Comparison of the binding stoichiometries of positively charged DNA-binding drugs using positive and negative ion electrospray ionization mass spectrometry

Positive and negative ion electrospray ionization (ESI) mass spectra of complexes of positively charged small molecules (distamycin, Hoechst 33258, [Ru(phen)2dpq]Cl2 and [Ru(phen)2dpqC]Cl2) have been compared. [Ru(phen)2dpq]Cl2 and [Ru(phen)2dpqC]Cl2 bind to DNA by intercalation. Negative ion ESI mass spectra of mixtures of [Ru(phen)2dpq]Cl2 or [Ru(phen)2dpqC]Cl2 with DNA showed ions from DNA-ligand complexes consistent with solution studies. In contrast, only ions from free DNA were present in positive ion ESI mass spectra of mixtures of [Ru(phen)2dpq]Cl2 or [Ru(phen)2dpqC]Cl2 with DNA, highlighting the need for obtaining ESI mass spectra of non-covalent complexes under a range of experimental conditions. Negative ion spectra of mixtures of the minor groove binder Hoechst 33258 with DNA containing a known minor groove binding sequence were dominated by ions from a 1:1 complex. In contrast, in positive ion spectra there were also ions present from a 2:1 (Hoechst 33258: DNA) complex, suggesting an alternative binding mode was possible either in solution or in the gas phase. When Hoechst 33258 was mixed with a DNA sequence lacking a high affinity minor groove binding site, the negative ion ESI mass spectra showed that 1:1 and 2:1 complexes were formed, consistent with existence of binding modes other than minor groove binding. The data presented suggest that comparison of positive and negative ion ESI-MS spectra might provide an insight into various binding modes in both solution and the gas phase.     

Stability analysis for double-stranded DNA oligomers and their noncovalent complexes with drugs by laser spray

Laser spray, which is a newly developed ionization technique, can characterize the stability of noncovalent complexes in the solution phase. By using this advantage, laser spray has been applied to probe the intrinsic stability of double-stranded DNA (dsDNA) sequences and their binding affinities with various drugs in the solution phase. Systematic experiments were carried out using six 16-mer and three 22-mer dsDNA oligomers, together with the complexes of the 16-mer dsDNA with minor groove binders: berenil, Hoechst 33342, DAPI, and netropsin. Dissociation curves for each dsDNA or each complex were plotted as a function of laser power. The laser power (E50%), where 50% of each dsDNA or each complex was dissociated, was compared with its melting temperature (Tm) determined by UV spectroscopy. Linear correlations between E50% and Tm were obtained not only for the dsDNA oligomers (correlation factor r = 0.9835) but also for the 16-mer dsDNA complexes with minor groove binders (r = 0.9966). In addition, laser spray has successfully clarified the binding affinities of a 16-mer dsDNA with two intercalators: daunomycin and nogalamycin. In the case of the dsDNA-daunomycin complex, by changing the molar ratio of dsDNA : drug from 1 : 1 to 1 : 5, the concentration-dependent stability of the complex was confirmed by laser spray. The present results demonstrate that laser spray mass spectrometry can be a powerful and convenient method to investigate the relative binding affinities of dsDNA-ligand complexes in the solution phase, which could be applied to the early stage of high-throughput screening of drugs targeting for dsDNA.     

