Backbone dynamics in the DNA HhaI protein binding site

The dynamics of the phosphodiester backbone in the [5'-GCGC-3'] 2 moiety of the DNA oligomer [d(G 1A 2T 3A 4 G 5 C 6 G 7 C 8T 9A 10T 11C 12)] 2 are studied using deuterium solid-state NMR (SSNMR). SSNMR spectra obtained from DNAs nonstereospecifically deuterated on the 5' methylene group of nucleotides within the [5'-GCGC-3'] 2 moiety indicated that all of these positions are structurally flexible. Previous work has shown that methylation reduces the amplitude of motion in the phosphodiester backbone and furanose ring of the same DNA, and our observations indicate that methylation perturbs backbone dynamics through not only a loss of mobility but also a change of direction of motion. These NMR data indicate that the [5'-GCGC-3'] 2 moiety is dynamic, with the largest amplitude motions occurring nearest the methylation site. The change of orientation of this moiety in DNA upon methylation may make the molecule less amenable to binding to the HhaI endonuclease.     

Furanose dynamics in the HhaI methyltransferase target DNA studied by solution and solid-state NMR relaxation

Both solid-state and solution NMR relaxation measurements are routinely used to quantify the internal dynamics of biomolecules, but in very few cases have these two techniques been applied to the same system, and even fewer attempts have been made so far to describe the results obtained through these two methods through a common theoretical framework. We have previously collected both solution 13C and solid-state 2H relaxation measurements for multiple nuclei within the furanose rings of several nucleotides of the DNA sequence recognized by HhaI methyltransferase. The data demonstrated that the furanose rings within the GCGC recognition sequence are very flexible, with the furanose rings of the cytidine, which is the methylation target, experiencing the most extensive motions. To interpret these experimental results quantitatively, we have developed a dynamic model of furanose rings based on the analysis of solid-state 2H line shapes. The motions are modeled by treating bond reorientations as Brownian excursions within a restoring potential. By applying this model, we are able to reproduce the rates of 2H spin-lattice relaxation in the solid and 13C spin-lattice relaxation in solution using comparable restoring force constants and internal diffusion coefficients. As expected, the 13C relaxation rates in solution are less sensitive to motions that are slower than overall molecular tumbling than to the details of global molecular reorientation, but are somewhat more sensitive to motions in the immediate region of the Larmor frequency. Thus, we conclude that the local internal motions of this DNA oligomer in solution and in the hydrated solid state are virtually the same, and we validate an approach to the conjoint analysis of solution and solid-state NMR relaxation and line shapes data, with wide applicability to many biophysical problems.     

Modeling furanose ring dynamics in DNA

Determination of the conformational flexibility of the furanose ring is of vital importance in understanding the structure of DNA. In this work we have applied a model of furanose ring motion to the analysis of deuterium line shape data obtained from sugar rings in solid hydrated DNA. The model describes the angular trajectories of the atoms in the furanose ring in terms of pseudorotation puckering amplitude (q) and the pseudorotation puckering phase phi. Fixing q, the motion is thus treated as Brownian diffusion through an angular-dependent potential U(phi). We have simulated numerous line shapes varying the adjustable parameters, including the diffusion coefficient D, pseudorotation puckering amplitude q, and the form of the potential U(phi). We have used several forms of the potential, including equal double-well potentials, unequal double-well potentials, and a potential truncated to "second order" in the Fourier series. To date, we have obtained best simulations for both equilibrium and nonequilibrium (partially relaxed) solid-state deuterium NMR line shapes for the sample [2' '-2H]-2'-deoxycytidine at the position C3 (underlined) in the DNA sequence [d(CGCGAATTCGCG)]2, using a double-well potential with an equal barrier height of U(0) = 5.5k(B)T ( approximately 3.3 kcal/mol), a puckering amplitude of q = 0.4 A, and a diffusion coefficient characterizing the underlying stochastic jump rate D = 9.9 x 10(8) Hz. Then the rate of flux for the C-D bond over the barrier, i.e., the escape velocity or the overall rate of puckering between modes, was found to be 0.7 x 10(7) Hz.     

