Effect of loop distortion on the stability and structural dynamics of DNA hairpin and dumbbell conjugates

The thermal stability and conformational dynamics of DNA hairpin and dumbbell conjugates having short A-tract base pair domains connected by tri- or hexa(ethylene glycol) linkers is reported. The formation of stable base-paired A-tract hairpins having oligo(ethylene glycol) linkers requires a minimum of four or five A-T base pairs. The formation of base-paired dumbbells having oligo(ethylene glycol) linkers by means of chemical ligation of nicked dumbbells requires a minimum of two A-T base pairs on either side of the nick. Molecular modeling indicates that the hexa(ethylene glycol) linker is sufficiently long to permit formation of strain-free loop regions and B-DNA base pair domains. In contrast, the tri(ethylene glycol) is too short to permit Watson-Crick base pairing between the bases attached to the linker. The shorter linker distorts the duplex, resulting in fluxional behavior in which the base pairs adjacent to the linker and at the open end of the hairpin dissociate on the nanosecond time scale. The loss of interstrand binding energy caused by these fluctuations leads to a difference of approximately 5 degrees C in melting temperature between EG3 and EG6 hairpins. An analysis of the fluxional behavior of the EG3 adjacent base-pair has been used to study the pathways for base flipping and base stacking, including the identification of rotated base (partially flipped) intermediates that have not been described previously for A-T base pairs.     

Synthesis,structure, and photochemistry of exceptionally stable synthetic DNA hairpins with stilbene diether linkers

The structure and properties of 18 hairpin-forming bis(oligonucleotide) conjugates possessing stilbene diether linkers are reported. Conjugates possessing bis(2-hydroxyethyl)stilbene 4,4'-diether linkers form the most stable DNA hairpins reported to date. Hairpins with as few as two T:A base pairs or four noncanonical G:G base pairs are stable at room temperature. Increasing the length of the hydroxyalkyl groups results in a decrease in hairpin thermal stability. On the basis of the investigation of their circular dichroism spectra, all of the hairpins investigated adopt B-DNA structures, except for a hairpin with a short poly(G:C) stem which forms a Z-DNA structure. Both the strong fluorescence of the stilbene diether linkers and their trans-cis photoisomerization are totally quenched in hairpins possessing neighboring T:A and G:C base pairs. Quenching is attributed to an electron-transfer mechanism in which the singlet stilbene serves as an electron donor and T or C serves as an electron acceptor. In contrast, in denatured hairpins and hairpins possessing neighboring G:G base pairs the stilbene diether linkers undergo efficient photoisomerization.     

Structure and electronic spectra of DNA mini-hairpins with G(n):C(n) stems

The solution structure of a synthetic DNA mini-hairpin possessing a stilbenediether linker and three G:C base pairs has been obtained using (1)H NMR spectral data and constrained torsion angle molecular dynamics. Notable features of this structure include a compact hairpin loop having a short stilbene-guanine plane-to-plane distance and approximate B-DNA geometry for the three base pairs. Comparison of the electronic spectra of mini-hairpins having one-to-four G:C base pairs and stilbenediether or hexamethyleneglycol linkers reveals the presence of features in the UV and CD spectra of the stilbene-linked hairpins that are not observed for the ethyleneglycol-linked hairpins. Investigation of the electronic structure of a stilbene-linked hairpin having a single G:C base pair by means of time-dependent density functional theory shows that the highest occupied molecular orbital, but not the lowest unoccupied molecular orbital, is delocalized over the stilbene and adjacent guanine. The calculated UV and CD spectra are highly dependent upon hairpin conformation, but reproduce the major features of the experimental spectra. These results illustrate the utility of an integrated experimental and theoretical approach to understanding the complex electronic spectra of pi-stacked chromophores.     

Charge-transfer and spin dynamics in DNA hairpin conjugates with perylenediimide as a base-pair surrogate