A FLUORESCENCE STUDY OF THE BINDING OF HOECHST 33258 and DAPI TO HALOGENATED DNAs

We have studied the time-resolved and the steady-state fluorescence of the DNA groove binders 4',6-diamidino-2-phenylindole (DAPI) and Hoechst 33258 with the double stranded DNAs poly(dA-dU) and poly(dI-dC) and their halogenated analogs, poly(dA-I5dU) and poly(dI-Br5dC). These studies were prompted by earlier observations that steady-state fluorescence of Hoechst 33258 is quenched on binding to halogenated DNAs (presumably due to an intermolecular heavy atom effect involving the halogen atom in the major groove), and recent studies which clearly point to a binding-site in the minor groove of DNA. Measurements of the time resolved fluorescence decay demonstrate that the fluorescence of Hoechst 33258 is quenched on binding to the halogenated DNAs, in agreement with previous observations. However, quenching studies carried out using the free halogenated bases IdUrd and BrdCyd in solution yielded bimolecular rate constants more than one order of magnitude larger than those expected for an intermolecular heavy atom effect. Moreover, the quenching of the Hoechst 33258 fluorescence was accompanied by an accelerated photochemical destruction of Hoechst 33258. We therefore conclude that the fluorescence quenching observed with halogenated DNAs is probably due to a photochemical reaction involving Hoechst 33258, rather than direct contact of Hoechst 33258 with the halogen substituents in the major groove of the DNA. The fluorescence decay measurements however, do provide clear evidence for at least two different modes of binding. Taking into account the alternating sequences used in this study and the possibility of two different conformations for bound dye, at least four different modes of binding are plausible. Our present data do not allow us to distinguish between these alternatives. The time-resolved fluorescence decays and fluorescence quantum yields of DAPI are not affected by the presence of the heavy atom substituents in the DNA major groove. Based on this observation and earlier reports that DAPI binds in one of the DNA grooves, we conclude that the high affinity sites for DAPI on DNA are located in the minor groove.     

Influence of initial charge state on fragmentation patterns for noncovalent drug/DNA duplex complexes

The charge state-dependent dissociation of various DNA duplexes and drug/duplex complexes has been investigated using collisionally activated dissociation (CAD) in a quadrupole ion trap mass spectrometer (QIT-MS). Several non-self-complementary 14-residue oligonucleotides were employed, in addition to an array of known DNA-interactive ligands, including the intercalators daunomycin and nogalamycin, as well as the minor groove binding agents distamycin, netropsin, 4',6-diamidino-2-phenylindole, and Hoechst 33342. In general, the dissociation pathways exhibited by both the duplexes and the drug/duplex complexes were found to be markedly sensitive to initial charge state. Time- and activation voltage-independent duplex strand separation predominated for higher charge states, which was interpreted to be a result of internal Coulombic repulsion or partial unzipping in the interface, while time- and activation voltage-dependent covalent cleavage predominated for lower charge states. The identity of the drug and the sequence of the duplex were both found to affect the competition between different dissociation processes. The dissociation pathways for the lower charge state complexes are probably more reflective of specific drug-DNA interactions because Coulombic and/or conformational effects are less marked for these precursors.     

Nature of minor-groove binders-DNA complexes in the gas phase

The structure of noncovalent complexes of DNA duplex with minor groove binders (mG-binders) has been analyzed by state of the art molecular dynamics (MD) simulations. More than 3.3 micros of MD trajectories (including 4 x 0.5 micros trajectories) were collected for the Dickerson's dodecamer bound to DAPI, Hoechst 33258, and Netropsin. Comparison of these trajectories with control simulations in water allowed us to determine that the extreme dehydration and partial neutralization occurring during electrospray experiments does not produce the disruption of the DNA:mG-binder complexes or the dissociation of the two strands of the duplex. Irrespective of the drug and the simulation conditions the mG-binders remains bound to the DNA near the preferential binding position in aqueous conditions. Large distortions appear in the two DNA strands, which maintain however a memory of the original DNA duplex structure in water, and a general helical-like conformation.     

Label-free aptamer-based sensors for L-argininamide by using nucleic acid minor groove binding dyes

The nucleic acid minor groove binding dyes, DAPI and Hoechst 33258, were for the first time used in label-free aptamer-based sensors for L-argininamide. The synergy binding effect results in the enhancement of fluorescence of dyes. The method for detection of L-argininamide is simple, rapid and cost-effective.     

A simple, high-resolution method for establishing DNA binding affinity and sequence selectivity.