31P NMR investigation of backbone dynamics in DNA binding sites

The backbone conformation of DNA plays an important role in the indirect readout mechanisms for protein--DNA recognition events. Thus, investigating the backbone dynamics of each step in DNA binding sequences provides useful information necessary for the characterization of these interactions. Here, we use 31P dynamic NMR to characterize the backbone conformation and dynamics in the Dickerson dodecamer, a sequence containing the EcoRI binding site, and confirm solid-state 2H NMR results showing that the C3pG4 and C9pG10 steps experience unique dynamics and that these dynamics are quenched upon cytosine methylation. In addition, we show that cytosine methylation affects the conformation and dynamics of neighboring nucleotide steps, but this effect is localized to only near neighbors and base-pairing partners. Last, we have been able to characterize the percent BII in each backbone step and illustrate that the C3pG4 and C9pG10 favor the noncanonical BII conformation, even at low temperatures. Our results demonstrate that 31P dynamic NMR provides a robust and efficient method for characterizing the backbone dynamics in DNA. This allows simple, rapid determination of sequence-dependent dynamical information, providing a useful method for studying trends in protein-DNA recognition events.     

Effect of (5'S)-5',8-cyclo-2'-deoxyadenosine on the conformation of di and trinucleotides. A NMR and DFT study

5',8-Purine cyclonucleosides constitute an important class of oxidatively generated tandem lesions whose formation involves initial hydroxyl radical-mediated hydrogen atom abstraction from the 5-hydroxymethyl group of 2-deoxyribose followed by intramolecular cyclization. The present study deals with the synthesis of the 5'S diastereomer of 5',8-cyclo-2'-deoxyadenosine containing di- and tri-oligodeoxynucleotides as an attempt to delineate the conformational changes induced in the DNA fragments by the presence of a rigid modified nucleoside. For this purpose, extensive 1D and 2D NMR measurements that were completed by DFT theoretical calculations were performed. As a striking result, it was found that the covalent bond between C(5') and C(8) in the investigated purine cyclonucleoside induces an unusual West ((0)T(1)) conformation of the furanose ring. Thus it can be postulated that the rigid structure of the tandem lesion would strongly perturb the global geometry of oligonucleotides at the site of the modification and therefore affect the enzymatic activity of DNA polymerases and repair enzymes.     

Synthesis and pairing properties of oligodeoxynucleotides containing bicyclo-RNA and bicyclo-ANA modifications

The synthesis of the ribo(bc-rT)- and arabino(bc-araT)-version of bicyclothymidine (bc-dT) has been achieved. A conformational analysis by X-ray and/or (1)H NMR spectroscopy on the corresponding 3',5'-benzyl-protected nucleosides featured a rigid C(2')-endo conformation for the furanose ring, irrespective of the configuration of the OH group at C(2'). The conformation of the carbocyclic ring in these nucleosides was found to be less defined and thus more flexible. Both nucleosides were converted into the corresponding phosphoramidites and incorporated into oligodeoxynucleotides by standard DNA chemistry. T(m)-data of duplexes with cDNA and RNA revealed that a bc-rT unit strongly destabilized duplexes with cDNA and RNA by 6-8 °C/mod, while bc-araT was almost T(m) neutral. A rationale based on a previous structure of a bc-DNA mini duplex suggests that the strong destabilization caused by a bc-rT unit arises from unfavorable steric interactions of the equatorial 2'-OH group with the sugar residue of the 3'-neighboring nucleotide unit.     

