共查询到20条相似文献,搜索用时 31 毫秒
1.
A dimeric neomycin-neomycin conjugate 3 with a flexible linker, 2,2'-(ethylenedioxy)bis(ethylamine), has been synthesized and characterized. Dimer 3 can selectively bind to AT-rich DNA duplexes with high affinity. Biophysical studies have been performed between 3 and different nucleic acids with varying base composition and conformation by using ITC (isothermal calorimetry), CD (circular dichroism), FID (fluorescent intercalator displacement), and UV (ultraviolet) thermal denaturation experiments. A few conclusions can be drawn from this study: (1) FID assay with 3 and polynucleotides demonstrates the preference of 3 toward AT-rich sequences over GC-rich sequences. (2) FID assay and UV thermal denaturation experiments show that 3 has a higher affinity for the poly(dA)·poly(dT) DNA duplex than for the poly(dA)·2poly(dT) DNA triplex. Contrary to neomycin, 3 destabilizes poly(dA)·2poly(dT) triplex but stabilizes poly(dA)·poly(dT) duplex, suggesting the major groove as the binding site. (3) UV thermal denaturation studies and ITC experiments show that 3 stabilizes continuous AT-tract DNA better than DNA duplexes with alternating AT bases. (4) CD and FID titration studies show a DNA binding site size of 10-12 base pairs/drug, depending upon the structure/sequence of the duplex for AT-rich DNA duplexes. (5) FID and ITC titration between 3 and an intramolecular DNA duplex [d(5'-A(12)-x-T(12)-3'), x = hexaethylene glycol linker] results in a binding stoichiometry of 1:1 with a binding constant ~10(8) M(-1) at 100 mM KCl. (6) FID assay using 3 and 512 hairpin DNA sequences that vary in their AT base content and placement also show a higher binding selectivity of 3 toward continuous AT-rich than toward DNA duplexes with alternate AT base pairs. (7) Salt-dependent studies indicate the formation of three ion pairs during binding of the DNA duplex d[5'-A(12)-x-T(12)-3'] and 3. (8) ITC-derived binding constants between 3 and DNA duplexes have the following order: AT continuous, d[5'-G(3)A(5)T(5)C(3)-3'] > AT alternate, d[5'-G(3)(AT)(5)C(3)-3'] > GC-rich d[5'-A(3)G(5)C(5)T(3)-3']. (9) 3 binds to the AT-tract-containing DNA duplex (B* DNA, d[5'-G(3)A(5)T(5)C(3)-3']) with 1 order of magnitude higher affinity than to a DNA duplex with alternating AT base pairs (B DNA, d[5'-G(3)(AT)(5)C(3)-3']) and with almost 3 orders of magnitude higher affinity than a GC-rich DNA (A-form, d[5'-A(3)G(5)C(5)T(3)-3']). 相似文献
2.
The syntheses of six different phosphoramidite building blocks of 6-oxocytosine and 5-allyl-6-oxocytosine as analogues of N(3)-protonated cytosine are described. These compounds have been incorporated into oligonucleotides by standard solid-phase synthesis. Hybridization of 15-mer Hoogsteen strands with target 21-mer duplexes was investigated. Comparison of the triplex-forming abilities of the different building blocks revealed that: i) 5-allyl substitution has a negative influence on triplex stability, ii) a uniform backbone of the Hoogsteen strand stabilizes triplexes relative to mixed backbones; iii) RNA strands with 6-oxocytidine or 5-allyl-6-oxocytidine do not form a triple helix with the DNA target duplex, probably due to backbone torsional constraints; and (iv) a 15-mer DNA sequence with three isolated 2'-deoxy-6-oxocytidines has the highest T(m) of all cytidine analogues investigated in this study. CD experiments provided further evidence for the presence or absence of triplex structures. In the course of these temperature-dependent CD measurements we were able to detect duplex and triplex melting independent from each other at selected wavelengths. This methodology is especially interesting in cases where UV melting curves show only one transition owing to spectral overlap. 相似文献
3.
