Dynamics of tRNAtyr Probed with Long-Lifetime Metal-Ligand Complexes

The metal-ligand complexes, [Ru(bpy)₂(dppz)]²⁺ (bpy = 2,2??-bipyridine, dppz = dipyrido[3,2-a:2??,3??-c]phenazine) (RuBD) and [Ru(phen)₂(dppz)]²⁺ (phen = 1,10-phenanthroline) (RuPD), display favorable photophysical properties including long lifetime, polarized emission, and very little background fluorescence. To check if RuBD and RuPD reflect the overall rotational mobility of small nucleic acid, we measured the intensity and anisotropy decays of RuBD and RuPD when intercalated into tRNA^tyr using pBC SK(+) phagemid as a control. We used frequency-domain fluorometry with a blue light-emitting diode (LED) as the modulated light source. We observed shorter lifetimes for tRNA^tyr than those for the pBC SK(+) phagemid for both probes, however, RuPD showed much larger decrease in the mean lifetime values (64%). The slow rotational correlation time of RuBD (31.3 ns) and the fast rotational correlation time of RuPD (26.0 ns) reflected the overall rotational mobility of tRNA^tyr. In addition, the steady-state anisotropy and time-resolved anisotropy decay data showed a clear difference between tRNA^tyr and pBC SK(+) phagemid. This suggests the possibility of a homogeneous assay for identifying target nucleic acids and/or nucleic acid binding proteins.     

Fluorescent Carbon Dots Capped with PEG<Subscript>200</Subscript> and Mercaptosuccinic Acid

The synthesis and functionalization of carbon nanoparticles with PEG₂₀₀ and mercaptosuccinic acid, rendering fluorescent carbon dots, is described. Fluorescent carbon dots (maximum excitation and emission at 320 and 430 nm, respectively) with average dimension 267 nm were obtained. The lifetime decay of the functionalized carbon dots is complex and a three component decay time model originated a good fit with the following lifetimes: τ ₁ = 2.71 ns; τ ₂ = 7.36 ns; τ ₃ = 0.38 ns. The fluorescence intensity of the carbon dots is affected by the solvent, pH (apparent pK _a of 7.4 ± 0.2) and iodide (Stern-Volmer constant of 78 ± 2 M⁻¹).     

Structure and Luminescence Properties of Monomeric and Dimeric Re(I) Complexes with Dicarboxylic Acid-2,2′-Bipyridine Ligands

The luminescence properties of Re(I) complexes incorporating the dcbpy ligand (dcbpy = n,n′-dicarboxylic acid-2,2′-bipyridine; n = 3, 4) were investigated as well as their utility as Pb²⁺ sensors. An unusual binuclear complex of the 3,3′- species was isolated. The emission intensity and lifetime for all complexes were found to be highly temperature-dependent, with quantum yields and lifetimes dramatically greater at 77 K than at room temperature. The monomeric 3,3′-dcbpy Re(I) complex demonstrates nearly 1:1 binding with Pb²⁺. The effect of this lead binding on the emission intensity is great, but the low quantum yields allow only for detection of the metal at the micromolar level. The binding of Pb²⁺ to the 4,4′-dcbpy complex is modeled and the interaction is demonstrated to involve two binding sites.     

Luminescence and anisotropy decays ofN-3-pyrene maleimide labeling IgG proteins and cells

The Py.M (N-3-Pyrene Maleimide) is a dye that covalently binds to reactive amino or sulfhycryl groups to give highly fluorescent protein conjugates. Measurements of luminescence lifetimes and anisotropy decays have been performed with a Phase and Modulation Fluorometer. Complexes of Py.M-antibody (IgG antimouse) and tumoral cells C6 labeled with Py.M have been investigated. The Py.M fluorescence in buffer solution and the protein and cells natural fluorescence have been checked. For Py.M-IgG and labeled cells, the fluorescence decays present interesting behaviours. The least-squares analysis of the experimental results on Py.M-IgG complex points out two lorentzian distributions centered at 74 ns and 11 ns, on the contrary, for the labeled cells, a discrete component at 100 ns and a lorentzian distribution centered at 5 ns are shown. In both systems a weak component lower than 1 ns is observed. The fluorescence decays, mainly the long lifetime one, are very sensitive to oxygen quenching, showing the high efficiency of O₂ quenching. For samples N₂ bubbled, the lifetime experimental resuits show a decrease of the oxygen accessibility from free probe in solution to Py.M-IgG complex and to labeled cells, compatible with a more compact packing of the probe binding site. The experimental results of anisotropy decays of degassed samples show for Py.M-IgG complexes a long rotation correlation time of about 200 ns at T=5°C, assigned to overall rotation of the protein, besides shorter correlation times attributable to inner protein motions. For labeled cells, the long rotation correlation time becomes of the order of 580 ns confirming a progressive increase of the stabilization of the binding site.     

