Addition of difluorocarbene to 4',5'-unsaturated nucleosides: synthesis and deoxygenation reactions of difluorospirocyclopropane nucleosides

Synthetic routes to 4'-(2,2-difluorospirocyclopropane) analogues of adenosine, cytidine, and uridine are described. Treatment of 2',3'-O-isopropylidene-4',5'-unsaturated compounds derived from adenosine and uridine with difluorocarbene (generated from PhHgCF3 and NaI) gave diastereomeric mixtures of the 2,2-difluorospirocyclopropane adducts. Stereoselectivity resulting from hindrance by the isopropylidene group favored addition at the beta face. Removal of base and sugar protecting groups gave new difluorospirocyclopropane nucleoside analogues. The protected uridine analogue was converted into its cytidine counterpart via a 4-(1,2,4-triazol-1-yl) intermediate. Stannyl radical-mediated deoxygenation of the 3'-O-TBS-2'-thionocarbamate derivatives gave the 2'-deoxy products of direct hydrogen transfer. In contrast, identical treatment of the 2'-O-TBS-3'-thionocarbamate isomers resulted in opening of the vicinal difluorocyclopropane ring upon generation of a C3' radical followed by homoallylic hydrogen transfer to give 4'-(1,1-difluoroethyl)-3',4'-unsaturated nucleoside derivatives. Structural aspects and biological effect considerations are discussed.     

抗癌核苷类似物

综述了近年来核苷类抗癌药物的最新研究进展，分别介绍了具有抗癌活性的核 苷类似物的作用机制和药物代谢机理、各种核苷类似物抗癌剂的分类、次黄嘌呤核 苷酸脱氢酶（IMPDH）抑制剂以及核苷氨基磷酸酯前药的结构与抗癌活性关系。     

Oxygen-dependent DNA damage amplification involving 5,6-dihydrothymidin-5-yl in a structurally minimal system.

5,6-Dihydrothymidin-5-yl (1) was independently generated in a dinucleotide from a phenyl selenide precursor (4). Under free radical chain propagation conditions, the products resulting from hydrogen atom donation and radical-pair reaction are the major observed products in the absence of O(2). The stereoselectivity of the trapping process is dependent on the structure of the hydrogen atom donor. No evidence for internucleotidyl hydrogen atom abstraction by 1 was detected. The tandem lesion (17) resulting from hydrogen atom abstraction from the C1' position of the adjacent 2'-deoxyuridine by the peroxyl radical derived from 1 (3) is observed under aerobic conditions. The structure of this product is confirmed by independent synthesis and its transformation into a second independently synthesized product (24). Internucleotidyl hydrogen atom abstraction is effected selectively by the 5S-diastereomer of the peroxyl radical. The formation of dinucleotide 17 provides further support for the novel O(2)-dependent DNA damage amplification mechanism involving 1 reported previously (Greenberg, M. M.; et al. J. Am. Chem. Soc. 1997, 119, 1828).     

The effects of secondary structure and O2 on the formation of direct strand breaks upon UV irradiation of 5-bromodeoxyuridine-containing oligonucleotides.

BACKGROUND: 5-Bromodeoxyuridine is a radiosensitizing agent that is currently being evaluated in clinical trials as an adjuvant in the treatment of a variety of cancers. gamma-Radiolysis and UV irradiation of oligonucleotides containing 5-bromodeoxyuridine result in the formation of direct strand breaks at the 5'-adjacent nucleotide by oxidation of the respective deoxyribose. We investigated the effects of DNA secondary structure and O2 on the induction of direct strand breaks in 5-bromodeoxyuridine-containing oligonucleotides. RESULTS: The efficiency of direct strand break formation in duplex DNA is dependent upon O2 and results in fragments containing 3'-phosphate and the labile 3'-ketodeoxyadenosine termini. The ratio of the 3'-termini is also dependent upon O2 and structure. Deuterium product isotope effects and tritium-transfer studies indicate that hydrogen-atom abstraction from the C1'- and C2'-positions occurs in an O2- and structure-dependent manner. CONCLUSIONS: The reaction mechanisms by which DNA containing 5-bromodeoxyuridine is sensitized to damage by UV irradiation are dependent upon whether the substrate is hybridized and upon the presence or absence of O2. Oxygen reduces the efficiency of direct strand break formation in duplex DNA, but does not affect the overall strand damage. It is proposed that the sigma radical abstracts hydrogen atoms from the C1'- and C2'-positions of the 5'-adjacent deoxyribose moiety, whereas the nucleobase peroxyl radical selectively abstracts the C1'-hydrogen atom from this site. This is the second example of DNA damage amplification by a nucleobase peroxyl radical, and might be indicative of a general reaction pattern for this family of reactive intermediates.     