Impact of pyrophosphate and O-ethyl-substituted pyrophosphate groups on DNA structure

Design of novel DNA probes to inhibit specific repair pathways is important for basic science applications and for use as therapeutic agents. As shown previously, single pyrophosphate (PP) and O-ethyl-substituted pyrophosphate (SPP) modifications can inhibit the DNA glycosylase activities on damaged DNA. To understand the structural basis of this inhibition, the influence of the PP and SPP internucleotide groups on the helical parameters and geometry of a double-stranded DNA was studied by using molecular modeling tools including molecular dynamics and quantum mechanical-molecular mechanical (QM/MM) approaches. Native and locally modified PP- and SPP-containing DNA duplexes of dodecanucleotide d(C1G2C3G4A5A6T7T8C9G10C11G12) were simulated in aqueous solution. The energies and forces were computed by using the PBE0/6-31+G** approach in the QM part and the AMBER force-field parameters in the MM part. Analysis of the local base-pair helical parameters, internucleotide distances, and overall global structure at the located stationary points revealed a close similarity of the initial and modified duplexes, with only torsion angles of the main chain being altered in the vicinity of introduced chemical modification. Results show that the PP and SPP groups are built into a helix structure without elongation of the internucleotide distance due to flipping-out of phosphate group from the sugar-phosphate backbone. The mechanism of such embedding has only a minor impact on the base pairs stacking and Watson-Crick interactions. Biochemical studies revealed that the PP and SPP groups immediately 5', but not 3', to the 8-oxoguanosine (8oxodG) inhibit translesion synthesis by a DNA polymerase in vitro. These results suggest that subtle perturbations of the DNA backbone conformation influence processing of base lesions.     

2-Deoxy-beta-D-erythro-pentofuranose: hydroxymethyl group conformation and substituent effects on molecular structure, ring geometry, and NMR spin-spin coupling constants from quantum chemical calculations.

The effect of hydroxymethyl conformation (gg, gt, and tg rotamers about the C4-C5 bond) on the conformational energies and structural parameters (bond lengths, bond angles, bond torsions) of the 10 envelope forms of the biologically relevant aldopentofuranose, 2-deoxy-beta-D-erythro-pentofuranose (2-deoxy-D-ribofuranose) 2, has been investigated by ab initio molecular orbital calculations at the HF/6-31G level of theory. C4-C5 bond rotation induces significant changes in the conformational energy profile of 2 (2gt and 2tg exhibit one global energy minimum, whereas 2gg exhibits two nearly equivalent energy minima), and structural changes, especially those in bond lengths, are consistent with predictions based on previously reported vicinal, 1,3- and 1,4-oxygen lone pair effects. HF/6-31G-optimized envelope geometries of 2gg were re-optimized using density functional theory (DFT, B3LYP/6-31G), and the resulting structures were used in DFT calculations of NMR spin-spin coupling constants involving 13C (i.e., J(CH) and J(CC) over one, two, and three bonds) in 2gg according to methods described previously. The computed J-couplings were compared to those reported previously in 2gt to assess the effect of C4-C5 bond rotation on scalar couplings within the furanose ring and hydroxymethyl side chain. The results confirm prior predictions of correlations between 2J(CH), 3J(CH), 2J(CC) and 3J(CC), and ring conformation, and verify the usefulness of a concerted application of these couplings (both their magnitudes and signs) in assigning preferred ring and C4-C5 bond conformations in aldopentofuranosyl rings. The new calculated J-couplings in 2gg have particular relevance to related J-couplings in DNA (and RNA indirectly), where the gg rotamer, rather than the gt rotamer, is observed in most native structures. The effects of two additional structural perturbations on 2 were also studied, namely, deoxygenation at C5 (yielding 2,5-dideoxy-beta-D-erythro-pentofuranose 4) and methyl glycosidation at O1 (yielding methyl 2-deoxy-beta-D-erythro-pentofuranoside 5) at the HF/6-31G level. The conformational energy profile of 4 resembles that found for 2gt, not 2gg, indicating that 4 is an inappropriate structural mimic of the furanose ring in DNA. Glycosidation failed to induce differential stabilization of ring conformations containing an axial C1-O1 bond (anomeric effect), contrary to experimental data. The latter discrepancy indicates that either the magnitude of this differential stabilization depends on ring configuration or that solvent effects, which are neglected in these calculations, play a role in promoting this stabilization.     