Domain Formation in DODAB–Cholesterol Mixed Systems Monitored via Nile Red Anisotropy

The effect of the cholesterol (ch) on liposomes composed of the cationic lipid dioctadecyldimethylammonium bromide (DODAB) was assessed by studying both the steady-state and time-resolved fluorescence anisotropy of the dye Nile Red. The information obtained combined with analysis of the steady-state emission and fluorescence lifetime of Nile Red (NR) for different cholesterol concentrations (5–50%) elucidated the presence of “condensed complexes” and cholesterol-rich domains in these mixed systems. The steady-state fluorescence spectra were decomposed into the sum of two lognormal emissions, emanating from two different states, and the effect of temperature on the anisotropy decay of Nile Red for different cholesterol concentrations was observed. At room temperature, the time-resolved anisotropy decays are indicative of NR being relatively immobile (manifest by a high r _∞ value). At higher temperature, rotational times ca. 1 ns were obtained throughout and a trend in increasing hindrance was seen with increase of Ch content.     

Fluorescent Properties of a Hybrid Cadmium Sulfide-Dendrimer Nanocomposite and its Quenching with Nitromethane

A fluorescent hybrid cadmium sulphide quantum dots (QDs) dendrimer nanocomposite (DAB-CdS) synthesised in water and stable in aqueous solution is described. The dendrimer, DAB-G5 dendrimer (polypropylenimine tetrahexacontaamine) generation 5, a diaminobutene core with 64 amine terminal primary groups. The maximum of the excitation and emission spectra, Stokes’ shift and the emission full width of half maximum of this nanocomposite are, respectively: 351, 535, 204 and 212 nm. The fluorescence time decay was complex and a four component decay time model originated a good fit (χ = 1.20) with the following lifetimes: τ ₁ = 657 ps; τ ₂ = 10.0 ns; τ ₃ = 59.42 ns; and τ ₄ = 265 ns. The fluorescence intensity of the nanocomposite is markedly quenched by the presence of nitromethane with a dynamic Stern-Volmer constant of 25 M⁻¹. The quenching profiles show that about 81% of the CdS QDs are located in the external layer of the dendrimer accessible to the quencher. PARAFAC analysis of the excitation emission matrices (EEM) acquired as function of the nitromethane concentration showed a trilinear data structure with only one linearly independent component describing the quenching which allows robust estimation of the excitation and emission spectra and of the quenching profiles. This water soluble and fluorescent nanocomposite shows a set of favourable properties to its use in sensor applications.     

Nickel oxide thin films synthesized by reactive pulsed laser deposition: characterization and application to hydrogen sensing

Transparent nickel oxide thin films were grown by reactive pulsed laser deposition. An ArF* (λ=193 nm, τ=12 ns) excimer laser source was used to ablate the Ni targets in a controlled pressure of ambient oxygen. The substrates were either kept at room temperature or heated to a selected temperature within the 200–400 °C range. Post-deposition heat treatment, which was applied to further promote crystallization and overcome any oxygen deficiency, yielded transparent thin films. The surface morphology and crystalline status of the synthesized thin structures were analyzed in correlation with their optical properties. A significant response to several concentrations of hydrogen was demonstrated when heating the nickel oxide films at 185 °C. PACS 78.66.Hf; 81.15.Fg; 82.47.Rs     

Study of DNA Light Switch Ru(II) Complexes : Synthesis,Characterization, Photocleavage and Antimicrobial Activity

The three Ru(II) complexes of [Ru(phen)₂dppca]²⁺ (1) [Ru(bpy)₂dppca]²⁺ (2) and [Ru(dmb)₂dppca]²⁺ (3) (where phen = 1,10 phenanthroline, bpy = 2,2-bipyridine, dmb = 2 ,2-dimethyl 2′,2′-bipyridine and polypyridyl ligand containing a single carboxylate functionality dppca ligand (dipyridophenazine-11-carboxylic acid) have been synthesized and characterized. These complexes have been shown to act as promising calf thymus DNA intercalators and a new class of DNA light switches, as evidenced by UV-visible and luminescence titrations with Co²⁺ and EDTA, steady-state emission quenching by [Fe(CN)₆]⁴⁻ and KI, DNA competitive binding with ethidium bromide, viscosity measurements, and DNA melting experiments. The results suggest that 1, 2, and 3 complexes bind to CT-DNA through intercalation and follows the order 1 > 2 > 3. Under irradiation at 365 nm, the three complexes have also been found to promote the photocleavage of plasmid pBR322 DNA.     