Expanding Radical SAM Chemistry by Using Radical Addition Reactions and SAM Analogues

Radical S‐adenosyl‐l ‐methionine (SAM) enzymes utilize a [4Fe‐4S] cluster to bind SAM and reductively cleave its carbon–sulfur bond to produce a highly reactive 5′‐deoxyadenosyl (dAdo) radical. In almost all cases, the dAdo radical abstracts a hydrogen atom from the substrates or from enzymes, thereby initiating a highly diverse array of reactions. Herein, we report a change of the dAdo radical‐based chemistry from hydrogen abstraction to radical addition in the reaction of the radical SAM enzyme NosL. This change was achieved by using a substrate analogue containing an olefin moiety. We also showed that two SAM analogues containing different nucleoside functionalities initiate the radical‐based reactions with high efficiencies. The radical adduct with the olefin produced in the reaction was found to undergo two divergent reactions, and the mechanistic insights into this process were investigated in detail. Our study demonstrates a promising strategy in expanding radical SAM chemistry, providing an effective way to access nucleoside‐containing compounds by using radical SAM‐dependent reactions.     

Investigation of the gas phase reactivity of the 1-adamantyl radical using a distonic radical anion approach

The gas phase reactions of the bridgehead 3-carboxylato-1-adamantyl radical anion were observed with a series of neutral reagents using a modified electrospray ionisation linear ion trap mass spectrometer. This distonic radical anion was observed to undergo processes suggestive of radical reactivity including radical-radical combination reactions, substitution reactions and addition to carbon-carbon double bonds. The rate constants for reactions of the 3-carboxylato-1-adamantyl radical anion with the following reagents were measured (in units 10(-12) cm(3) molecule(-1) s(-1)): (18)O(2) (85 +/- 4), NO (38.4 +/- 0.4), I(2) (50 +/- 50), Br(2) (8 +/- 2), CH(3)SSCH(3) (12 +/- 2), styrene (1.20 +/- 0.03), CHCl(3) (H abstraction 0.41 +/- 0.06, Cl abstraction 0.65 +/- 0.1), CDCl(3) (D abstraction 0.035 +/- 0.01, Cl abstraction 0.723 +/- 0.005), allyl bromide (Br abstraction 0.53 +/- 0.04, allylation 0.25 +/- 0.01). Collision rates were calculated and reaction efficiencies are also reported. This study represents the first quantitative measurement of the gas phase reactivity of a bridgehead radical and suggests that distonic radical anions are good models for the study of their elusive uncharged analogues.     

Cleavage of azoles—I: Synthesis of some triazolyloxazolines and triazolylbenzoxazones

Treatment of glycine, and o-aminobenzoic acid with 4-arylhydrazono-2-phenyl-2-oxazolin-5-ones effected the formation of the N-(1,5-diaryl-1H-1,2,4-triazolyl-3-carbonyl) derivatives of the amino acids. The triazolylcarbonylglycines were azlactonised with aromatic aldehydes to 4-arylidene-2-triazolyl-2-oxazolin-5-ones, which behaved similar to the 2-phenyl analogues towards the action of ammonia and amines. Cyclisation of the triazolylcarbonylanthranilic acids with acetic anhydride afforded 2-triazolyl-4H-3,1-benzoxazin-4-ones.     