Comprehensive structural studies of 2',3'-difluorinated nucleosides: comparison of theory, solution, and solid state

The conformations of three 2',3'-difluoro uridine nucleosides were studied by X-ray crystallography, NMR spectroscopy, and ab initio calculations in an attempt to define the roles that the two vicinal fluorine atoms play in the puckering preferences of the furanose ring. Two of the compounds examined contained fluorine atoms in either the arabino or xylo dispositions at C2' and C3' of a 2',3'-dideoxyuridine system. The third compound also incorporated fluorine atoms in the xylo configuration on the furanose ring but was substituted with a 6-azauracil base in place of uracil. A battery of NMR experiments in D 2O solution was used to identify conformational preferences primarily from coupling constant and NOE data. Both (1)H and (19)F NMR data were used to ascertain the preferred sugar pucker of the furanose ring through the use of the program PSEUROT. Compound-dependent parameters used in the PSEUROT calculations were newly derived from complete sets of conformations calculated from high-level ab initio methods. The solution and theoretical data were compared to the conformations of each molecule in the solid state. It was shown that both gauche and antiperiplanar effects may be operative to maintain a pseudodiaxial arrangement of the C2' and C3' vicinal fluorine atoms. These data, along with previously reported data by us and others concerning monofluorinated nucleoside conformations, were used to propose a model of how fluorine influences different aspects of nucleoside conformations.     

Solution structure of a DNA duplex containing the potent anti-poxvirus agent cidofovir

Cidofovir (1(S)-[3-hydroxy-2-(phosphonomethoxy)propyl]cytosine, CDV) is a potent inhibitor of orthopoxvirus DNA replication. Prior studies have shown that, when CDV is incorporated into a growing primer strand, it can inhibit both the 3'-to-5' exonuclease and the 5'-to-3' chain extension activities of vaccinia virus DNA polymerase. This drug can also be incorporated into DNA, creating a significant impediment to trans-lesion DNA synthesis in a manner resembling DNA damage. CDV and deoxycytidine share a common nucleobase, but CDV lacks the deoxyribose sugar. The acyclic phosphonate bears a hydroxyl moiety that is equivalent to the 3'-hydroxyl of dCMP and permits CDV incorporation into duplex DNA. To study the structural consequences of inserting CDV into DNA, we have used (1)H NMR to solve the solution structures of a dodecamer DNA duplex containing a CDV molecule at position 7 and of a control DNA duplex. The overall structures of both DNA duplexes were found to be very similar. We observed a decrease of intensity (>50%) for the imino protons neighboring the CDV (G6, T8) and the cognate base G18 and a large chemical shift change for G18. This indicates higher proton exchange rates for this region, which were confirmed using NMR-monitored melting experiments. DNA duplex melting experiments monitored by circular dichroism revealed a lower T(m) for the CDV DNA duplex (46 °C) compared to the control (58 °C) in 0.2 M salt. Our results suggest that the CDV drug is well accommodated and stable within the dodecamer DNA duplex, but the stability of the complex is less than that of the control, suggesting increased dynamics around the CDV.     

Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) tethering a Hoechst 33258 analogue: triplex and duplex stabilization by simultaneous minor groove binding

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.     