Photophysical and Analyte Sensing Properties of Cyclometalated Ir(III) Complexes

The synthesis of some heteroleptic, cyclometalated iridium(III) complexes is described. The utility of these [Ir(ppy)₂(N-N)]Cl (ppy = 2-phenylpyridine and N-N = substituted bipyridine, biquinoline, or phenanthroline) complexes as luminescence-based sensors is assessed. The emission intensity of an Ir(III) complex featuring the 3,3′-H_ndcbpy ligand (H_ndcbpy = dicarboxylic acid-2,2′-bipyridine; n = 0,1,2 to indicate deprotonated, mono- and diprotonated species, respectively) is seen to increase in the presence of Pb(II). Insight into the structure and analyte-sensing capability is achieved by X-ray crystallography in conjunction with computational modeling. Complexes incorporating carboxylic acid-functionalized bipyridine and biquinoline as the polypyridyl ligand show pH sensitivity while similar phenanthroline complexes do not.     

Structure,thermal properties,conductivity and electrochemical stability of di-urethanesil hybrids doped with LiCF<Subscript>3</Subscript>SO<Subscript>3</Subscript>

Variable chain length di-urethane cross-linked poly(oxyethylene) (POE)/siloxane hybrid networks were prepared by application of a sol-gel strategy. These materials, designated as di-urethanesils (represented as d-Ut(Y′), where Y′ indicates the average molecular weight of the polymer segment), were doped with lithium triflate (LiCF₃SO₃). The two host hybrid matrices used, d-Ut(300) and d-Ut(600), incorporate POE chains with approximately 6 and 13 (OCH₂CH₂) repeat units, respectively. All the samples studied, with compositions ∞ > n ≥ 1 (where n is the molar ratio of (OCH₂CH₂) repeat units per Li⁺), are entirely amorphous. The di-urethanesils are thermally stable up to at least 200 °C. At room temperature the conductivity maxima of the d-Ut(300)- and d-Ut(600)-based di-urethanesil families are located at n = 1 (approximately 2.0 × 10⁻⁶ and 7.4 × 10⁻⁵ Scm⁻¹, respectively). At about 100 °C, both these samples also exhibit the highest conductivity of the two electrolyte systems (approximately 1.6 × 10⁻⁴ and 1.0 × 10⁻³ Scm⁻¹, respectively). The d-Ut(600)-based xerogel with n = 1 displays excellent redox stability.     

Proton-conducting hybrid membranes for medium temperature (>100 °C) fuel cells

Hybrid membranes doped with silicotungstic acid (STA) were prepared by sol–gel process with 3-glycidoxypropyltrimethoxysilane, 3-aminopropyltriethoxysilane, phosphoric acid, and tetraethoxysilane as chemical precursors. The thermogravimetry and differential thermal analysis measurements confirmed that the hybrid membranes were thermally stable up to 350 °C. Relatively, a high proton conductivity of 2.85 × 10⁻² S/cm was obtained for 10 mol% STA-doped hybrid membrane at 120 °C under 90% RH. The hydrogen permeability was found to decrease in the temperature range 20–120 °C from 1.64 × 10⁻¹⁰ to 1.36 × 10⁻¹⁰ mol/cm.s.Pa.     

Star-shaped oligofluorene nanostructured blend materials: controlled micro-patterning and physical characteristics

Star-shaped oligofluorene consists of highly-fluorescent macromolecules of considerable interest for organic electronics. Here, we demonstrate controlled micro-patterning of these organic nanostructured molecules by blending them with custom-synthesized photo-curable aliphatic polymer matrices to facilitate solventless inkjet printing. The printed microstructures are spherical with minimum dimensions of 12 μm diameter and 1 μm height when using a cartridge delivering ∼1 pL droplets. We evaluate the physical characteristics of the printed structures. Photoluminescence studies indicate that the blend materials possess similar fluorescence properties to neat materials in solid films or toluene solution. The fluorescence lifetime consists of two components, respectively 0.68±0.01 ns (τ ₁) and 1.23±0.12 ns (τ ₂). This work demonstrates that inkjet printing of such blends provides an attractive method of handling fluorescent nano-scaled molecules for photonic and optoelectronic applications.     