Mazzitelli CL Chu Y Reczek JJ Iverson BL Brodbelt JS 《Journal of the American Society for Mass Spectrometry》2007,18(2):311-321
The DNA binding of novel threading bis-intercalators V1, trans-D1, and cis-C1, which contain two naphthalene diimide (NDI) intercalation units connected by a scaffold, was evaluated using electrospray ionization mass spectrometry (ESI-MS) and DNAse footprinting techniques. ESI-MS experiments confirmed that V1, the ligand containing the -Gly3-Lys- peptide scaffold, binds to a DNA duplex containing the 5'-GGTACC-3' specific binding site identified in previous NMR-based studies. The ligand formed complexes with a ligand/DNA binding stoichiometry of 1:1, even when there was excess ligand in solution. Trans-D1 and cis-C1 are new ligands containing a rigid spiro-tricyclic scaffold in the trans- and cis- orientations, respectively. Preliminary DNAse footprinting experiments identified possible specific binding sites of 5'-CAGTGA-5' for trans-D1 and 5'-GGTACC-3' for cis-C1. ESI-MS experiments revealed that both ligands bound to DNA duplexes containing the respective specific binding sequences, with cis-C1 exhibiting the most extensive binding based on a higher fraction of bound DNA value. Cis-C1 formed complexes with a dominant 1:1 binding stoichiometry, whereas trans-D1 was able to form 2:1 complexes at ligand/DNA molar ratios >or=1 which is suggestive of nonspecific binding. Collisional activated dissociation (CAD) experiments indicate that DNA complexes containing V1, trans-D1, and cis-C1 have a unique fragmentation pathway, which was also observed for complexes containing the commercially available bis-intercalator echinomycin, as a result of similar binding interactions, marked by intercalation in addition to hydrogen bonding by the scaffold with the DNA major or minor groove. 相似文献
4.
K Nakatani S Sando H Kumasawa J Kikuchi I Saito 《Journal of the American Chemical Society》2001,123(50):12650-12657
Dimeric 2-amino-1,8-naphthyridine selectively binds to a G-G mismatch with high affinity (K(d) = 53 nM). We have investigated a binding mechanism of naphthyridine dimer 2 to a G-G mismatch by spectroscopic studies, thermodynamic analysis, and structure-activity studies for the thermal stabilization of the mismatch. 1H NMR spectra of a complex of 2 with 9-mer duplex d(CATCGGATG)2 containing a G-G mismatch showed that all hydrogens in two naphthyridine rings of 2 were observed upfield compared to those of 2 in a free state. The 2D-NOESY experiments showed that each naphthyridine of 2 binds to a guanine in the G-G mismatch within the pi-stack. In CD spectra, a large conformational change of the G-G mismatch-containing duplex was observed upon complex formation with 2. Isothermal calorimetry titration of 2 binding to the G-G mismatch showed that the stoichiometry for the binding is about 1:1 and that the binding is enthalpy-controlled. It is clarified by structure-activity studies that show (i) the linker connecting two naphthyridine rings was essential for the stabilization of the G-G mismatch, (ii) the binding efficiency was very sensitive to the linker structure, and (iii) the binding of two naphthyridines to each one of two Gs in the G-G mismatch is essential for a strong stabilization. These results strongly supported the intercalation of both naphthyridine rings of 2 into DNA base pairs and the formation of a hydrogen bonded complex with the G-G mismatch. 相似文献
5.
Nakatani K Hagihara S Sando S Sakamoto S Yamaguchi K Maesawa C Saito I 《Journal of the American Chemical Society》2003,125(3):662-666
The binding of a dimeric form of the 2-amino-1,8-naphthyridine derivative (naphthyridine dimer) to a human telomeric sequence, TTAGGG, was investigated by UV melting, CD spectra, and CSI-MS measurements. Both the 9-mer d(TTAGGGTTA) and the 15-mer d(TTAGGGTTAGGGTTA) showed apparent melting temperatures (T(m)) of 45.6 and 63.6 degrees C, respectively, in the presence of naphthyridine dimer (30 microM) in sodium cacodylate buffer (50 mM, pH 7.0) containing 100 mM NaCl. The CD spectra at 235 and 255 nm of the 9-mer increased in intensity accompanied with strong induced CDs at 285 and 340 nm upon complex formation with naphthyridine dimer. UV titration of the binding of naphthyridine dimer to the 9-mer at 320 nm showed a hypochromism of the spectra. A Scatchard plot of the data showed the presence of multiple binding sites with different association constants. Cold spray ionization mass spectrometry of the complex between naphthyridine dimer and the 9-mer clearly showed that one to three molecules of the ligand bound to the dimer duplex of the 9-mer. Telomeric repeat elongation assay showed that the binding of naphthyridine dimer to the telomeric sequence inhibits the elongation of the sequence by telomerase. 相似文献
6.