Characterization and mechanism of formation of tandem lesions in DNA by a nucleobase peroxyl radical

5,6-Dihydro-2'-deoxyuridin-6-yl (1) was independently generated via photolysis of 3. The radical is an analogue of the major reactive species produced from thymidine upon reaction with hydroxyl radical, which is the dominant DNA-damaging agent produced by the indirect effect of gamma-radiolysis. Under aerobic conditions, the peroxyl radical (2) derived from 1 reacts approximately 82% of the time with either the 5'- or 3'-adjacent nucleotide to produce two contiguously damaged nucleotides, known as tandem lesions. The structures and distribution of tandem lesions were investigated using probes that selectively detect abasic sites, ESI-MS/MS, and competition kinetics. In addition to 2-deoxyribonolactone, nonoxidized abasic sites were detected. 18O-Labeling verified that H2O was the source of oxygen in the abasic sites, but that O2 was the source of the oxygen in the 5,6-dihydro-6-hydroxy-2'-deoxyuridine derived from 2. ESI-MS/MS experiments, in conjunction with isotopic labeling, identified several products and provided direct evidence for peroxyl radical addition to the adjacent thymine bases. Kinetic studies revealed that peroxyl radical addition to the 5'-thymine was favored by approximately 4-5-fold over C1'-hydrogen atom abstraction from the respective deoxyribose ring, and that 2-deoxyribonolactone formation accounts for approximately 11% of the total amount of tandem lesions produced. These results suggest that tandem lesions, whose biochemical effects are largely unknown, constitute a major family of DNA damage products produced by the indirect effect of gamma-radiolysis.     

A conformationally preorganized universal solid support for efficient oligonucleotide synthesis

A novel, conformationally preorganized nonnucleosidic universal solid support for oligonucleotide synthesis was developed. The solid support featured two chemically equivalent hydroxy groups locked in syn-periplanar orientation and orthogonally protected with 4,4'-dimethoxytrityl and acetyl groups. The solid support was extensively tested in the preparation of oligonucleotides and their phosphorothioate analogues containing 2'-deoxy, 2'-O-methyl, and 2'-O-methoxyethylnucleoside residues at the 3'-terminus. Upon completion of oligonucleotide chain assembly, the support-bound oligonucleotide material was treated with concentrated ammonium hydroxide, which removed the O-acetyl protection. The deprotected hydroxy group then effected the transesterification of a phosphate linkage between the solid support and the 3'-terminal nucleoside residue to result in a facile release of the oligonucleotide to solution. The kinetics of the release process was studied in a continuous flow of concentrated aqueous ammonium hydroxide at a temperature of 300.15 K. Optimal conditions for the release of oligonucleotides depending on the chemistry of the backbone and 3'-terminal nucleoside residue were formulated.     

Rotation of the exo-methylene group of (R)-3-methylitaconate catalyzed by coenzyme B(12)-dependent 2-methyleneglutarate mutase from Eubacterium barkeri