Quantum-chemical study of effect of conjugation on structure and spectral properties of C105 sensitizing dye

The structure and spectral properties of two organic ruthenium complexes used as sensitizing dyes for solar batteries (well-known N3 dye and its selenophene-conjugated analogue C105 ([Ru(bpy)(bpysef)(COOH)₂(NCS)₂] (bpy = 2,2′-bipyridine, bpysef = 4,4′-bis(5-hexylselenophene-2-yl)2,2′-bipyridine)) are comparatively studied within the density functional method. It is shown that the conjugation of the bipyridine ligand with selenophene affects the electronic structure of the C105 dye. A multilevel model for interpreting the electronic spectra of dyes is proposed based on the analysis of the shapes of molecular orbitals. The nature of the absorption bands of these ruthenium complexes in the region of 300–800 nm is explained. It is found that, in the polar acetonitrile solvent, these dyes are negatively solvatochromic, which agrees with the current classical views on the effect of the solvent on the shape of electronic absorption spectra of related compounds.     

Determination of Judd-Ofelt intensity parameters of pure samarium(III) complexes

This work reports an alternative aproach to obtain the Judd-Ofelt intensity parameters of Sm(III) complexes with the general formula: [Sm(tta)₃(L)_n], with L = H₂O, triphenylphosphine oxide (tppo), 2,2′-bipyridine (bipy) and 1,10-phenantroline (phen); n = 2 for H₂O and tppo and n = 1 for phen and bipy, using the absorption spectra of rare earth complexes where the powders are dispersed in KBr pellets. This approach can be applied to other complexes of rare earth ions that have spin allowed transitions and it is validated by comparing the emission spectra of the complexes with those dispersed in KBr pellets.     

New one-pot synthesis of spiro[furo[2,3-<Emphasis Type="Italic">d</Emphasis>]pyrimidine-6,5′-pyrimidine]pentaones and their sulfur analogues

Reaction of barbituric acid (BA), 1,3-dimethyl barbituric acid (DMBA) and 2-thiobarbituric acid (TBA) with cyanogen bromide and various aldehydes in presence of triethylamine afforded a new class of heterocyclic stable 5-alkyl and/or 5-aryl-1H, 1′H-spiro[furo[2,3-d]pyrimidine-6,5′-pyrimidine]2,2′,4,4′,6′(3H,3′H,5H)-pentaones which are dimeric forms of barbiturate (uracil and thiouracil derivatives) at 0 °C to ambient temperatures. Structure elucidation is proved by X-ray crystallography, ¹H NMR, ¹³C NMR, FT-IR, CHN and mass analyses techniques. Mechanisms of the formations are discussed.     

Thermal Effect on Aequorea Green Fluorescent Protein Anionic and Neutral Chromophore Forms Fluorescence

The emission behaviour of Aequorea green fluorescent protein (A-GFP) chromophore, in both neutral (N) and anionic (A) form, was studied in the temperature range from 20 °C to 75 °C and at pH = 7. Excitation wavelengths of 399 nm and 476 nm were applied to probe the N and A forms environment, respectively. Both forms exhibit distinct fluorescence patterns at high temperature values. The emission quenching rate, following a temperature increase, is higher for the chromophore N form as a result of the hydrogen bond network weakening. The chromophore anionic form emission maximum is red shifted, upon temperature increase, due to a charge transfer process occurring after A form excitation.     