Full details of the development of a simple, nondestructive, and high-throughput method for establishing DNA binding affinity and sequence selectivity are described. The method is based on the loss of fluorescence derived from the displacement of ethidium bromide or thiazole orange from the DNA of interest or, in selected instances, the change in intrinsic fluorescence of a DNA binding agent itself and is applicable for assessing relative or absolute DNA binding affinities. Enlisting a library of hairpin deoxyoligonucleotides containing all five base pair (512 hairpins) or four base pair (136 hairpins) sequences displayed in a 96-well format, a compound's rank order binding to all possible sequences is generated, resulting in a high-resolution definition of its sequence selectivity using this fluorescent intercalator displacement (FID) assay. As such, the technique complements the use of footprinting or affinity cleavage for the establishment of DNA binding selectivity and provides the information at a higher resolution. The merged bar graphs generated by this rank order binding provide a qualitative way to compare, or profile, DNA binding affinity and selectivity. The 96-well format assay (512 hairpins) can be conducted at a minimal cost (presently ca. $100 for hairpin deoxyoligonucleotides/assay with ethiduim bromide or less with thiazole orange), with a rapid readout using a fluorescent plate reader (15 min), and is adaptable to automation (Tecan Genesis Workstation 100 robotic system). Its use in generating a profile of DNA binding selectivity for several agents including distamycin A, netropsin, DAPI, Hoechst 33258, and berenil is described. Techniques for establishing binding constants from quantitative titrations are compared, and recommendations are made for use of a Scatchard or curve fitting analysis of the titration binding curves as a reliable means to quantitate the binding affinity.     

Use of Capillary Electrophoresis in the Study of Interaction between dsDNA and Drug Molecules

The advantages of berberine such as the anticancer1, antiinflammatory2 and no side effects of camptothecin1, have promoted the research in the mechanism of berberine with macrobiomolecules. In general, three different points of view have been presented on…     

Combined pharmacophore-guided 3D-QSAR,molecular docking,and virtual screening on bis-benzimidazoles and ter-benzimidazoles as DNA–topoisomerase I poisons

Structural Chemistry - Certain DNA minor groove binders, especially bis-benzimdazole containing compounds, such as Hoechst 33258 and its derivatives, act as potent topoisomerase I inhibitors. The...     

Visualization of complexes of Hoechst 33258 and DNA duplexes in solution by atomic force microscopy

Tertiary structure changes in DNA duplexes, induced by Hoechst 33258 binding, have been examined by the use of atomic force microscopy. Besides minor groove binding, which is an established mode of binding for this drug, Hoechst 33258 has now been found to show another binding mode, which causes an unwinding of the duplex. When the drug concentration is as high as 0.5 microg/ml, the Hoechst 33258 molecule seems to function as a clamp for two DNA chains and forms a condensate. The condensate was found to have a toroidal shape. By surveying more than 100 microscopic images of such condensates formed in I microg/ml drug solution, a mechanism of toroidal condensate formation has been proposed.     

Characterization of noncovalent complexes formed between minor groove binding molecules and duplex DNA by electrospray ionization-mass spectrometry

The noncovalent complex formed in solution between minor groove binding molecules and an oligonucleotide duplex was investigated by electrospray ionization-mass spectrometry (ESI-MS). The oligonucleotide duplex formed between two sequence-specific 14-base pair oligonucleotides was observed intact by ESI-MS and in relatively high abundance compared to the individual single-stranded components. Only sequence-specific A:B duplexes were observed, with no evidence of random nonspecific aggregation (i.e., A:A or B:B) occurring under the conditions utilized. Due to the different molecular weights of the two 14-base pair oligonucleotides, unambiguous determination of each oligonucleotide and the sequence-specific duplex was confirmed through their detection at unique mass-to-charge ratios. The noncovalent complexes formed between the self-complementary 5′-dCGCAAATTTGCG-3′ oligonucleotide and three minor groove binding molecules (distamycin A, pentamidine, and Hoechst 33258) were also observed. Variation of several electrospray ionization interface parameters as well as collision-induced dissociation methods were utilized to characterize the nature and stability of the noncovalent complexes. The noncovalent complexes upon collisional activation dissociated into single-stranded oligonucleotides and single-stranded oligonucleotides associated with a minor groove binding molecule. ESI-MS shows potential for the study of small molecule-oligonucleotide duplex interactions and determination of small molecule binding stoichiometry.     