Cyclobutylpyrimidine dimers (CPDs) are the major UV photoproduct formed in DNA containing adjacent pyrimidines. These lesions can be repaired by DNA photolyase, a flavoprotein that utilizes blue light in a direct reversal of the cyclobutane ring. Previous studies have shown that the CPD is base flipped into the protein, with concomitant disruption of the substrate around the CPD. In this study, we use a fluorescent cytidine analog, pyrrolo-dC (PC), to probe how far base flipping propagates along the duplex. From these measurements, the degree of base destacking in the two bases flanking the adenines opposing the CPD appears to be minimal, which was consistent with the protein:substrate crystal structure. Fluorescence-detected melting temperatures for duplexes with and without a CPD were obtained, suggesting that a 5'-pyrimidine-PC-purine-3' motif is more stable than the 5'-purine-PC-pyrimidine-3' motif. This stability trend was reflected in the fluorescence intensities of ss-PC oligos but not for duplexes. The melting point depression due to the PC probe was found to be comparable to other popular fluorescent base analogs. 相似文献
7.
The structure of LNA:DNA hybrids from molecular dynamics simulations: the effect of locked nucleotides 总被引:1,自引:0,他引:1
Locked nucleic acids (LNAs) exhibit a modified sugar fragment that is restrained to the C3'-endo conformation. LNA-containing duplexes are rather stable and have a more rigid structure than DNA duplexes, with a propensity for A-conformation of the double helix. To gain detailed insight into the local structure of LNA-modified DNA oligomers (as a foundation for subsequent exploration of the electron-transfer capabilities of such modified duplexes), we carried out molecular dynamics simulations on a set of LNA:DNA 9-mer duplexes and analyzed the resulting structures in terms of base step parameters and the conformations of the sugar residues. The perturbation introduced by a single locked nucleotide was found to be fairly localized, extending mostly to the first neighboring base pairs; such duplexes featured a B-type helix. With increasing degree of LNA modification the structure gradually changed; the duplex with one complete LNA strand assumed a typical A-DNA structure. The relative populations of the sugar conformations agreed very well with NMR data, lending credibility to the validity of the computational protocol. 相似文献
8.
L G Marzilli J S Saad Z Kuklenyik K A Keating Y Xu 《Journal of the American Chemical Society》2001,123(12):2764-2770
DNA bases in the three-base-pair (3bp) region of duplexes with the two major lesions of cisplatin (cis-PtCl(2)(NH(3))(2)) with DNA, namely d(XGG) and d(XAG) ( = N7-platinated base), differ in their relative positions by as much as approximately 3.5 A in structures in the literature. Such large differences impede drug design and assessments of the effects of protein binding on DNA structure. One recent and several past structures based on NMR-restrained molecular dynamics (RMD) differ significantly from the reported X-ray structure of an HMG-bound XGG 16-mer DNA duplex (Ohndorf, U.-M.; Rould, M. A.; He, Q.; Pabo, C. O.; Lippard, S. J. Nature 1999, 399, 708). This 16-mer structure has several significant novel and unique features (e.g., a bp step with large positive shift and slide). Hypothesizing that novel structural features in the XGG or XAG region of duplexes elude discovery by NMR methods (especially because of the flexible nature of the 3bp region), we studied an oligomer with only G.C bp's in the XGGY site by NMR methods for the first time. This 9-mer gave a 5'-G N1H signal with a normal shift and intensity and showed clear NOE cross-peaks to C NHb and NHe. We assigned for the first time (13)C NMR signals of a duplex with a GG lesion. These data, by adding NMR-based criteria to those inherent in NOESY and COSY data, have more specifically defined the structural features that should be present in an acceptable model. In particular, our data indicated that the sugar of the X residue has an N pucker and that the GG cross-link should have a structure similar to the original X-ray structure of cis-Pt(NH(3))(2)(d(pGpG)) (Sherman S. E.; Gibson, D.; Wang, A. H.-J.; Lippard, S. J. J. Am. Chem. Soc. 1988, 110, 7368). With these restrictions added to NOE restraints, an acceptable model was obtained only when we started our modeling with the 16-mer structural features. The new X-ray/NMR-based model accounted for the NOESY data better than NOE-based models, was very similar in structure to the 16-mer, and differed from solely NOE-based models. We conclude that all XGG and XAG (X = C or T) duplexes undoubtedly have structures similar to those of the 16-mer and our model. Thus, protein binding does not change greatly the structure of the 3bp region. The structure of this region can now be used in understanding structure-activity relationships needed in the design of new carrier ligands for improving Pt anticancer drug activity. 相似文献
9.