Collisional processes near the CH B 2Σ- v′=0,1 predissociation limit in laser-induced fluorescence flame diagnostics

Excitation and dispersed laser-induced fluorescence spectra of CH B ²Σ^-v^′=0,1 in methane flames are analyzed using rotational relaxation models to investigate their applicability for flame diagnostics. The existence of non-predissociative and highly predissociative rotational levels in the same vibrational state provides a unique scenario to test the effects of rotational relaxation in laser-induced fluorescence measurements. Using a statistical power gap law for rotational relaxation modeling, we find that the levels with collision-free lifetimes as short as 100 ps have apparent fluorescence yields larger than expected because of the extent of rotational relaxation at atmospheric pressure. Also, vibrational (v^′=1 to v^′=0) and electronic energy transfer (B ²Σ^-v^′=1 to A ²Δ) are competitive, and together are half the value for the total collisional removal rate from CH B ²Σ^-v^′=0. The measured electronic energy transfer branching ratio into A (v^′=0-3) depends on the initial rotational level pumped, and energy gap considerations can be used to explain these propensities. The combination of measurements and model calculations finds the excitation of the CH B ²Σ^- v^′=1,N^′=8 level a good candidate for laser-induced fluorescence quantitative measurements in flames at atmospheric pressure. Received: 24 September 1999 / Published online: 7 June 2000     

Electrochemical study of P(VDF-HFP)/PMMA blended polymer electrolyte with high-temperature stability for polymer lithium secondary batteries

In the present study, a kind of solid polymer electrolyte (SPE) based on poly(vinylidene difluoride-co-hexafluoropropylene)/poly(methyl methacrylate) blends was prepared by a casting method to solve the safety problem of lithium secondary batteries. Owing to being plasticized with a room temperature ionic liquid, N-butyl-N′-methyl-imidiazolium hexafluorophosphate, the obtained SPE shows a thermal decomposition temperature over 300°C and an ionic conductivity close to 10⁻³ S cm⁻¹. The SPE-3 sample, in which the weight of two polymers is equivalent, possesses an ionic conductivity of 0.45 × 10⁻³ S cm⁻¹ at 25°C and presents an electrochemical window of 4.43 V. The ionic conductivity of the SPE-3 is as high as 1.73 × 10⁻³ S cm⁻¹ at 75°C approaching to that of liquid electrolyte. The electrochemical performances of the Li/LiFePO₄ cells confirmed its feasibility in lithium secondary batteries.     

Synthesis,Electrochemical, and Optical Properties of New Fluorescent,Substituted Thieno[3,2-b][1]Benzothiophenes

The synthesis, electrochemical and optical properties of three fluorescent substituted thieno[3,2-b][1]benzothiophenes (TBT) derivatives, including 3-methoxythieno[3,2-b][1]benzothiophene (3-MeO-TBT), 2,3-dimethylthieno[3,2-b][1]benzothiophene (2,3-diMe-TBT), and 6-methoxythieno[3,2-b][1]benzothiophene-2-carboxylate (6-MeO-TBT-2-COOMe), were investigated. The oxidation potential values varied between 1.40 and 1.20 V/SCE according to the electronic substituent effect, and electropolymerization attempts, performed in 0.1 M LiClO₄ acetonitrile solution, led to the formation of very thin films of poly(3-MeO-TBT) and poly(2,3-di-Me-TBT). Electronic absorption spectra, fluorescence excitation and emission spectra, fluorescence quantum yields (Φ_F) , lifetimes (τ_F), and other photophysical parameters of the three new TBT derivatives were measured in DMSO solutions at room temperature. For the methyl-and methoxy-substituted TBT derivatives, the fluorescence emission peak were slightly red shifted relative to that of unsubstituted TBT (Δλ_em = 1–12 nm) whereas, in the case of 6-MeO-TBT-2-COOMe, a rather strong red-shift (Δλ_em = 73 nm) was attributed to the existence of a “push-pull” electronic interaction of the MeO and COOMe groups. All Φ_F values were rather high, varying between 0.11 and 0.35, according to the substituent effect. Fluorescence decays were mono-exponential and τ_F values were very short, ranging between 0.11 and 0.30 ns for the substituted TBT derivatives until study.     

The Fluorescence Properties and Lifetime Study of G-quadruplexes Single- and Double-labeled with Pyrene

We report steady state fluorescence and lifetime emission studies of d(GGTTGGTGTGGTTGG) (TBA) and d(GGGTTAGGGTTAGGGTTAGGG) (Htelom) oligonucleotides labeled with pyrene through a 3-aminopropyl linker. Such G-rich sequences are able to self-assemble into G-quadruplexes, especially in the presence of specific cations like potassium. A comparative studies with single- and double-labeled G-quadruplexes were carried out. For each probe we have measured fluorescence decays for emission wavelength of 390 and 480 nm in the varying concentration of potassium ion. We have calculated average lifetimes <τ> for every system as well as the fractional distribution α_i of emitting species.