Combined theoretical and computational study of interstrand DNA guanine-guanine cross-linking by trans-[Pt(pyridine)2] derived from the photoactivated prodrug trans,trans,trans-[Pt(N3)2(OH)2(pyridine)2

Molecular modeling and extensive experimental studies are used to study DNA distortions induced by binding platinum(II)-containing fragments derived from cisplatin and a new class of photoactive platinum anticancer drugs. The major photoproduct of the novel platinum(IV) prodrug trans,trans,trans-[Pt(N(3))(2)(OH)(2)(py)(2)] (1) contains the trans-{Pt(py)(2)}(2+) moiety. Using a tailored DNA sequence, experimental studies establish the possibility of interstrand binding of trans-{Pt(py)(2)}(2+) (P) to guanine N7 positions on each DNA strand. Ligand field molecular mechanics (LFMM) parameters for Pt-guanine interactions are then derived and validated against a range of experimental structures from the Cambridge Structural Database, published quantum mechanics (QM)/molecular mechanics (MM) structures of model Pt-DNA systems and additional density-functional theory (DFT) studies. Ligand field molecular dynamics (LFMD) simulation protocols are developed and validated using experimentally characterized bifunctional DNA adducts involving both an intra- and an interstrand cross-link of cisplatin. We then turn to the interaction of P with the DNA duplex dodecamer, d(5'-C(1)C(2)T(3)C(4)T(5)C(6)G(7)T(8)C(9)T(10)C(11)C(12)-3')·d(5'-G(13)G(14)A(15)G(16)A(17)C(18)G(19)A(20)G(21)A(22)G(23)G(24)-3') which is known to form a monofunctional adduct with cis-{Pt(NH(3))(2)(py)}. P coordinated to G(7) and G(19) is simulated giving a predicted bend toward the minor groove. This is widened at one end of the platinated site and deepened at the opposite end, while the P-DNA complex exhibits a global bend of ～67° and an unwinding of ～20°. Such cross-links offer possibilities for specific protein-DNA interactions and suggest possible mechanisms to explain the high potency of this photoactivated complex.     

The beta-fluorine effect. Electronic versus steric effects in radical deoxygenations of fluorine-containing pentofuranose nucleosides

Stereoselective pyramidalization of free radicals by a vicinal fluorine substituent, the beta-fluorine effect, was invoked to rationalize a 77:23 anti/syn ratio of 2-deuterio-1-fluorocyclopentanes obtained by radical reduction of trans-2-fluoro-1-bromocyclopentane with tributyltin deuteride (Dolbier, W. R., Jr.; Bartberger, M. D. J. Org. Chem. 1995, 60, 4984-4985). We have evaluated analogous reductions of the four possible stereoisomers of some adenine 2'(3')-fluoro-3'(2')-O-phenoxythiocarbonyl nucleoside derivatives. In all cases, the steric effect of adenine on the beta face directs deuterium transfer from the stannane to C2'(C3') on the alpha face of the furanose ring. However, the beta-fluorine effect enhances ratios of deuterium transfer anti to the vicinal fluorine substituent.     

Magic-angle spinning solid-state NMR spectroscopy of the beta1 immunoglobulin binding domain of protein G (GB1): 15N and 13C chemical shift assignments and conformational analysis

Magic-angle spinning solid-state NMR (SSNMR) studies of the beta1 immunoglobulin binding domain of protein G (GB1) are presented. Chemical shift correlation spectra at 11.7 T (500 MHz 1H frequency) were employed to identify signals specific to each amino acid residue type and to establish backbone connectivities. High sensitivity and resolution facilitated the detection and assignment of every 15N and 13C site, including the N-terminal (M1) 15NH3, the C-terminal (E56) 13C', and side-chain resonances from residues exhibiting fast-limit conformational exchange near room temperature. The assigned spectra lend novel insight into the structure and dynamics of microcrystalline GB1. Secondary isotropic chemical shifts report on conformation, enabling a detailed comparison of the microcrystalline state with the conformation of single crystals and the protein in solution; the consistency of backbone conformation in these three preparations is the best among proteins studied so far. Signal intensities and line widths vary as a function of amino acid position and temperature. High-resolution spectra are observed near room temperature (280 K) and at <180 K, whereas resolution and sensitivity greatly degrade substantially near 210 K; the magnitude of this effect is greatest among the side chains of residues at the intermolecular interface of the microcrystal lattice, which we attribute to intermediate-rate translational diffusion of solvent molecules near the glass transition. These features of GB1 will enable its use as an excellent model protein not only for SSNMR methods development but also for fundamental studies of protein thermodynamics in the solid state.     