An L-DNA, the mirror-image isomer of natural DNA, has extraordinary nuclease resistance, and thus the molecules should be promising reagents for many applications, such as antisense technology. However, little is known about the structural and thermodynamic properties of DNAs with this modified nucleotide. In this study, we prepared the L-nucleotide (L-dA) and introduced it into oligodeoxyribonucleotides to assess the ability of the L-nucleotide as a functional molecule for many applications based on the DNA hybridization. Two decamers with an L-dA at the center were synthesized and duplexes with the complementary DNA strand were applied to structural and thermodynamic analyses. The structural study by CD spectra showed that the structures of both modified "L/D-D" duplexes were the typical B-form. This result suggests that the global structure of DNA was not collapsed by the introduction of an L-DNA. Thermodynamic parameters (deltaH degrees, deltaS degrees, and deltaG degrees 37) of the duplex formation, determined by UV melting experiments, indicated that the both duplexes were destabilized at about 2.5 to 3.0 kcal mol(-1) by the introduced L-dA, mainly due to an unfavorable enthalpic effect. In conjunction with information by other researchers, these results suggest that the L-DNA affect on the duplex structure and the stability vary locally; thus, the thermodynamic stability of modified L/D-D duplexes should be predictable by the nearest-neighbor thermodynamic parameters. 相似文献
10.
Lin PH Chen RH Lee CH Chang Y Chen CS Chen WY 《Colloids and surfaces. B, Biointerfaces》2011,88(2):552-558
Thrombin, a multifunctional serine protease, has both procoagulant and anticoagulant functions in human blood. Thrombin has two electropositive exosites. One is the fibrinogen-binding site and the other is the heparin-binding site. Over the past decade, two thrombin-binding aptamers (15-mer and 29-mer) were reported by SELEX technique. Recently, many studies examined the interactions between the 15-mer aptamer and thrombin extensively, but the data on the difference of these two aptamers binding to thrombin are still lacking and worth investigating for fundamental understanding. In the present study, we combined conformational data from circular dichroism (CD), kinetics and thermodynamics information from surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) to compare the binding mechanism between the two aptamers with thrombin. Special attentions were paid to the formation of G-quadruplex and the effects of ions on the aptamer conformation on the binding and the kinetics discrimination between specific and nonspecific interactions of the binding. The results indicated reasonably that the 15-mer aptamer bound to fibrinogen-binding site of thrombin using a G-quadruplex structure and was dominated by electrostatic interactions, while the 29-mer aptamer bound to heparin-binding site thrombin using a duplex structure and was driven mainly by hydrophobic effects. 相似文献
11.