2-Methyleneglutarate mutase from the anaerobe Eubacterium (Clostridium) barkeri is an adenosylcobalamin (coenzyme B(12))-dependent enzyme that catalyzes the equilibration of 2-methyleneglutarate with (R)-3-methylitaconate. Two possibilities for the mechanism of the carbon skeleton rearrangement of the substrate-derived radical to the product-related radical are considered. In both mechanisms an acrylate group migrates from C-3 of 2-methyleneglutarate to C-4. In the "addition-elimination" mechanism this 1,2-shift occurs via an intermediate, a 1-methylenecyclopropane-1,2-dicarboxylate radical, in which the migrating acrylate is simultaneously attached to both C-3 and C-4. In the "fragmentation-recombination" mechanism the migrating group, a 2-acrylyl radical, becomes detached from C-3 before it starts bonding to C-4. In an attempt to distinguish between these two possibilities we have investigated the action of 2-methyleneglutarate mutase on the stereospecifically deuterated substrates (Z)-3-methyl[2'-(2)H(1)]itaconate and (Z)-3-[2'-(2)H(1),methyl-(2)H(3)]methylitaconate. The enzyme catalyzes the equilibration of both compounds with their corresponding E-isomers and with a 1:1 mixture of the corresponding (E)- and (Z)-2-methylene[2'-(2)H(1)]glutarates, as shown by monitoring of the reactions with (1)H and (2)H NMR. In the initial phase of the enzyme-catalyzed equilibration a significant excess (8-11%) of (E)-3-methyl[2'-(2)H(1)]itaconate over its equilibrium value was observed ("E-overshoot"). The E-overshoot was only 3-4% with (Z)-3-[2'-(2)H(1),methyl-(2)H(3)]methylitaconate because the presence of the deuterated methyl group raises the energy barrier from 3-methylitaconate to the corresponding radical. The overshoot is explained by postulating that the migrating acrylate group has to overcome an additional energy barrier from the state leading back to the substrate-derived radical to the state leading forward to the product-related radical. It is concluded that the fragmentation-recombination mechanism can provide an explanation for the results in terms of an additional energy barrier, despite the higher calculated activation energy for this pathway.     

DNA cleavage by the photolysis of cyclopentadienyl metal complexes: mechanistic studies and sequence selectivity of strand scission by CpW(CO)3CH3

[Reaction: see text]. The photolysis of CpW(CO)3Me has been shown to produce methyl radicals and to cleave DNA in a single-stranded manner, and preliminary evidence implicated a carbon-centered radical in this process. In this work, the mechanism of strand scission in this reaction was determined to occur by hydrogen atom abstraction from the 4'- and 5'-positions of the deoxyribose moiety of the backbone of DNA. Additionally, in a side reaction that does not lead to frank strand scission, all four bases of DNA are methylated under these conditions; however, none of these base or backbone modifications lead to the formation of abasic sites.     

Absolute Rate Constants for the Reactions of Primary Alkyl Radicals with Aromatic Amines(1)

Hydrogen abstraction from diarylamines (4-X-C(6)H(4))(2)NH [X = H, CH(3), C(8)H(17), CH(3)O, and Br] by the 2-methyl-2-phenylpropyl radical in n-dodecane solution was investigated by thermolysis of 3-methyl-3-phenylbutanoyl peroxide in the presence of various concentrations of the amines. The reaction is a non-chain process in which the 2-methyl-2-phenylpropyl radical and its rearrangement product, the 2-benzylpropan-2-yl radical, abstract hydrogen from both the solvent and the amine. Cross-disproportionation reactions of the rearranged radical led to the formation of significant amounts of beta,beta-dimethylstyrene. Rate constants for hydrogen abstraction by the unrearranged, primary alkyl radical from n-dodecane (k(373K) = 3.5 x 10(3) M(-)(1) s(-)(1)), diphenylamine (k(373K) = 1.3 x 10(6) M(-)(1) s(-)(1)), and the substituted diarylamines were determined from the product yields and the known rate constant for the radical rearrangement. From kinetic experiments with N-deuteriodiphenylamine the deuterium kinetic isotope effect,k(NH)/k(ND), was found to be 2.3 at 373 K.     