Phase biaxiality in nematic liquid crystalline side-chain polymers of various chemical constitutions

In a previous deuterium NMR study conducted on a liquid crystalline (LC) polymer with laterally attached book-shaped molecules as the mesogenic moiety, we have revealed a biaxial nematic phase below the conventional uniaxial nematic phase (Phys. Rev. Lett. 2004, 92, 125501). To elucidate details of its formation, we here report on deuterium NMR experiments that have been conducted on different types of LC side-chain polymers as well as on mixtures with low-molar-mass mesogens. Different parameters that affect the formation of a biaxial nematic phase, such as the geometry of the attachment, the spacer length between the polymer backbone and the mesogenic unit, as well as the polymer dynamics, were investigated. Surprisingly, also polymers with terminally attached mesogens (end-on polymers) are capable of forming biaxial nematic phases if the flexible spacer is short and thus retains a coupling between the polymer backbone and the LC phase. Furthermore, the most important parameter for the formation of a biaxial nematic phase is the dynamics of the polymer backbone, as the addition of a small percentage of low molar mass LC to the biaxial nematic polymer from the original study served to shift both the glass transition and the appearance of detectable biaxiality in a very similar fashion. Plotting different parameters for the investigated systems as a function of T/Tg also reveals the crucial role of the dynamics of the polymer backbone and hence the glass transition.     

Chemical and structural implications of 1',2'- versus 2',4'- conformational constraints in the sugar moiety of modified thymine nucleosides

In order to understand how the chemical nature of the conformational constraint of the sugar moiety in ON/RNA(DNA) dictates the duplex structure and reactivity, we have determined molecular structures and dynamics of the conformationally constrained 1',2'-azetidine- and 1',2'-oxetane-fused thymidines, as well as their 2',4'-fused thymine (T) counterparts such as LNA-T, 2'-amino LNA-T, ENA-T, and aza-ENA-T by NMR, ab initio (HF/6-31G** and B3LYP/6-31++G**), and molecular dynamics simulations (2 ns in the explicit aqueous medium). It has been found that, depending upon whether the modification leads to a bicyclic 1',2'-fused or a tricyclic 2',4'-fused system, they fall into two distinct categories characterized by their respective internal dynamics of the glycosidic and the backbone torsions as well as by characteristic North-East type sugar conformation (P = 37 degrees +/- 27 degrees , phi(m) = 25 degrees +/- 18 degrees ) of the 1',2'-fused systems, and (ii) pure North type (P = 19 degrees +/- 8 degrees , phi(m) = 48 degrees +/- 4 degrees ) for the 2',4'-fused nucleosides. Each group has different conformational hyperspace accessible, despite the overall similarity of the North-type conformational constraints imposed by the 1',2'- or 2',4'-linked modification. The comparison of pK(a)s of the 1-thyminyl aglycon as well as that of endocyclic sugar-nitrogen obtained by theoretical and experimental measurements showed that the nature of the sugar conformational constraints steer the physicochemical property (pK(a)) of the constituent 1-thyminyl moiety, which in turn can play a part in tuning the strength of hydrogen bonding in the basepairing.     