Barbieri CM Li TK Guo S Wang G Shallop AJ Pan W Yang G Gaffney BL Jones RA Pilch DS 《Journal of the American Chemical Society》2003,125(21):6469-6477
Spectroscopic and calorimetric techniques were employed to characterize and contrast the binding of the aminoglycoside paromomycin to three octamer nucleic acid duplexes of identical sequence but different strand composition (a DNA.RNA hybrid duplex and the corresponding DNA.DNA and RNA.RNA duplexes). In addition, the impact of paromomycin binding on both RNase H- and RNase A-mediated cleavage of the RNA strand in the DNA.RNA duplex was also determined. Our results reveal the following significant features: (i) Paromomycin binding enhances the thermal stabilities of the RNA.RNA and DNA.RNA duplexes to similar extents, with this thermal enhancement being substantially greater in magnitude than that of the DNA.DNA duplex. (ii) Paromomycin binding to the DNA.RNA hybrid duplex induces CD changes consistent with a shift from an A-like to a more canonical A-conformation. (iii) Paromomycin binding to all three octamer duplexes is linked to the uptake of a similar number of protons, with the magnitude of this number being dependent on pH. (iv) The affinity of paromomycin for the three host duplexes follows the hierarchy, RNA.RNA > DNA.RNA > DNA.DNA. (v) The observed affinity of paromomycin for the RNA.RNA and DNA.RNA duplexes decreases with increasing pH. (vi) The binding of paromomycin to the DNA.RNA hybrid duplex inhibits both RNase H- and RNase A-mediated cleavage of the RNA strand. We discuss the implications of our combined results with regard to the specific targeting of DNA.RNA hybrid duplex domains and potential antiretroviral applications. 相似文献
12.
Ahn DR Egger A Lehmann C Pitsch S Leumann CJ 《Chemistry (Weinheim an der Bergstrasse, Germany)》2002,8(23):5312-5322
The design, synthesis, and base-pairing properties of bicyclo[3.2.1]amide-DNA (bca-DNA), a novel phosphodiester-based DNA analogue, are reported. This analogue consists of a conformationally constrained backbone entity, which emulates a B-DNA geometry, to which the nucleo-bases were attached through an extended, acyclic amide linker. Homobasic adenine-containing bca decamers form duplexes with complementary oligonucleotides containing bca, DNA, RNA, and, surprisingly, also L-RNA backbones. UV and CD spectroscopic investigations revealed the duplexes with D- or L-complements to be of similar stability and enantiomorphic in structure. Bca oligonucleotides that contain all four bases form strictly antiparallel, left-handed complementary duplexes with themselves and with complementary DNA, but not with RNA. Base-mismatch discrimination is comparable to that of DNA, while the overall thermal stabilities of bca-oligonucleotide duplexes are inferior to those of DNA or RNA. A detailed molecular modeling study of left- and right-handed bca-DNA-containing duplexes showed only minor changes in the backbone structure and revealed a structural switch around the base-linker unit to be responsible for the generation of enantiomorphic duplex structures. The obtained data are discussed with respect to the structural and energetic role of the ribofuranose entities in DNA and RNA association. 相似文献
13.
Abstract— Following UV irradiation at 254 nm and treatment with hot piperidine, single-stranded 49-mer and 12-mer oligodeoxyribonucleotides have been shown by gel-sequencing experiments to contain a prominent alkali-labile cleavage site that maps to adenine in the sequence element 5'-TTGATC-3'. This behavior is abolished by single base substitutions within the photoreactive tract and does not occur with duplex DNA. The distinctive properties of the photolesion are consistent with the formation of an abasic site through initial loss of a photomodified adenine base of unknown structure. The presence of an abasic site is supported by the observations that the alkaline cleavage fragments are terminally phosphorylated and that strand scission can also be effected by spermidine and the tripeptide Lys-Trp-Lys. 相似文献
14.
Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH. 相似文献
15.
Gidden J Ferzoco A Baker ES Bowers MT 《Journal of the American Chemical Society》2004,126(46):15132-15140
The gas-phase conformations of a series of cytosine/guanine DNA duplexes were examined by ion mobility and molecular dynamics methods. Deprotonated duplex ions were formed by electrospray ionization, and their collision cross sections measured in helium were compared to calculated cross sections of theoretical models generated by molecular dynamics. The 4-mer (dCGCG) and 6-mer (dCGCGCG) duplexes were found to have globular conformations. Globular and helical structures were observed for the 8-mer (dCGCGCGCG) duplex, with the globular form being the more favored conformer. For the 10-mer (dCGCGCGCGCG), 14-mer (dCGCGCGCGCGCGCG), and 18-mer (dCGCGCGCGCGCGCGCGCG) duplexes, only helical structures were observed in the ion mobility measurements. Theory predicts that the helical structures are less stable than the globular forms in the gas phase and should collapse into the globular form given enough time. However, molecular dynamics simulations at 300 K indicate the helical structures are stable in aqueous solution and will retain their conformations for a limited time in the gas phase. The presence of helical structures in the ion mobility experiments indicates that the duplexes retain "solution structures" in the gas phase on the millisecond time scale. 相似文献
16.