The role of radicals in enzymatic processes

Research on the mechanism of action of coenzyme B12, adenosylcobalamin, as a graduate student introduced the author to the field of organic free radicals in enzymology. Twenty years later, related work on S-adenosylmethionine (SAM) as a "poor man's coenzyme B12" was initiated in a detailed analysis of the mechanism of action of lysine 2,3-aminomutase (LAM). The interconversion of L-lysine and L-beta-lysine is catalyzed by LAM, which requires SAM, pyridoxal-5'-phosphate (PLP), and a [4Fe-4S] cluster as coenzymes. The mechanism of this reaction has been delineated as a radical isomerization, in which radical formation is initiated by the [4Fe-4S]-dependent cleavage of the SAM into methionine and the 5'-deoxyadenosyl radical. The mechanism of this process is discussed, together with the role of this radical in hydrogen abstraction from lysine to initiate the substrate radical isomerization. The chemistry underlying the functions of SAM, PLP, and [4Fe-4S] in the action of LAM is novel in all respects, except for the formation of a lysine-PLP aldimine at the active site. Of the four free radicals in the mechanism, three have been characterized by EPR spectroscopy. In the suicide inactivation of adenosylcobalamin-dependent dioldehydrase (DDH) by glycolaldehyde, the formation of cob(II)alamin and 5'-deoxyadenosine is accompanied by the conversion of glycolaldehyde to cis-ethanesemidione radical at the active site. The cis-ethanesemidione radical has been characterized by EPR spectroscopy. Its exceptional stability at the active site is the basis for the inactivation of DDH by glycolaldehyde.     

Synthesis, Conformational Analysis, and Biological Evaluation of Heteroaromatic Taxanes

The asymmetric syntheses of heteroaromatic 3-[(tert-butyldimethylsilyl)oxy]-2-azetidinones 12-16 via chiral ester enolate-imine cyclocondensation chemistry are described. The azetidinones contain heteroaromatic moieties which, in certain cases, contribute to a decrease in enantioselectivity due to possible alternate coordinations in the transition states. The (3R,4S)-3-[(tert-butyldimethylsilyl)oxy]-4-heteroaryl-2-azetidinones were subsequently converted to the heteroaromatic taxanes 31-36 and 43-45. Conformational analyses of the 3'-(2-pyridyl) analogue 31 and 3'-(2-furyl) analogue 43 indicate they have solution conformational preferences virtually identical to paclitaxel and docetaxel. Heteroaromatic N-acyl paclitaxel analogues 47-51 were prepared from N-debenzoylpaclitaxel via Schotten-Baumann acylation. The majority of the 14 analogues displayed good to excellent activity in a microtubule assembly assay in comparison to paclitaxel. The analogues were also tested for cytotoxicity against B16 melanoma cells. 3'-Dephenyl-3'-(2-pyridyl)paclitaxel (31), 3'-dephenyl-3'-(2-furyl)paclitaxel (34), N-BOC-3'-dephenyl-3'-(2-furyl)paclitaxel (43), 3'-dephenyl-3'-(2-furyl)-N-(hexanoyl)paclitaxel (44), and N-debenzoyl-N-(3-furoyl)paclitaxel (51) were found to be more cytotoxic than paclitaxel against this cell line. 3'-Dephenyl-3'-(4-pyridyl)paclitaxel (33) and N-debenzoyl-N-(2-furoyl)paclitaxel (50) displayed cytotoxicity against B16 melanoma cells similar to paclitaxel.     

Theoretical and experimental investigations on the chemical reactions of positively charged phenyl radicals with cytosine and 1-methylcytosine

The chemical behavior of positively charged phenyl radicals toward cytosine, 1-methylcytosine, and some pyrimidine analogues in the gas phase was investigated both theoretically by performing molecular orbital calculations and experimentally by using FT/ICR mass spectrometry. The phenyl radicals react with cytosine and 1-methylcytosine predominately by hydrogen abstraction and addition. For cytosine, the preferred site for hydrogen abstraction appears to be the amino group, and addition occurs preferentially at the N3 and N1 positions of the keto and enol tautomeric forms, respectively. For 1-methylcytosine, the methyl group is the thermodynamically favored site for hydrogen abstraction and N3 for addition. Possible structures and formation mechanisms are suggested for two unknown product ions formed upon the reaction of cytosine with the 3-dehydro-N-phenylpyridinium radical cation.     

Synthesis and conformational analysis of new cyclobutane-fused nucleosides

[structure: see text]. A stereselective synthesis of 3-oxabicyclo[3.2.0]heptane nucleoside analogues, which were designed as conformational mimics of the anti-HIV agents 2',3'-didehydro-2',3'-dideoxythimidine (stavudine, d4T) and 2',3'-didehydro-2',3'-dideoxyadenosine (d4A), is described. The target compounds were prepared by condensation of a common intermediate bicyclic acetate, derived from a homochiral 2(5H)-furanone, with pyrimidine and purine bases under modified Vorbrüggen conditions. The conformational behavior of the synthesized nucleoside analogues was studied by NMR spectroscopy and X-ray crystallography.     