Sequence selective recognition in the minor groove of dsDNA by pyrrole,imidazole-substituted bis-benzimidazole conjugates

A series of pyrrole, imidazole-substituted bis-benzimidazole conjugates, Py-Py-Im-gamma-biBenz, Py-Py-gamma-biBenz, Py-Im-gamma-biBenz, and Im-Py-gamma-biBenz (1-4), were prepared in an attempt to target dsDNA sequences possessing both A/T and G/C bps. The dsDNA interactions and sequence specificity of the conjugates have been characterized via spectrofluorometric titrations and thermal melting studies. All conjugates form 1:1 complexes with dsDNA at subnanomolar concentrations. The Im moiety selectively recognizes a G/C bp embedded in the A/T-rich binding site. This represents the first clear example of sequence selective recognition in a 1:1 motif.(1) The equilibrium association constant (K(1)) for complexation of a specific nine-bp dsDNA site, 5'-gcggTATGAAATTcgacg-3', by conjugate 1 is approximately 2.6 x 10(9) M(-1). Displacement of the G/C position or G/C-->A/T substitution within the nine-bp site decreases the K(1) by approximately 8-fold, whereas two continuous G/C bps decrease the K(1) by approximately 50-fold magnitude. The K(1) values for seven-bp dsDNA, 5'-gcggtaTGAAATTcgacg-3' and 5'-gcggtaCAAAATTcgacg-3', binding sites by conjugates Py-Im-gamma-biBenz (3) and Im-Py-gamma-biBenz (4) are approximately 2.3 x 10(9) and approximately 1.2 x 10(9) M(-1), respectively. However, the conjugates with no Im moiety, Py-Py-gamma-biBenz (2) and Py-Py-Py-gamma-biBenz (5 and 6), are specific for seven- to nine-bp A/T-rich sites and single A/T-->G/C bp substitution within the binding site decreases the K(1) values by 1-2 orders of magnitude.     

Synthesis and structural characterization of pyrimidine bi- and tricyclic nucleosides with sugar puckers conformationally locked into the eastern region of the pseudorotational cycle

Reaction of 5'-O-tosyl TSAO-m(3)T (1) with amines has led to the synthesis of new classes of bi- and tricyclic nucleosides. Full details about the synthesis of these compounds and a plausible mechanism to explain their obtention are reported. In addition, we describe the development of a second, more efficient, and higher yielding synthetic route as a general approach for the synthesis of some of these bicyclic nucleosides. To study the conformational behavior of the bi- and tricyclic nucleosides described in this paper, intensive NMR investigations and molecular modeling studies were performed. Conformational analysis indicates that the furanose ring of the compounds described here prefers the eastern side of the pseudorotation cycle with the base substituents preferentially in the anti range. The torsion angle gamma describing the C-4'[bond]C-5' is found to prefer the +sc range. These compounds represent a novel class of E-type conformationally restricted bicyclic ribo-nucleosides containing a [3.3.0]-fused carbohydrate moiety. The bicyclic nucleosides described herein present an interesting potential for diverse and selective chemical treatments on the 2'-hydroxyl and/or the functionalities incorporated at the bridge between C-3' and C-5'.     

Relaxation-optimized NMR spectroscopy of methylene groups in proteins and nucleic acids

A large fraction of hydrogens in proteins and nucleic acids is of the methylene type. Their detailed study, however, in terms of structure and dynamics by NMR spectroscopy is hampered by their fast relaxation properties, which give rise to low sensitivity and resolution. It is demonstrated that six different relaxation interference processes, involving 1H-13C and 1H-1H dipolar interactions and 1H and 13C chemical shift anisotropy, can be used simultaneously to mitigate these problems effectively. The approach is applicable to the majority of NMR experiments commonly used to study side chain and backbone conformation. For proteins, its efficiency is evaluated quantitatively for two samples: the third IgG-binding domain from Streptococcal Protein G and the protein calmodulin complexed with a 26-residue target peptide. Gains in both resolution and sensitivity by up to factors of 3.2 and 2.0, respectively, are observed for Gly residues at high magnetic field strengths, but even at much lower fields gains remain substantial. The resolution enhancement obtained for methylene groups makes possible a detailed analysis of spectral regions commonly considered inaccessible due to spectral crowding. For DNA, the high resolution now obtainable for C5' sites permits an H5'/H5'-based sequential NOE assignment procedure, complementary to the conventional base-H1'/H2'/H2' pathway.