involves measurement of R(1ρ) relaxation dispersion for the hydrogen-bond donor imino nitrogens in G and T residues. In the second approach, we assess the consequence of substituting the hydrogen-bond acceptor nitrogen (N7) with a carbon (C7H7) on both carbon and nitrogen relaxation dispersion data. Together, these data allow us to obtain direct evidence for transient Hoogsteen base pairs that are stabilized by N-H···N type hydrogen bonds in canonical duplex DNA. The methods introduced here greatly expand the utility of NMR in the structural characterization of transient states in nucleic acids.     

pH-independent triple-helix formation with 6-oxocytidine as cytidine analogue

The syntheses of six different phosphoramidite building blocks of 6-oxocytosine and 5-allyl-6-oxocytosine as analogues of N(3)-protonated cytosine are described. These compounds have been incorporated into oligonucleotides by standard solid-phase synthesis. Hybridization of 15-mer Hoogsteen strands with target 21-mer duplexes was investigated. Comparison of the triplex-forming abilities of the different building blocks revealed that: i) 5-allyl substitution has a negative influence on triplex stability, ii) a uniform backbone of the Hoogsteen strand stabilizes triplexes relative to mixed backbones; iii) RNA strands with 6-oxocytidine or 5-allyl-6-oxocytidine do not form a triple helix with the DNA target duplex, probably due to backbone torsional constraints; and (iv) a 15-mer DNA sequence with three isolated 2'-deoxy-6-oxocytidines has the highest T(m) of all cytidine analogues investigated in this study. CD experiments provided further evidence for the presence or absence of triplex structures. In the course of these temperature-dependent CD measurements we were able to detect duplex and triplex melting independent from each other at selected wavelengths. This methodology is especially interesting in cases where UV melting curves show only one transition owing to spectral overlap.     

Stabilization of a Bimolecular Triplex by 3′‐S‐Phosphorothiolate Modifications: An NMR and UV Thermal Melting Investigation

Triplexes formed from oligonucleic acids are key to a number of biological processes. They have attracted attention as molecular biology tools and as a result of their relevance in novel therapeutic strategies. The recognition properties of single‐stranded nucleic acids are also relevant in third‐strand binding. Thus, there has been considerable activity in generating such moieties, referred to as triplex forming oligonucleotides (TFOs). Triplexes, composed of Watson–Crick (W–C) base‐paired DNA duplexes and a Hoogsteen base‐paired RNA strand, are reported to be more thermodynamically stable than those in which the third strand is DNA. Consequently, synthetic efforts have been focused on developing TFOs with RNA‐like structural properties. Here, the structural and stability studies of such a TFO, composed of deoxynucleic acids, but with 3′‐S‐phosphorothiolate (3′‐SP) linkages at two sites is described. The modification results in an increase in triplex melting temperature as determined by UV absorption measurements. ¹H NMR analysis and structure generation for the (hairpin) duplex component and the native and modified triplexes revealed that the double helix is not significantly altered by the major groove binding of either TFO. However, the triplex involving the 3′‐SP modifications is more compact. The 3′‐SP modification was previously shown to stabilise G‐quadruplex and i‐motif structures and therefore is now proposed as a generic solution to stabilising multi‐stranded DNA structures.