Formation of superoxide by benzofurazans in Escherichia coli under aerobic incubation.

The superoxide (O2-.) production in Escherichia coli through the action of benzofurazans (BZs) was examined using the cytochrome c (cyt. c) reduction method. Adding BZs to E. coli cell suspensions caused the cyt. c reduction, which was completely inhibited by superoxide dismutase (SOD). The effects of BZs on cyt. c reduction was in the order of benzofurazan (1) approximately 4,7-dimethylbenzofurazan (2) approximately 4,7-dibromobenzofurazan (3) less than 4-bromo-6-cyanobenzofurazan (4) less than 4,7-dicyanobenzofurazan (5). This was correlated with the toxicity of BZs against E. coli growth (1 approximately 2 approximately 3 less than 4 less than 5) and with the redox potentials of BZs (1 approximately 2 less than 3 less than 4 less than 5). The formation of compound 5 anion radical in the cell suspensions in the absence of dioxygen (O2), was determined using ESR spectrum. The ESR signal of the anion radical disappeared with the addition of O2. The BZs effected the O2-. production in E. coli cells.     

Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core).     

Novel carbocyclic nucleosides containing a cyclobutyl ring: adenosine analogues

(1S,1'R)-cis-1-(3'-aminomethyl-2',2'-dimethylcyclobutyl)ethanol (1) and (1S,1'R)-cis-1-[3'-(2-aminoethyl)-2',2'-dimethylcyclobutyl]ethanol (2) were used as precursors in the synthesis of cyclobutyl nucleoside analogues containing adenine and 8-azaadenine moieties, which were tested as antiviral and antitumoral agents in a variety of assay systems. Compounds 8 and 9 displayed significant activity against respiratory syncytial virus, and compounds 14 and 15 were moderately active against vaccinia virus.     

Chain amplification in photoreactions of N-alkoxypyridinium salts with alcohols: mechanism and kinetics

Photosensitized electron transfer from a variety of singlet- and triplet-excited donors to N-methoxypyridinium salts leads to N-O bond cleavage. Hydrogen atom abstraction by the resulting methoxy radical from an added alcohol generates an alpha-hydroxy radical that reduces another pyridinium molecule, thus leading to chain propagation. For example, thioxanthone-sensitized reactions of 4-cyano-N-methoxypyridinium, P1, with several aliphatic and benzyl alcohols gave quantum yields for products formation (an aldehyde or a ketone and protonated 4-cyanopyridinium) of approximately 15-20, at reactant concentrations of approximately 0.02-0.04 M. The reaction can also be sensitized with triplet benzopheone, which in this case acts as an electron donor. Energetic limitations on chain propagation are imposed by the relationship between the oxidation potential of the alpha-hydroxy radical and the reduction potential of the pyridinium salt. The chain reactions proceed despite approximately 0.25 eV endothermicity for the electron-transfer step. Chain reactions with the harder-to-reduce 4-phenyl-N-methoxypyridinium, however, are limited in scope because of increased endothermicity for electron transfer. The thioxanthone-sensitized reaction of P1 with benzhydrol was studied in detail by a combination of steady state and transient kinetics. The bimolecular rate constants for the chain propagation reactions:hydrogen atom abstraction by the methoxy radical and electron transfer from the diphenylketyl radical to P1 are approximately 6 x 10(6) and 1.1 x 10(6) M(-1) s(-1), respectively. The kinetic data indicate that deuterium atom abstraction by the methoxy radical from the solvent, acetonitrile-d(3), is a dominant chain-terminating process. Because of a large deuterium isotope effect, approximately 7, the quantum amplification is strongly suppressed when the reaction is carried out in acetonitrile.