A perylenediimide chromophore (P) was incorporated into DNA hairpins as a base-pair surrogate to prevent the self-aggregation of P that is typical when it is used as the hairpin linker. The photoinduced charge-transfer and spin dynamics of these hairpins were studied using femtosecond transient absorption spectroscopy and time-resolved EPR spectroscopy (TREPR). P is a photooxidant that is sufficiently powerful to quantitatively inject holes into adjacent adenine (A) and guanine (G) nucleobases. The charge-transfer dynamics observed following hole injection from P into the A-tract of the DNA hairpins is consistent with formation of a polaron involving an estimated 3-4 A bases. Trapping of the (A 3-4) (+*) polaron by a G base at the opposite end of the A-tract from P is competitive with charge recombination of the polaron and P (-*) only at short P-G distances. In a hairpin having 3 A-T base pairs between P and G ( 4G), the radical ion pair that results from trapping of the hole by G is spin-correlated and displays TREPR spectra at 295 and 85 K that are consistent with its formation from (1*)P by the radical-pair intersystem crossing mechanism. Charge recombination is spin-selective and produces (3*)P, which at 85 K exhibits a spin-polarized TREPR spectrum that is diagnostic of its origin from the spin-correlated radical ion pair. Interestingly, in a hairpin having no G bases ( 0G), TREPR spectra at 85 K revealed a spin-correlated radical pair with a dipolar interaction identical to that of 4G, implying that the A-base in the fourth A-T base pair away from the P chromophore serves as a hole trap. Our data suggest that hole injection and transport in these hairpins is completely dominated by polaron generation and movement to a trap site rather than by superexchange. On the other hand, the barrier for charge injection from G (+*) back onto the A-T base pairs is strongly activated, so charge recombination from G (or even A trap sites at 85 K) most likely proceeds by a superexchange mechanism.     

DNA as helical ruler: exciton-coupled circular dichroism in DNA conjugates

The structure and properties of oligonucleotide conjugates possessing stilbenedicarboxamide chromophores at both ends of a poly(dA):poly(dT) base-pair domain of variable length have been investigated using a combination of spectroscopic and computational methods. These conjugates form capped hairpin structures in which one stilbene serves as a hairpin linker and the other as a hydrophobic end-cap. The capping stilbene stabilizes the hairpin structures by ca. 2 kcal/mol, making possible the formation of a stable folded structure containing a single A:T base pair. Exciton coupling between the stilbene chromophores has little effect on the absorption bands of capped hairpins. However, exciton-coupled circular dichroism (EC-CD) can be observed for capped hairpins possessing as many as 11 base pairs. Both the sign and intensity of the EC-CD spectrum are sensitive to the number of base pairs separating the stilbene chromophores, as a consequence of the distance and angular dependence of exciton coupling. Calculated spectra obtained using a static vector model based on canonical B-DNA are in good agreement with the experimental spectra. Molecular dynamics simulations show that conformational fluctuations of the capped hairpins result in large deviations of the averaged spectra in both the positive and negative directions. These results demonstrate for the first time the ability of B-DNA to serve as a helical ruler for the study of electronic interactions between aligned chromophores. Furthermore, they provide important tests for atomistic theoretical models of DNA.     

Differential solvation and tautomer stability of a model base pair within the minor and major grooves of DNA

2-(2'-Hydroxyphenyl)benzoxazole (HBO) may be used as a model base pair to study solvation, duplex environment, and tautomerization within the major and minor groves of DNA duplexes. In its ground state, HBO possesses an enol moiety which may be oriented syn or anti relative to the imino nitrogen of the benzoxazole ring. In the absence of external hydrogen-bond donors and acceptors HBO exists as the internally hydrogen-bonded syn-enol, a mimic of the rare base pair tautomer found in DNA, which may be photoinduced to tautomerize and form the keto tautomer, a mimic of the dominant base pair tautomer. Previously, we demonstrated that when incorporated into DNA such that the enol moiety is positioned in the major groove, HBO is not solvated, exists exclusively as the internally hydrogen-bonded syn-enol which is efficiently photoinduced to tautomerize, and the corresponding keto tautomer is preferentially stabilized. In stark contrast, we now show that when HBO is incorporated in DNA such that the enol moiety is positioned in the minor groove, the enol tautomer is preferentially stabilized. Molecular dynamics simulations suggest that this results from the formation of a stable hydrogen-bond between the HBO enol and the O4' atom of an adjacent nucleotide, an H-bond acceptor that is only available in the minor groove. The differential stabilization of the enol and keto tautomers in the major and minor grooves may reflect the functions for which these environments evolved, including duplex replication, stability, and recognition.     