The complex of a minor groove binding drug mithramycin (MTR) and the self-complementary d(TAGCTAGCTA) 10-mer duplex was investigated by molecular dynamics (MD) simulations using the AMBER 7.0 suite of programs. There is one disaccharide and trisaccharide segment projecting from opposite ends of an aglycone chromophore of MTR. A MTR dimer complex (MTR)2Mg2+ is formed in the presence of a coordinated ion Mg2+. A NMR solution structure of two (MTR)2Mg2+ complexes bound with one DNA duplex, namely, the 2:1 duplex complex, was taken as the starting structure for the MD simulation. The partial charge on each atom was calculated using the multiple-RESP fitting procedure, and all of the missing parameters in the Parm99 force field used were adapted comparably from the literature. The length of the MD simulation was 5 ns, and the binding free energy for the formation of a 1:1 or 2:1 duplex complex was determined from the last 4 ns of the simulation. The binding free energies were decomposed to components of the contributions from different energy types, and the changes in the helical parameters of the bound DNA duplex plus the glycosidic linkages between sugar residues of the bound MTR dimer were determined. It was found that binding of the first (MTR)2Mg2+ complex with the DNA duplex to form a 1:1 duplex complex does not cause stiffening of the duplex especially in the unoccupied site of the duplex. However, the overall flexibility of the DNA duplex is reduced substantially once the second (MTR)2Mg2+ complex is bound with the unoccupied site to form the 2:1 duplex complex. The van der Waals interactions were found to be dominant in the central part of the DNA duplex where sugar residues from each bound (MTR)2Mg2+ complex were inwardly pointing and the corresponding minor groove was widened. 相似文献
17.
ULTRAVIOLET LIGHT IRRADIATION OF DEFINED-SEQUENCE DNA UNDER CONDITIONS OF CHEMICAL PHOTOSENSITIZATION 总被引:3,自引:0,他引:3
Marc E. Umlas William A. Franklin Gerald L. Chan William A. Haseltine 《Photochemistry and photobiology》1985,42(3):265-273
Abstract— The formation of cyclobutane pyrimidine dimers and UV light-induced (6-4) products was examined under conditions of triplet state photosensitization. DNA fragments of defined sequence were irradiated with 313 nm light in the presence of either acetone qr silver ion. UV irradiation in the presence of both silver ion and acetone enhanced the formation of TT cyclobutane dimers, yet no (6-4) photoproducts were formed at appreciable levels. When photoproduct formation was also measured in pyrimidine dinucleotides, only cyclobutane dimers were formed when the dinucleotides were exposed to 313 nm light in the presence of photosensitizer. The relative distribution of each type of cyclobutane dimer formed was compared for DNA fragments that were irradiated with 254, 313, or 313 nm UV light in the presence of acetone. The dimer distribution for DNA irradiated with 254 and 313 nm UV light were very similar, whereas the distribution for DNA irradiated with 313 nm light in the presence of acetone favored TT dimers. Alkaline labile lesions at guanine sites were also seen when DNA was irradiated with 313 nm light in the presence of acetone. 相似文献
18.