DNA-ligand binding mode discrimination by characterizing fluorescence resonance energy transfer through lifetime measurements with picosecond resolution

We describe a method for distinguishing between minor groove binders and base intercalators that is based on measurements of the fluorescence lifetime of a donor (D) in the presence of an acceptor (A). The D-A pair is separated by a short double helix DNA with which the ligands interact. By plotting the D fluorescence lifetime as a function of the ligand-to-base pair concentration ratio we find a clear signature that distinguishes between the two binding mechanisms: minor groove binding induces an asymptotic decrease of the D fluorescence lifetime, while intercalation gives a monotonically increasing lifetime and the appearance of an additional short lifetime. We assayed Quinacrine, Hoechst and 4'-6'diamidine-2-phenyl indole, which in control experiments performed on oligodeoxyribonucleotides (oligos) lacking the A are demonstrated not to interfere with the D fluorescence. The changes in fluorescence lifetimes measured in the case of dual-labeled oligos are thus caused by structural changes in the DNA that modify the D-A distance. The appearance of the short-lived transient in the fluorescence decay of Ds attached to dual-labeled oligos upon binding of an intercalator can be interpreted as denaturation.     

Design and synthesis of novel thiazole-containing cross-linked polyamides related to the antiviral antibiotic distamycin

A family of naturally occurring oligopeptides includes netropsin, distamycin, anthelvencin, kikumycin B, amidinomycin, and norformycin. Netropsin (I) and distamycin (II) express their biological activities by targeting specific sequences of chemical functionalities in the minor groove of DNA. Both netropsin and distamycin can be regarded as polyamide chains in which each alpha-carbon has been replaced by a five-membered pyrrole ring. The repeat distance in such an augmented polyamide chain is almost the same as the distance from one base pair to the next along the floor of a minor groove within beta-DNA. In this paper we report the synthesis of 16-21 cross-linked polyamides containing a thiazole heterocyclic ring bearing the active functionalites NH(2), NHCHO, or H. 16 and 17 were synthesized by DCC and HOBt catalyzed reaction of 5 with 14 and 15, while the formylation products 18 and 19 were obtained by coupling the formylated 4-methyl-thiazolated acid 6 with 14 and 15. The deaminated compounds 20 and 21 were obtained by the coupling of 5-trichloroacetyl-4-methylthiazole 7 synthesized from 4-methylthiazole. All the six cross-linked polyamides 16-21 were tested for their DNA gyrase inhibition. The studies have shown these polyamides have better sequence recognition and a greater percentage of inhibition than the corresponding monomers. The compound 17 shows complete inhibition of gyrase at 0.5 microM concentration as compared to the naturally occurring distamycin at 1.0 microM.     

Exploring the DNA binding mode of transition metal based biologically active compounds

Few novel 4-aminoantipyrine derived Schiff bases and their metal complexes were synthesized and characterized. Their structural features and other properties were deduced from the elemental analysis, magnetic susceptibility and molar conductivity as well as from mass, IR, UV-vis, (1)H NMR and EPR spectral studies. The binding of the complexes with CT-DNA was analyzed by electronic absorption spectroscopy, viscosity measurement, and cyclic voltammetry. The interaction of the metal complexes with DNA was also studied by molecular modeling with special reference to docking. The experimental and docking results revealed that the complexes have the ability of interaction with DNA of minor groove binding mode. The intrinsic binding constants (K(b)) of the complexes with CT-DNA were found out which show that they are minor groove binders. Gel electrophoresis assay demonstrated the ability of the complexes to cleave the pUC19 DNA in the presence of AH(2) (ascorbic acid). Moreover, the oxidative cleavage studies using distamycin revealed the minor groove binding for the newly synthesized 4-aminoantipyrine derived Schiff bases and their metal complexes. Evaluation of antibacterial activity of the complexes against Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Staphylococcus epidermidis, and Klebsiella pneumoniae exhibited that the complexes have potent biocidal activity than the free ligands.     