Synthesis and properties of nicked dumbbell and dumbbell DNA conjugates having stilbenedicarboxamide linkers

The synthesis and properties of nicked dumbbell and dumbbell DNA conjugates having A-tract base pair domains connected by rod-like stilbenedicarboxamide linkers are reported. The nicked dumbbells have one to eight dA-dT base pairs and are missing a sugar-phosphate bond either between the linker and a thymine nucleoside residue or between two thymine residues. Chemical ligation of all of the nicked dumbbells with cyanogen bromide affords the dumbbell conjugates in good yield, providing the smallest mini-dumbbells prepared to date. The dumbbells have exceptionally high thermal stability, whereas the nicked dumbbells are only marginally more stable than the hairpin structures on either side of the nick. The structures of the nicked dumbbells and dumbbells have been investigated using a combination of circular dichroism spectroscopy and molecular modeling. The base pair domains are found to adopt normal B'-DNA geometry and thus provide a helical ruler for studies of the distance and angular dependence of electronic interactions between the chromophore linkers.     

Recognition of nine base pairs in the minor groove of DNA by a tripyrrole peptide-Hoechst conjugate.

A tripyrrole peptide-Hoechst conjugate (FPH-1) has been designed which recognizes nine dA/dT base pair A/T rich dsDNA sequences at subnanomolar concentrations and complexes its targets at near diffusion controlled rates to form a fluorescent product. Spectrofluorometric titrations show the stoichiometry of the complex to be (FPH-1)(2):dsDNA. Spectrofluorometric titrations were also employed to determine the product of the equilibrium constant for complexation (K(1)K(2)) of dsDNA by two FPH-1 molecules for 35 different oligomeric duplexes. Single base pair mismatches in the FPH-1 binding site were found to cause significant decreases in K(1)K(2) of 18- to 2300-fold. Thermal denaturation experiments provided similar results. Arguments are presented which favor the structure of the (FPH-1)(2):dsDNA minor groove complex to involve the two FPH-1 molecules in a slightly staggered, side-by-side, and antiparallel arrangement such that the bis-benzimidazole moiety of one FPH-1 molecule lies adjacent to the tripyrrole moiety of the second FPH-1 molecule.     

Removal of a single minor-groove functional group eliminates A-tract curvature

Much of the work in studying the phenomenon of A-tract curvature has involved the insertion of modified residues into the A-tract sequence and then cross-correlation of the structural differences with the resulting curvature effects. In the A-tract sequence d(A-T)5, removal of a single functional group (the O2-carbonyl of the central dT residue) by its replacement with hydrogen completely eliminates the curvature properties. This atom-specific change was accomplished by using the C-nucleoside dm32P in which the O2-carbonyl is replaced with -H but normal Watson-Crick hydrogen bonding is maintained. Similar derivatives with -F (dF62P) or -CH3 (dm62P) when present for the central dT residue also eliminate curvature. Finally, we have shown that the extent of curvature for sequences containing this carbonyl are sensitive to the [Mg2+], while those lacking the carbonyl show little to no Mg2+ dependence, strongly suggesting, we believe, a role for Na+/Mg2+ cooperative interactions in the minor groove to explain the curvature phenomenon.     

Alpha- and beta-stilbenosides as base-pair surrogates in DNA hairpins

The synthesis, structure, and optical spectroscopy of hairpin oligonucleotide conjugates possessing synthetic stilbene C-nucleosides (stilbenosides) are reported. Synthetic methods for selective preparation of both the alpha- and beta-stilbenosides have been developed. Both anomers are effective in stabilizing hairpin structures when used as capping groups at the open end of the hairpin base-pair domain. However, only the beta-anomer effectively stabilizes the hairpin structure when located in the interior of the base-pair domain opposite an abasic site. Similar results are obtained for hairpins possessing two stilbenosides, either adjacent to each other or with one intervening base-pair. Molecular dynamics simulations are employed to obtain averaged structures for these conjugates. The calculated structures for the capped hairpins formed with either anomer show effective pi-stacking with the adjacent base-pair. The calculated structures for the internal stilbenosides show that the alpha- and beta-anomers form extrahelical and intrahelical structures, respectively. The relative orientations of the two stilbenes in the bis-stilbenosides have been studied using a combination of exciton-coupled circular dichroism spectroscopy and molecular modeling.     

High-resolution structure of an extended A-tract: [d(CGCAAATTTGCG)]2

The crystal structure of [d(CGCAAATTTGCG)]2 has been determined to 1.5 A resolution, representing the first high-resolution structure of this DNA fragment. The ion interactions are novel. A spermine molecule replaces a Mg2+ observed in analogous structures. Unlike lower-resolution structures, the minor groove is narrow and the major groove lacks extra Watson-Crick hydrogen bonds. In addition, a monolayer of solvent sites, including a "spine of hydration", is visible in the minor groove. The crystal of [d(CGCAAATTTGCG)]2 was grown from a solution containing spermine, magnesium, and lithium. The conformation recapitulates that of "monovalent-minus" DNA.     

Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) tethering a Hoechst 33258 analogue: triplex and duplex stabilization by simultaneous minor groove binding

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.     

Phenanthrene‐Derived DNA Hairpin Mimics

Self‐complementary oligodeoxynucleotides containing 3,6‐disubstituted phenanthrenes adopt highly stable, hairpin‐like structures. The thermodynamic stability of the hairpin mimics depends on the overall length of the phenanthrene building block. Hairpin loops composed of a phenanthrene‐3,6‐dicarboxamide and ethylene linkers were found to be optimal. The hairpin mimics are more stable than the analogous hairpins containing either a dT₄ or dA₄ tetraloop. Model studies indicate that the thermodynamic stability of the hairpin mimics is primarily due to aromatic stacking of the phenanthrene‐3,6‐dicarboxamide onto the adjoining base pair of the DNA duplex.     

Probing RNA hairpins with cobalt(III)hexammine and electrospray ionization mass spectrometry

In this work, electrospray ionization mass spectrometry (ESI MS) was employed to study the interactions of cobalt(III) hexammine, Co(NH3)6(3+), with five RNA hairpins representing the 790 loop of 16S ribosomal RNA and 1920 loop of 23S ribosomal RNA. The RNAs varied in mismatch identity (G.U versus A.C) and level of base modification (pseudouridine versus uridine). Co(NH3)6(3+) binding was observed with the four RNA hairpins that contained a G.U wobble pair in the stem region. ESI MS revealed 1:1 and 1:2 complex formation with all RNAs. Weaker binding was observed with the fifth RNA hairpin that contained an A.C wobble pair in the stem region. The effects of pH on Co(NH3)6(3+) binding were also examined.     

Amplified analysis of DNA by the autonomous assembly of polymers consisting of DNAzyme wires

A systematic study of the amplified optical detection of DNA by Mg(2+)-dependent DNAzyme subunits is described. The use of two DNAzyme subunits and the respective fluorophore/quencher-modified substrate allows the detection of the target DNA with a sensitivity corresponding to 1 × 10(-9) M. The use of two functional hairpin structures that include the DNAzyme subunits in a caged, inactive configuration leads, in the presence of the target DNA, to the opening of one of the hairpins and to the activation of an autonomous cross-opening process of the two hairpins, which affords polymer DNA wires consisting of the Mg(2+)-dependent DNAzyme subunits. This amplification paradigm leads to the analysis of the target DNA with a sensitivity corresponding to 1 × 10(-14) M. The amplification mixture composed of the two hairpins can be implemented as a versatile sensing platform for analyzing any gene in the presence of the appropriate hairpin probe. This is exemplified with the detection of the BRCA1 oncogene.     

Molecular design of a pyrrole-imidazole hairpin polyamides for effective DNA alkylation

New hairpin polyamide-CPI (CPI = cyclopropylpyrroloindole) conjugates, compounds 12-14, were synthesized and their DNA-alkylating activities compared with the previously prepared hairpin polyamide, compound 1, by high-resolution denaturing gel electrophoresis with 450 base pair (bp) DNA fragments and by HPLC product analysis of the synthetic decanucleotide. In accord with our previous results, alkylation by compound 1 occurred predominantly at the G moiety of the sequence 5'-AGTCAG-3' (site 3). However, compound 12, in which the structure of the alkylating moiety of compound 1 is replaced with segment A of duocarmycin A DU-86 (CPI), did not show any DNA alkylating activity. In clear contrast, the hairpin CPI conjugate 13, which differs from compound 1 in that it lacks one Py unit and possesses a vinyl linker, alkylated the A of 5'-AGTCAG-3' (site 3) efficiently at nanomolar concentrations. Alkylation by compound 14, which has a vinyl linker, occurred at the A of 5'-AGTCCA-3' (site 6) and at several minor alkylation sites, including mismatch alkylation at A of 5'-TCACAA-3' (site 2). The significantly different reactivity of the alkylating hairpin polyamides 1, 12, 13, and 14 was further confirmed by HPLC product analysis by using a synthetic decanucleotide. The results suggest that hairpin polyamide--CPI conjugate 13 alkylates effectively according to Dervan's pairing rule, and with a new mode of recognition in which the Im-vinyl linker (L) pair targets G-C base pairs. These results demonstrate that incorporation of the vinyl-linker pairing with Im dramatically improves the reactivity of hairpin polyamide--CPI conjugates.     