Nielsen KM Petersen M Håkansson AE Wengel J Jacobsen JP 《Chemistry (Weinheim an der Bergstrasse, Germany)》2002,8(13):3001-3009
We have used NMR and CD spectroscopy to study and characterise two alpha-L-LNA:DNA duplexes, a nonamer that incorporates three alpha-L-LNA nucleotides and a decamer that incorporates four alpha-L-LNA nucleotides, in which alpha-L-LNA is alpha-L-ribo-configured locked nucleic acid. Both duplexes adopt right-handed helical conformations and form normal Watson-Crick base pairing with all nucleobases in the anti conformation. Deoxyribose conformations were determined from measurements of scalar coupling constants in the sugar rings, and for the decamer duplex, distance information was derived from 1H-1H NOE measurements. In general, the deoxyriboses in both of the alpha-L-LNA:DNA duplexes adopt S-type (B-type structure) sugar puckers, that is the inclusion of the modified alpha-L-LNA nucleotides does not perturb the local native B-like double-stranded DNA (dsDNA) structure. The CD spectra of the duplexes confirm these findings, as these display B-type characteristic features that allow us to characterise the overall duplex type as B-like. The 1H-1H NOE distances which were determined for the decamer duplex were employed in a simulated annealing protocol to generate a model structure for this duplex, thus allowing a more detailed inspection of the impact of the alpha-L-ribo-configured nucleotides. In this structure, it is evident that the malleable DNA backbone rearranges in the vicinity of the modified nucleotides in order to accommodate them and present their nucleobases in a geometry suitable for Watson-Crick base pairing. 相似文献
19.
Oligothymidine methylphosphonates derivatized at the 5′-end with 4′-aminoalkyl-4,5′,8-trimethylpsoralen (AMT) were prepared. The interaction of these oligonucleoside methylphosphonates with double-stranded DNA was studied. Oligothymidine tnethylphosphonates, T7 and T14, were found to form triple helix with an oligodeoxyribonucleotide 45-mer DNA duplex which contains an A15-T15 sequence. Upon irradiation with 365 nm (UV light, AMT crosslinked to accessible thymidine residues in the target DNA. Both AMT-derivatized T7 and T14 crosslink to the T15 containing strand of the double-stranded DNA target, but they do not crosslink to the A15 containing strand which also contains a potential thymidine crosslinking site. Methylphosphonate oligomer, T7, was derivatized with AMT using either an ethyl-, butyl- or hexyl-linker. The efficiency of crosslinking is affected by the length of the aminoalkyl linker arm connecting the AMT to the methylphosphonate oligomer. The relative crosslinking efficiencies of the oligomers with these three types of linkers were different. Greatest crosslinking, 45%, was obtained using an oligomer having a butyl-or a hexyl-linker. The interaction of oligothymidine methylphosphonates with DNA can be enhanced by using two shorter AMT-oligomers instead of using one full-length AMT-derivatized oligomer. This strategy was demonstrated by the interaction of AMT-derivatized T7 with duplex DNA 35-mer and 45-mer target. The extent of crosslinking to the 45-mer target, whose binding site can accommodate two molecules of AMT-derivatized T7, is 45% whereas that with the 35-mer target, which can accommodate only one T7 molecule, is only 3%. The results of our experiments suggest that AMT-derivatized oligothymidine methylphosphonates can form triple-stranded complex and psoralen photoadduct with DNA. The formation of such complexes may be useful in probing and controlling gene expression at the DNA level. 相似文献
20.
Clever GH Söltl Y Burks H Spahl W Carell T 《Chemistry (Weinheim an der Bergstrasse, Germany)》2006,12(34):8708-8718
Two isomeric salicylic aldehyde nucleobases have been prepared and incorporated into various DNA duplexes. Reaction with ethylenediamine leads to formation of the well-known salen ligand inside the DNA double helix. Addition of transition-metal ions such as Cu(2+), Mn(2+), Ni(2+), Fe(2+), or VO(2+) results in the formation of metal-salen-base-pair complexes, which were studied by using UV and circular dichroism (CD) spectroscopy. HPLC and ESI mass spectrometric measurements reveal an unusually high stability of the DNA-metal system. These metal-salen complexes act as interstrand cross-links and thereby lead to a strong stabilization of the DNA duplexes, as studied by thermal de- and renaturing experiments. Complex formation is strong enough to override sequence information even when the preorganization of the ligand precursors is unfavorable and the DNA duplex is distorted by the metal complexation. Furthermore, melting-point studies show that the salen complex derived from ligand 2 fits better into the DNA duplex, in accordance with results obtained from the crystal structure of the corresponding copper-salen complex 8. 相似文献