How and how much can Hoechst 33258 cause unwinding in a DNA duplex?

The effect of Hoechst 33258 binding on the geometry of a DNA duplex (plasmid pBR322) has been examined using topoisomerase II relaxation followed by gel electrophoresis. Of this drug-DNA system, fluorescence, optical absorption, and calorimetric measurements were also made at various drug and DNA concentrations and in the same buffer as that for the topoisomerase reaction. It has been confirmed that there are two modes of drug-DNA interaction. When the drug concentration is much lower than the DNA base pair concentration, the Hoechst 33258 molecule binds in the minor groove of the DNA duplex and occupies a site formed of five continuous base pair sequences that contain no G.C pair. Here, the equilibrium constant K1 is 1.8 x 10(7) M-1 (at 37 degrees C), and the enthalpy of binding delta H1 is -865 cal/mol. When the drug concentration is much higher, on the other hand, it shows another binding mode which is much weaker, so that K2 = 2.25 x 10(4) M-1 and delta H2 is -464 cal/mol, which gives fluorescence quenching, which has no base pair preference, and which causes an unwinding of the duplex by 1 degree.     

Molecular Recognition of DNA by Hoechst Benzimidazoles: Exploring Beyond the Pyrrole‐Imidazole‐Hydroxypyrrole Polyamide‐Pairing Code

A series of three‐ring analogs of the minor‐groove‐binding molecule Hoechst 33258 ( 1 ), consisting of benzimidazole (B), imidazopyridine (P), and hydroxybenzimidazole (H) monomers, have been synthesized in order to investigate both their sequence specificity and binding modes. MPE⋅Fe^II Footprinting has revealed the preference of both PBB and BBB ligands for 5′‐WGWWW‐3′ and 5′‐WCWWW‐3′ tracts, as well as A⋅T‐rich sequences. Affinity‐cleavage titrations show no evidence for a 2 : 1 binding mode of these Hoechst analogs. Importantly, all derivatives are oriented in one direction at each of their binding sites. The implications of these results for the design of minor‐groove‐binding small molecules is discussed.     

Dynamics in the DNA recognition by DAPI: exploration of the various binding modes

Two distinct modes of interaction of the fluorescent probe 4',6-diamidino-2-phenylindole (DAPI), depending on the sequence of DNA, have been reported in the literature. In the present study, the dynamics of solvation has been utilized to explore the binding interaction of DAPI to DNA oligomers of different sequences. Picosecond-resolved fluorescence and polarization-gated anisotropy have been used to characterize the binding of DAPI to the different oligomers. In the double-stranded dodecamer of sequence CGCGAATTCGCG (oligo1), the solvation relaxation dynamics of the probe reveals time constants of 0.130 ns (75%) and 2.35 ns (25%). Independent exploration of the minor-groove environment of oligo1 using another well-known minor-groove binder Hoechst 33258 (H258) shows similar timescales, further confirming minor-groove binding of DAPI to oligo1. In the double-stranded dodecamer (oligo2) having the sequence GCGCGCGCGCGC, where intercalation has been reported in the literature, no solvation is observed in our experimental window. DAPI bound to oligo2 shows quenching of fluorescence compared to that of DAPI in a buffer. The quenching of fluorescence of DAPI intercalated in DNA is also borne out by the appearance of a fast component of 30 ps in the fluorescence lifetime, revealing electron transfer to DAPI from GC base pairs, between which it intercalates. In addition to this, the excited-state lifetime of the probe in the DAPI-DNA complex also shows a time constant similar to that of the dye in a buffer, indicating that the excited-state photoprocesses associated with the free dye is also operative in this binding mode, consistent with the binding geometry of the DAPI in the DNA. The dynamics of DAPI in calf thymus DNA having a random sequence of base pairs is similar to that associated with the DNA minor groove. Our studies clearly explore the structure-dynamics correlation of the DAPI-DNA complex in the two distinct modes of interaction of DAPI with DNA.     

Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) tethering a Hoechst 33258 analogue: triplex and duplex stabilization by simultaneous minor groove binding

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.