Influence of the dynamic positions of cations on the structure of the DNA minor groove: sequence-dependent effects

Different models for minor groove structures predict that the conformation is essentially fixed by sequence and has an influence on local ion distribution or alternatively that temporal positions of ions around the minor groove can affect the structure if they neutralize cross-strand phosphate charges. Our previous studies show that the minor groove in an AATT dodecamer responds to local sodium ion positions and is narrow when ions neutralize cross-strand phosphate-phosphate charges [J. Am. Chem. Soc. 2000, 122, 10513-10520]. Previous results from a number of laboratories have shown that G-tracts often have a wider minor groove than A-tracts, but they do not indicate whether this is due to reduced flexibility or differences in ion interactions. We have undertaken a molecular dynamics study of a d(TATAGGCCTATA) duplex to answer this question. The results show that the G-tract has the same amplitude of minor groove fluctuations as the A-tract sequence but that it has fewer ion interactions that neutralize cross-strand phosphate charges. These results demonstrate that differences in time-average groove width between A- and G-tracts are due to differences in ion interactions at the minor groove. When ions neutralize the cross-strand phosphates, the minor groove is narrow. When there are no neutralizing ion interactions, the minor groove is wide. The population of structures with no ion interactions is larger with the GGCC than with the AATT duplex, and GGCC has a wider time-average minor groove in agreement with experiment.     

In silico footprinting of ligands binding to the minor groove of DNA

The sequence selectivity of small molecules binding to the minor groove of DNA can be predicted by "in silico footprinting". Any potential ligand can be docked in the minor groove and then moved along it using simple simulation techniques. By applying a simple scoring function to the trajectory after energy minimization, the preferred binding site can be identified. We show application to all known noncovalent binding modes, namely 1:1 ligand:DNA binding (including hairpin ligands) and 2:1 side-by-side binding, with various DNA base pair sequences and show excellent agreement with experimental results from X-ray crystallography, NMR, and gel-based footprinting.     

Crossover from superexchange to hopping as the mechanism for photoinduced charge transfer in DNA hairpin conjugates

The mechanism and dynamics of photoinduced charge separation and charge recombination have been investigated in synthetic DNA hairpins possessing donor and acceptor stilbenes separated by one to seven A:T base pairs. The application of femtosecond broadband pump-probe spectroscopy, nanosecond transient absorption spectroscopy, and picosecond fluorescence decay measurements permits detailed analysis of the formation and decay of the stilbene acceptor singlet state and of the charge-separated intermediates. When the donor and acceptor are separated by a single A:T base pair, charge separation occurs via a single-step superexchange mechanism. However, when the donor and acceptor are separated by two or more A:T base pairs, charge separation occurs via a multistep process consisting of hole injection, hole transport, and hole trapping. In such cases, hole arrival at the electron donor is slower than hole injection into the bridging A-tract. Rate constants for charge separation (hole arrival) and charge recombination are dependent upon the donor-acceptor distance; however, the rate constant for hole injection is independent of the donor-acceptor distance. The observation of crossover from a superexchange to a hopping mechanism provides a "missing link" in the analysis of DNA electron transfer and requires reevaluation of the existing literature for photoinduced electron transfer in DNA.     

Influence of Mg(2+) on the guanine-cytosine tautomeric equilibrium: simulations of the induced intermolecular proton transfer

Metallic ions are essential for stabilizing the nucleic acid structure, and are also involved in the majority of RNA and DNA biological functions. However, at large concentrations metals may play an opposite role by promoting alterations in the genetic code (mutagenicity). To contribute to the understanding of this effect, theoretical tools are used to investigate the influence of the magnesium dication on the guanine-cytosine (GC) base pair structure and stability. To this end, a fully hydrated Mg(2+) cation is inserted in two models: an isolated GC base pair, and a more realistic DNA model corresponding to a hydrated double-stranded trimer. Calculations performed with a hybrid ONIOM approach reveal that the Mg(2+) cation coordination to the GC base pair alters drastically the natural tautomeric equilibria in DNA by promoting single proton transfer. Nevertheless, the generated rare tautomer will have a limited impact on the total spontaneous mutation due to the low back-reaction barrier allowing a quick return to the canonical form. Additionally, it is demonstrated that the major effects of biological environment arise from the hydration and stacking influence, whereas the impact of phosphate groups is minor.